Team:NU Kazakhstan/InterLab Study

Nazarbayev University Team

iGEM 2015 Measurement InterLab Study

1. iGEM distribution kit 2015 was used for this Measurement InterLab study. The following parts were transformed into E.coli dh5alpha strain:

  1. BBa_I13504 2015 kit plate 3, Well 17C
  2. BBa_J23101 (called K823005 when in pSB1C3) 2015 kit Plate 1, Well 20K
  3. BBa_J23106 (called K823008 when in pSB1C3) 2015 kit Plate 1, Well 22A
  4. BBa_J23117 (called K823013 when in pSB1C3) 2015 Kit Plate 1, Well 22K
2. Next day we observed colonies on chloramphenicol selective plates. One colony from each plate was put into 5 mL LB + 5 ul chloramphenicol (33 µg/ml). After 8 hours mini- prep was performed by using PureLink Quick Plasmid Miniprep Kit - Life Technologies.
3. Polymerase Chain Reaction was performed on each part using Prefix-F(GAATTCGCGGCCGCTTCTAG) and Suffix-R(CTGCAGCGGCCGCTACTAGTA) Primers. After that, PCR products were purified with QIAquick PCR Purification Kit.

PCR mixture

  1. High Fidelity Master Mix – 10 ul
  2. Prefix-F primer – 2 ul (0.5 ng/ul)
  3. Suffix-R primer – 2 ul (0.5 ng/ul)
  4. DNA (final concentration) - 0.5 ng/ul
  5. Sterile water to 20 ul
  6. Overall volume = 20 ul

PCR protocol

  1. 98 C - 30 sec
  2. 98 C - 10 sec
  3. 56 C - 30 sec
  4. 72 C - 30 sec for 1 kb
  5. Go to 2, 35X
  6. 72 C - 5 min

Devices construction

1. First, purified PCR products of BBa_K823005, BBa_K823008, BBa_K823013 that were digested with SpeI (NEB enzyme). PCR product of BBa_I13504 was digested with XbaI (NEB enzyme).

  1. DNA – 1000ng
  2. Cut Smart buffer – 5 ul
  3. Restriction Enzyme – 1 ul
  4. Sterile water to 50 ul.
Incubation for 37°C for 1 hour.
Heat inactivation at 80°C for 20 min.
Then, restriction digest reaction was cleaned up with QIAGEN MinElute reaction clean up kit. Concentrations were measured with Nanodrop.
2.Ligation reactions was set up for following parts
  1. J23101+ I13504
  2. J23106 +I13504
  3. J23117 + I13504
Reaction set up for ligation, ratio 1:3, GFP: promoter
  1. Promoter – 20-35 ng
  2. GFP - 50 ng
  3. 10X T4 DNA Ligase Buffer – 1 ul
  4. T4 DNA Ligase – 0.5 ul
  5. Nuclease free water to 10 ul
Incubation was performed overnight at 16°C.
Heat inactivation for 10 minutes at 65°C.
3.We used PCR-after-ligation method described in the following paper '' A PCR-after-ligation method for cloning of multiple DNA inserts'' (2010) by Yingfeng An, Wenfang Wu, Anguo Lv.
  1. Ligation product – 0.5 ul
  2. Prefix-F primer – 2 ul (0.5 ng/ul)
  3. Suffix-R primer – 2 ul (0.5 ng/ul)
  4. DNA (final concentration) - 0.5 ng/ul
  5. Sterile water to 20 ul
Results: Photo below shows that GFP+promoter is higher than just GFP without promoter

Figure 1. A PCR-after-ligation. Lanes are:
  1. Ladder 1 kb+
  2. J23106+ I13504 (35 bp + 10 bp(scar) + 875 bp)
  3. J23117 +I13504 (35 bp + 10 bp(scar) + 875 bp)
  4. Control: BBa_I13504(875 bp)
* J23101+ I13504 part was ligated and a pcr-after-ligation was performed in the same way.
4.Gel extract was performed using PureLink Quick Gel Extraction Kit - Life Technologies.
5.We used Circular Polymerase Extension Cloning (CPEC) method for inserting Anderson promoter+ GFP part into linearized plasmid backbone (pSB1C3). This method was described in a paper '' Circular polymerase extension cloning for high-throughput cloning of complex and combinatorial DNA libraries'' written by Jiayuan Quan, Jingdong Tian.
Reaction set up for CPEC:
  1. Linearized plasmid backbone= 200 ng
  2. Anderson promoter+ GFP = equimolar to backbone
  3. High Fidelity Master Mix = 10 ul
  4. DMSO= 0.75 ul
  5. Sterile water to 25 ul
PCR program for CPEC: Results: 10 ul of CPEC reaction was run on a gel. The successful incorporation has shown a band on 2980 bp (2070 backbone+ 875 GFP + 35 Anderson promoter)
Figure 2. CPEC reaction.
5 ul of CPEC reaction were transformed into E.coli DH5alpha. After 16 hours, colonies were observed. When colonies were observed under UV, green color was seen. Finally, these cells were grown and measured by VarioScan apparatus in the following manner.