Template:Team:Groningen/CONTENT/EXPERIMENTS/PCR a21
00:00, 3 September 2015 - 00:00, 3 September 2015
PCR with purified DNA of abrB KO BD1807 and control 168 Bacillus subtilis strains.
Sequence primer forward:
Type of primer
sequence
Sequence primer forward
GAAGTGTACGATGCTTACC
Sequence primer reverse
CGGTAGTTTCCAAGACATTACTG
Recombination primer forward
CTGCAGCGGCCGCTACTAGTAGCGGAAGATACGAGGCAAAC
Recombination primer reverse
GAATTCGCGGCCGCTTCTAGAGAGACGATCCGCGTATTTCCC
Primer sequences
The was primer sequenced for sequencing the pcr product.
Recombination primers for creating abrB knockout in a biobrick.
The bands of both PCR products had similar lenghts. Nonetheless, transformation preparations were performed with these samples since these PCR results were not interpreted as wrong at first. They were rightly interpreted at a later date.