Template:Team:Groningen/CONTENT/LOGBOOK/PCR a26
PCR_a26
Repeated PCR of abrB knock out from BD1807 strain and DNA provided by Jan Willem.
To knock out abrB in Bacillus subtilis strains to obtain a more rigid biofilm. AbrB suppresses biofilm formation. Knocking out AbrB should result in a more rigid biofilm.
PCR failed as no bands were found on agarose gel.
<a class="postscriptum protocol" href="https://2015.igem.org/Team:Groningen/Protocols_and_Protocols/PCR">PCR</a>
00:00, 2 September 2015 - 00:00, 2 September 2015
PCR of abrB KO from BD1807 strains and Veening DNA.
Sequence primer forward:
Type of primer
sequence
Sequence primer forward
GAAGTGTACGATGCTTACC
Sequence primer reverse
CGGTAGTTTCCAAGACATTACTG
Recombination primer forward
CTGCAGCGGCCGCTACTAGTAGCGGAAGATACGAGGCAAAC
Recombination primer reverse
GAATTCGCGGCCGCTTCTAGAGAGACGATCCGCGTATTTCCC
The was primer sequenced for sequencing the pcr product.
Recombination primers for creating abrB knockout in a biobrick.
PCR failed, as no bands were found on agarose gel.