Difference between revisions of "Team:TU Dresden/Project/Results/amplification"

(Created page with "{{:Team:TU_Dresden/Templates/Menu}} <html> <head> <style> #TueContent table img { width: 250px; display: block; margin-left: auto; margin-right: auto; padding-bo...")
 
 
(One intermediate revision by the same user not shown)
Line 61: Line 61:
 
   <p style="line-height:1.8">ATATATCTGCAGCGGCCGCTAGTATTA</p>
 
   <p style="line-height:1.8">ATATATCTGCAGCGGCCGCTAGTATTA</p>
  
 +
 +
  <p style="line-height:1.8">More information about these primers can be found in the following document:</p>
 +
 +
    <figure align="center">
 +
    <embed src="https://static.igem.org/mediawiki/2015/1/1e/TU_Dresden_info_primers.pdf" width="800" height="450" type='application/pdf'>
 +
    </figure>
 +
 +
<h3 style="text-align:center;"><a style="text-decoration:none;" href="#top"><font color="#045FB4">To the top!</font></a></h3>
  
 
</div>
 
</div>
 
</html>
 
</html>

Latest revision as of 12:56, 18 September 2015


Amplification of HER2 fragment

The amplification of the HER2 framgnet from the Biobrick plasmid pIDTSMART-KAN was performed using the following primers:

subcl_fwd

ATATATGCTAGCGCCGGCAACCAGGAGGTGA

subcl_rev

ATATATCTGCAGCGGCCGCTAGTATTA

More information about these primers can be found in the following document:

To the top!