Revision as of 14:31, 16 September 2015

Project

The Synthesizer
Background
Unleash the OGRE!
Optimization of OGRE
Oligo Software
Modifying surfactin
Expression of tyrocidine
Lab-on-chip Screening
Intein
Detection of NRP
Chip Library
References

The Synthesizer
Background
Unleash the OGRE!
Optimization of OGRE
Oligo Software
Modifying surfactin
Expression of tyrocidine
Lab-on-chip Screening
Intein
Detection of NRP
Chip Library
References

Scroll down for more

The Synthesizer

Nonribosomal petides (NRP) are a diverse class of short, bioactive peptides isolated from plant, fungi, and bacteria. Clinical uses of NRPs include antibiotics, immunosuppressants, antifungal, and antitumor drugs [1]. The diversity in bioactivity of these peptides can be explained in the way they are synthesized [2]. They are synthesized by highly modular enzymes called nonribosomal peptide synthetases (NRPS). Through repeated condensations of more than 500 different amino acids in an assembly line manner, they synthesize a range of diverse peptides with a range of different activities [3]. Discovery of novel NRP has a large potential in drug discovery, but is limited by the accelarating cost of drug development [4,5]. Some existing nonribosomal peptide on the market are associated with severe side-effects [6] or reduced activity due to resistance [7], while the implementation of other potential NRP drugs are limited due to their toxicity [8]. There is therefore the potential for improvement of already existing NRP drugs; an area which is largely unexploited due to the complexity of NRPS. The DTU Synthesizer Team sought to solve this problem by building a novel platform for generating libraries of NRP drugs that can be screened for improved activity, reduced side-effect, or toxicity. The libraries are made using directed evolution of NRPS using libraries of short single-stranded DNA (ssDNA). The four steps of The Synthesizer is: MISSING Expression, Libraries, Screening, and Modelling (Figure # MISSING). We sought to optimize each step of the cycle to improve the platform. In addition to potentially improving drugs, our platform can also expand our knowledge of these large multidomain proteins that due to their size are hard to study.

Background

Unlike proteins, nonribosomal peptides are not synthesized through translation, but rather by sequential condensation of amino acids by large multimodular enzymes called nonribosomal peptide synthetases (NRPS) [1,9]. In fact, it is these complex pattern of condensation of amino acids that attributes to the activity of these compounds. NRPSs do not rely on an external template for synthesis of their products. They can be divided up in modules that each are responsible for incorporating one additional amino acid onto the growing peptide chain much like an assembly line (Figure MISSING#) [2]. At the end of the assembly line, the growing peptide is released as a linear peptide or through cyclization.

Each module, with the exception of the initiation, consists of at least three domains. These domains are responsible for activating the monomer (adenylation (A) domain), holding the activated monomoer (peptidyl carrier protein (PCP) domain), and amino acid condensation (condensation (C) domain). The C-domain is lacking in initation modules and the terminal module contains an additional required domain responsible for termination and release of the product called thioesterase (TE) domain [9].

Adenylation domains

The Adenylation domains are responsible for activating and attaching the amino acid monomers to the PCP domain. They act as gatekeepers, ensuring that only the desired monomers are incorporated. They may be highly specific, only binding a single amino acid, or as in the case with Tyrocidine, see below, allow multiple similar amino acids to be incorporated in the peptide [2]. In the late 1990's the so called specificity-conferring code of A domains was revealed [10]. This code consists of the 10 amino acids, which were identified by sequence alignments to the first solved A domain crystal structure PheA [11], that are responsible for substrate binding (READ MORE MISSING).

Peptidyl carrier protein domains

The monomers are covalently bound to the PCP domains through thioester bonds. Before they can accept the monomers, they must be activated by posttranslational modification. A 4'-phosphopantetheinyl transferases (PPTase) transfers a 4'-phosphopantetheine (4'-PP) moiety, carrying the sulfhydryl group required for thioester bond formation, from coenzyme A to a conserved serine residue in the PCP domain [9].

Condensation domains

Elongation of the peptidyl chain is performed by the C domains, which catalyze the condensation of the peptidyl chain bound to the upstream PCP domain and the amino acid bound to the downstream PCP domain. These domains have a strong stereoselectivity and may have some specificity towards the side chain of the amino acid incorporated by the A domain of the same module, whereas little specificity has been observed towards the peptidyl chain [12].

Thioesterase domains

MISSING

Engineering of NRPS

With a pool of more than 500 different amino acid monomers, a peptide of only nine monomers have almost infite possibilities of composition. Yet, to our knowledge, improvement of existing NRP drugs through genomic engineering of NRPS in vivo still remains unaccomplished. This is perhaps surprising as it for long has been possible to predict NRPS clusters/operon by genomic mining and in addition predict NRP products by analysis of adenylation domains [13?5]. A classical engineering approach is therefore to simple combine modules with known specificity into a synthetic assembly line. Two years ago, the iGEM team from Heidelberg tried to imrpove synthesis of synthetic peptides by combining different modules (MISSING LINK TO THEIR WIKI). In addition, they implemented a NRPS module (indC) which produces a blue compound and they combined this module with other NRPS module to produce tagged peptides. Such a tagging system would greatly improve the synthesis of synthetic NRPS-derived peptides, but to our knowledge, it has not been possible to repeat the experiment within the group at Heidelberg since then. The reason why synthetic modular-based design of NRPS is not yet possible, may be explained by recent insight into NRPS structure provided by structural analysis [11,16]. Crystallization of NRPS is complicated by their large size and mobile structure, but domain-specific crystallisation and other structural analysis has highlighted that specific interactions between individual modules in NRPS is crucical for the catalytic acivity and subsequently transfer of the growing peptide to the next module [16].

Prediction of adenylation domain specificity

Table 1 Stachelhaus code showing position in Stachelhaus code (as defined my multiple alignment) with A-domain specificity. The data consists of 160 A-domain. [10]

Domain	Position (Stachelhaus code)										Similarity
	235	236	239	278	299	302	322	330	331	317
Aad	E	P	R	N	I	V	E	F	V	K	94%
Ala	D	L	L	F	G	I	A	V	L	K	55%
Asn	D	L	T	K	L	G	E	V	G	K	90%
Asp	D	L	T	K	V	G	H	I	G	K	100%
Cys(1)	D	H	E	S	D	V	G	I	T	K	96%
Cys(2)	D	L	Y	N	L	S	L	I	W	K	88%
Dab	D	L	E	H	N	T	T	V	S	K	100%
Dhb/Sal	P	L	P	A	Q	G	V	V	N	K	83%
Gln	D	A	Q	D	L	G	V	V	D	K	100%
Glu(1)	D	A	W	H	F	G	G	V	D	K	95%
Glu(2)	D	A	K	D	L	G	V	V	D	K	95%
Ile(1)	D	G	F	F	L	G	V	V	Y	K	92%
Ile(2)	D	A	F	F	Y	G	I	T	F	K	100%
Leu(1)	D	A	W	F	L	G	N	V	V	K	99%
Leu(2)	D	A	W	L	Y	G	A	V	M	K	100%
Leu(3)	D	G	A	Y	T	G	E	V	V	K	100%
Leu(4)	D	A	F	M	L	G	M	V	F	K	97%
Orn(1)	D	M	E	N	L	G	L	I	N	K	100%
Orn(2)	D	V	G	E	I	G	S	I	D	K	98%
Phe	D	A	W	T	I	A	A	V	C	K	88%
Phg/hPhg	D	I	F	L	L	G	L	L	C	K	80%
Pip/Pip-@	D	F	Q	L	L	G	V	A	V	K	75%
Pro	D	V	Q	L	I	A	H	V	V	K	87%
Ser	D	V	W	H	L	S	L	I	D	K	90%
Thr/Dht	D	F	W	N	I	G	M	V	H	K	91%
Tyr(1)	D	G	T	I	T	A	E	V	A	K	100%
Tyr(2)	D	A	L	V	T	G	A	V	V	K	80%
Tyr(3)	D	A	S	T	V	A	A	V	C	K	78%
Val(1)	D	A	F	W	I	G	G	T	F	K	96%
Val(2)	D	F	E	S	T	A	A	V	Y	K	94%
Val(3)	D	A	W	M	F	A	A	V	L	K	95%
Variability	3%	16%	16%	39%	52%	13%	26%	23%	26%	0%

antiSMASH predicts NRPS clusters by patially Hidden Markov Models. It also predicts a consensus product by integrating three different methods for predictions of adenylation domain specificity These methods are: NRPSpredictor2, Stachelhaus, and Minova et al. [15,17]. Stachelhaus et al. alligned the binding pocket of 160 adenylation domains using a structural alignment approach. By trimming of the sequence 10 core amino acids encoding specificity in the binding pocket was identified giving rise to the Stachelhaus code (Table # MISSING). In addition, it was shown that by modying the binding pocket in silico substrate affinity could be altered or relaxed [10].

Prediction is sometimes complicated by the fact that adenylation domains sometimes show more or less variability in amino acid specificity. In addition, the Stachelhaus code show some redundance in the 160 sequences [10]. Tyrocidine is an example of this. Tyrocidine is a commercially available mixture of non-ribosomal antibiotic synthesized by Brevibacillus parabrevis. It consists of four decapeptides varying at three amino acids (MISSING Table #) and is synthetiszed by the NRPS, Tyrocidine Synthetase A-C, containing 1, 3, and 6 modules, respetively. (Figure # MISSING HIGHER UP MICHAEL).

Tyrocidine has an unique mode of acton wherein it disrupts the function of the cell membrane. Unfortunately, it has high toxicity towards human blood and reproductive cells and can only be used in topical applications. This makes tyrocidine an interesting target for drug improvement. Under MISSING section you can read more about improvement of tyrocidine.

Table 2 Tyrocidine variability

Amino acid position

Tyrocidine

3

4

7

A

L-Phe

D-Phe

L-Tyr

B

L-Trp

D-Phe

L-Tyr

C

L-Trp

D-Trp

L-Tyr

D

L-Trp

D-Trp

L-Trp

Potential NRP targets for drug improvement

In addition to tyrocidine, ciclosporin (or cyclosporin) is an important nonribosomal peptide drug used as an immunosuppressant in transplantations [6]. It consists of eleven amino acids which are cyclized upon releasing from the NRPS, like tyrocidine and contains D-amino acids and amino acids with modifications (Figure #). It was first isolated from the filamentous fungi Tolypocladium inflatum in 1969 and in 1972, its function as immunosuppresant was discovered by Sandoz (now Novartis). Despite, its widely use in clinal applications it is associated with side effects (adverse drug reactions) [6]. In ciclosporin G which is also isolated from Tolypocladium inflatum, the a-aminobutyric acid residue in position 2 has been replaced by norvaline [18]. Ciclosporin G has reduced side effects in some clinical applications and it highlights the possibility of drug improvement by NRPS engineering. A total of 25 derivates of ciclosporin are known [?]. Comparing the number of known derivates to the actual potential diversity in compounds of an 11-mer cyclic peptide (11⁵⁰⁰), only a very little fraction of potential compounds are known. Even substitution of a single amino acid would yield more than 5,000 different compounds that could be screened for improved function.

Hypothesis: Targetted engineering of adenylation domains using OGRE

As highlihgted above, there are multiple potential NRPS candidates that can be used for drug improvement through screening of NRP products, synthesized by modifying the Stachelhaus code of the adenylation domain. The limitation has been the limited genetic tools available for engineering of NRPS. Considering that the Tyrocidine Synthase is 1.25*10⁶ Da which is approximately the size of the large subunit of the prokaryotic ribosome, this is perhaps not surprising. Even though that the changes required to potentially alter the specificity of the A-domain (~1-10 amino acids) according to the Stachelhaus code, transformation requires introduction of selection a casettes. As each NRPS module is ~1,500 amino acid and often multiple modules are encoded in one open reading frame, even few modifications require assembly and introduction of large expression casettes. For example the NRPS responsible to ciclosporin synthesis in Tolypocladium inflatum is encoded in a single gene simA encoding one 45.8 kb exon [?]. Amplification of 45.8 kb nucleotides is not feasable with standard PCR and would be considerable expensive to synthesize by even cheap errorprone DNA synthesis methods (calculated based on prices from IDT for gblock synthesis).

We hypothesized that NRPS directed evolution targetting the Stachelhaus code could lead to improvement of NRP drugs. We proposed that the recent advantge in oligo mediated reecombineering (OGRE) using short single-stranded DNA (ssDNA) can be applied to generate this diversity. While OGRE has low efficiencies, it is actually an advantge for generation of libraries, as multiplex and automated targetting with a library of oligos will create a library of different compounds.

Oligo mediates recombineering

Recombination-mediated genetic engineering or recombineering (we call it OGRE) utlises homologous recombination to facilitate genetic modifications at any desired target by flanking the mutated sequence with homologous regions. One system for recombineering in E. coli is the λ phage derived λ Red, consisting of the genes encoding three proteins, Gam, Exo and Beta. Gam prevents degradation of linear dsDNA by inhibition of nucleases, Exo degrades dsDNA in a 5'-3' direction yielding ssDNA, and Beta facilitates recombination by binding to the ssDNA [19].

Multiplex Automated Genome Engineering (MAGE)

Wang et al. developed a method for rapid and efficient targeted evolution of cells through cyclical recombineering with ssDNA (oligo) in E. coli. Using this automated method, they more than five-fold improved lycoprene production in E. coli in three days [20]. Through MAGE it is possible to simultaneously target many different loci or target the same locus with a pool of multiple and/or degenerate oligos. By using multiple oligos targetting the same locus, it is possible to generate a library of mutants varying only at the target locus in a short amount of time. The genetic variation in the population of cells will be a function of the degenerate pool complexity and combinatorial arrangements of the modifications at different loci and can be used to modify e.g. the active site of an enzyme [20,21].

The MAGE protocol utilises the λ Red recombination system in combination with an (temporary) inactivation of the mismatch repair system and consists of seven steps that can be done with standard laboratory equipment [21]. As MAGE utilises oligos, only the Beta protein of the λ Red system is required. In short, the cells are grown to mid-log phase, followed by induction of beta. The cells are then chilled to 4°C and washed with cold water to make the cells competent. The oligos are added to the cells which are then electroporated. The cycle is repeated every 2-3 hours allowing the cells to recover in between rounds of electroporations [21].
See figure.

Chip-based oligonucleotide synthesis

Traditional column-based oligo synthesis is costly for large scale MAGE experiments. Synthesis of 1,000 90-mer column-based oligos costs about 36,000 USD [22]. An alternative to this method is to use Microchip DNA arrays to synthesize the oligos on, with the advantage that the price scales with the number of chips instead of the number of oligos. Thus it is possible to have up to 12,472 130-mer oligos synthesized for 2,000 USD and up to 92,918 oligos for 5,000 USD (http://customarrayinc.com/oligos_main.htm).

This method however comes with a few disadvantages. The oligo amount comes in the picomolar range and is delivered as a single mix of all the oligos. Because of these disadvantages, an extra processing step is required before they can be used in MAGE experiments.

The oligos are synthesized with two 20 nucleotide flanking sequences (barcodes). These barcodes must include a thymidine immediately upstream and a DpnII restriction site immediately downstream of the oligo, while the rest of the barcodes can be designed for amplification with a specific primer. By using different barcodes, it is possible to design one oligo chip for multiple MAGE experiments. The thymidine allows amplification with an uracil-containing primer. In these primers U is substituted for T in the primer. The barcode can then be excited from the oligo using USER enzyme, DnpII, and a guide primer [22].

Oligo design

While the recombination frequency of MAGE can be increased by doing multiple cycles, care should be taken when designing oligos to ensure high efficiency for each individual cycle. There are several parameters that can be optimized to increase the recombination frequency.

The oligos should target the lagging strand of the replication fork as this is 10-100 times more efficient compared to targetting the leading strand, and the folding energy of the oligo should be considered, as it may form hairpins if it is too low, preventing incorporation.

The frequency is also dependent on the length of the oligo, as shorter oligos are less efficient due to their lower hybridization energy to the chromosome, while longer oligos have a higher tendency to form hairpins. 70-90-mer oligos seem to be the most efficient in E. coli [21].

Designing many optimized oligos for MAGE experiment is a time consuming task. Considering a 90-mer oligo with a single mismatch and 15nt homology arms results in 60 possible oligos with different secondary structures and consequently different recombineering efficiencies. Much of the time spent on designing oligos can be saved by using the online tool MODEST [23].

Oligo mediated recombineering in Bacillus subtilis

While the described λ Red reecombineering system is well exploited in E. coli the last years, the technology has not been adopted for genome editing to the same extend in other microorganisms. Application of λ Red reecombineering system has been described in Bacillus subtilis (ARTICLE 2012), but with longer oligos of approx. 2,000 nucletoides generated by PCR [24]. Besides expression of Beta, Sun et al. also expressed homologous recombinases from other phages. The gene product of region 35 (GP35) from the native B. subtilis phage SPP1 to Beta. Gene product of region 34 (GP34) encodes an endonuclease similar to λ Exo and GP35 is a recombinase protein homologous and GP36 is an ssDNA binding protein [25,26]. This native Bacilli reecombineering system yielded higher efficiency compared to λ Red in B. subtilis, but lower efficiency in E. coli [24]. Based on heteroloogus expression of many recombinases of different origin in Bacillus subtilis, it was included that recombineering efficiencies were optimised by using a recombinase derived from a phage which host was closely related to heterologous host. We noticed that codon usage of lambda beta is not optimal for expression of B. subtilis and that expression level (likeli due to codon usage) varried among the recombinases tested in the study. In addition, the length of the oligo tested is drastically different from the optimal length in E. coli based on the λ Red Lambda recombineering system.

Unleash the OGRE!

(Purpose: To make oligo reecombineering (we call this OGRE) in B. subtilis.)

Making small and prisice changes in the genome of a bacteria can be extreamly powerfull if you can standardize a method to do so.

We made a method for inserting small changes in the genome of B. subtilis. By using our Oligo Recombineering (OGRE) method we inserted small changes in the genome we showed that we can change the function of different genes with a high efficiency. The method was shown to work by knocking out the upp gene and making Bacillus resistant to streptomycin

Knock out of upp and amyE

As a prof of concept we knocked out the amyE and upp locus in B. subtilis by using oligoes that insert a stop codon in the coding sequence of the coding sequence. The oligoes were designed using the program MODEST ( ? link til modest ). We tried to use amyE and upp to calculate the transformation efficiency of the OGRE technique, but the results were to unclear to measure efficiency. The upp selection indicated that the knockout was possible but that the transformant grew slowly. The amyE screening could not give any conclusive results. The starch plates and 5-Fluorouracil (5-FU) plates were mixed with a deffined minimal medium ( ? see protocol for for minimal medium)

Name	Oligo	Length	point mutation position
mage_amyE-1	AAGTAACGGTTGCCAATTTGATACGATGTCGGCTGATACAGtCAtTACtAGTTCGACATGCTTTTATCTCCTTGATTCCCTTCCTTTACT	90	?
mage_upp-1	GGGTAATTTCAAATGCCATGAGTGTAGCCACTTCATCTACTtACTaTCaAAAATCCTTCGTACCTGTATTTTCATTCCGTATATATGTCA	90	?

Method

B. subtilis strain 168 with GP35 or lambda beta inserted in amyE or mutS knockouts were made electrocompetent using protocol ( ? link electro protocol). amyE and upp were electroporated with the oligoes shown above (see link to protocol ?). Prior to the experiment the mutant were grown over night in 5y neomycin. and plated on minimal medium with 1% starch for amyE or 25uM for 5-FU. ( ? see procol for minimal medium)

Results

The amyE screening showed to be too difficult to interpret clear results from therefor this selection was abandond. The 5-FU were incubated for 3 days before colonies were visible

? SHow pictures

It can be shown that some of the colonies had the upp locus knocked out there by making them resistent to the toxin 5-FU. This coused the cells to grew on the minimal plates shown on picture ?

Because of the long growth time this selection was not effective or clear enough to calculate the frequency of tranformation.

Growth experiment for mutants

We were interested in testing if the mutations made in the amyE or mutS would change the growth rate of the B. subtilis compared to the wild type. It was indicated by Sun et al. 2015 ( [24] ) that the growth rate of the GP35 mutant would be lower than the wild type strain. Our experiment could not suport this theory. It was not possible to find any significant different in the growthrates of any of the strains tested in this experiment.

Method

An over night culture of wild type, mutS:GP35, mutS:lambda beta, amyE:GP35 and amyE:lambda beta were inoculated in LB.

A 16 fold dilution of each of the inoculated cultures was made in growth medium.

The inoculated growth medium (LB with 0.5M sorbitol) was incubated at 30dec shaking at 200rpm.

The OD was measured continually until it reached 0.85.

Results

It seems that the mutS:GP35 had a faster growth in the exponential phase. When looking at the function given from the graf it is clear that the growth rate is the same for all samples mesured.

Graf (?) Here all the OD mesurements can be seen.

B subtilis strain	rate (mu)	Generationrate	R²
Wild type	0.0155	45min	0.9546
amyE:GP35	0.02	35min	0.9883
amyE:lambda beta	0.0193	36min	0.9849
mutS:GP35	0.0184	38min	0.9330
mutS:lambda beta	0.0178	39min	0.9450

Table of calculated results from experiment.

Plot ?. The four different mutants generationrate can here be compared to the wild type. The errorbares indicate the 5% error of every generationrate. The y axes is mesured in minuttes.

Incerting streptomycine recistens with one point mutation

The streptomycin resistance only requires one point mutation in the gene known as rpsL. This point mutation is lysine to arginine at position 56.

An oligo with the necessary change was transformed by electroporation of the B. subtilis.

Method

Protocol for electrocompetent Bacillus subtilis 168

An over night culture of bacillus subtilis 168 with lambda beta incerted into mutS was prepared in LB media with 5y neo at 37dec shaken at 200rpm.

The protol for making electrocompetent Bacillus was followed. ? see link to protocol

Protocol for multiplex OGRE cycles in Bacillus subtilis 168

We hypothesized that if the OGRE protocol was repeated multiple times the amount of transformants would rise. This was tested by running four cycles of the OGRE protocol. The progress could be followed by plating a dilution of the sample on streptomycin plates after every round and calculating the start value of the culture from the OD₆₀₀ measurements.

Materials

( ? see procol for multiplex OGRE)

Optimization of OGRE

Purpose: tp optimise the conditions, tests of oligos

why

To optimize our new OGRE method we made different experiment testing the optimal amount of oligo and length. The mismatch frequency for multiple mismatches was also quantified.

how

optimal olig amount for OGRE

The same protcol as shown for streptomycine ( make link ? ) was used where the amount of oligo used was veried form 0.2-25uL

OD calculator

The Imperial iGEM 2008 team has made a equation for calculating CFU from OD600. We tried to validate there formulary by using our own results. The hope was to make a calculator that could calculate what type of dilution would be needed to give you accurate results with out having to use up a lot of agar plates for unnecessary dilutions. We could not get measurements that were accurate enough to validate the Imperical iGEM 2008.

Results

compare with impirial 2008 formula and show data.

put link to there page and make link to own data.

finding frequency of mutation

Same protcol as shown for streptomycine ( make link ? ) where the oligoes with 1-6 mismatches were tested.

optimizing oligo length

the protocol for changing streptomycin ( ? incert link ) was used for oligo's with one mismatch but with verying lengths from 50-100nt were also tested.

Materials

same materials used as in protocol for changing streptomcine resistens ( ? incert link)

Oligo Software

Modifying surfactin

As a proof of concept, we tried to modify surfactin synthase to substitute aspartic acid in surfactin with aspargine using oligo mediated recombineering.

Achivements

MISSING

Experimental design

Surfactin (Figure # MISSING) is a surfactant cyclic lipopeptide produced by Bacillus subtilis. It is important for sporulation in B. subtilis [27]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). antiSMASH prediction of adenylation domain specificity corresponds to surfactant. The NRPS modules are divided out on three contigs (ctg1_353-5) with 3, 3, and 1 module, respectively (Figure # MISSING).

The second module (or module 5) of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp->Asn. Three different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table MISSING), yielding different number of mismatches in the oligo.

Table #MISSING List of oligos used to modify surfactin NRPS.

Name	Oligo	Length	Mutations (Stacelhaus)
Oligo1	catacagatcaacccgcccggcgatggcgccgaCcgttgcttctgtcgggccgtaCtCattgataaattcggtatgtccatacatcttac	90	H322E, I330S
Oligo3	ttcgcaaatgcatccggctcatacagatcaacccgcccggcgatggcgccgaCcgttgcttctgtcgggccgtaCtCattgataaattc ggtatgtccatacatcttacggaaggcgataacatcagtcgggatgattttttctcctcccaagaGgatcaagcgcaaggattcaaagttc gcatcttttgcaaaactggc	200	V299L, H322E, I330S

Methods

(??? whay is there 3 oligoes displated above !!??)

Electrocompetent B. subtilis was used with a mutS:lambda beta mutation was used. (see protocol for making eletrocompetent bacillus ? )

three oligoes were used for this experiment. Two different surfactin oligoes were used separately, and one streptomycin resisters oligo was used to select for the desired change.

100uL of cells was mixed with 5uL of the surfactine changing oligo and 0.5uL of an streptomycin resistance oligo was mixed in electroporation cuvettes, and incubated for 7min.

The electroporation cuvettes were electroporated with 2.2kV (1mm cuvettes). The run time should be 5.0-6ms. Optimal run time is 5.5ms

Immediately after electroporation the electroprated cells were incubated in 3mL Recovery Medium.

The cells were incubated for 4 hours at 30dec shaking at 220rpm.

after incubation OD was measured for each sample.

Samples were diluted to 10³ and 10⁴ .

The dilutions were plated on 500y streptomycin plates.

Plates were incubated for 2 days at 37dec.

Results

Oligo reecombineering competent strain (mutSΔ::GP35) was electroporated with oligo1 and oligo2 from Table MISSING. After recovery of cells for 3 hours, dilutions were plated on LB agar plates containing 5

Expression of tyrocidine

Tyrocidine has an unique mode of acton wherein it disrupts the function of the cell membrane. Unfortunately, it has high toxicity towards human blood and reproductive cells and can only be used in topical applications. This makes tyrocidine an interesting target for drug improvement. Under MISSING section you can read more about improvement of tyrocidine.

Lab-on-chip Screening

Intein

During the laboratory work, we experienced great difficulties with heterologous expression of the tyrocidine operon in Bacillus subtilis [read more link MISSING]. This inspired us to think of alternative approaches for production of nonribosomal peptide drugs than by NRPS. We came up with a peculiar idea of generating short cyclised peptides using inteins. Inteins are short peptide sequences that do not have an endogenous role in proteins. They are removed post translation by auto-catalysation. This forms a peptide bond between two amino acids while splicing out the N-intein and C-intein (Figure #MISSING). If the N-intein and C-intein are placed at each end of a polypeptide; cyclisation would give a cyclised protein - or in our case a short peptide.

Figure #Missing N-intein and C-intein is spliced out by forming a leftover extein scar of the size of the N-extein and C-extein. The size and amino acid sequenceof the scar depends on the source of the intein.

Achivements

Designed construct for expression of two short cyclic peptides using BioBrick BBa_K1362000 and two short primers.
Made the cyclisation construct in the laboratory.
Analyzed constructs by chomotography, though no products could be detected.
Improved characterization of BioBrick BBa_K1362000.

Background

Nonribosomal peptide synthetases do not have monopolly on production of bioactive nonribosomal peptides. CyBase contains 818 entries for ribosomal head-to-tail cyclised peptides from 105 different spieces [28]. The length of these cyclic peptides varry from 8-80 amino acids and they are often chracterized by having internal cysteine bridges [29]. Reported activities include anti-HIV, anti-cancer, anti-bacterial, and toxins and due to their high thermostability and resistantance against degredation by proteases, they may be used to increase bioavailability of peptide drugs. Alternatively, their biosynthesis may propose an alternative approach for synthesis of nonribosomal peptide drugs independently of NRPS.

Cyclisation of these protein occurs post translation and is mediated by short peptides that have autocatalytic activity. In one mechanism (Figure #MISSING), self-splicing peptide sequences (inteins) bind and catalyze their own excission while forming a peptide bond between the N-extein and C-extein. Numerous of inteins have been characterized including split intein Npu DnaE from Nostoc punctiforme PCC73102 (Npu) (Figure #MISSING) [30,31]. When the Npu DnaE intein auto-catalyze its own excisions, it leaves the six amino acid extein-scar behind. The native scar (AEY-CFN) can be modified at some positions and still yield splicing [31]. The cysteine of the first position in the C-extein was the only amino acid that could not be substituted.

The BioBrick BBa_K1362000 was introduced by Heidelberg in 2014. It contains Npu DnaE inteins surrounding a negative RFP selection marker, which can be exided by cutting with BsaI. Digestion with BsaI generates to overhangs with different sequence, thereby making direction specific introduction of coding sequence (CDS) for portein of interest into the cyclisation construct possible. The BioBrick was used to cyclise different proteins, but was to our knowledge not used to cyclise short peptides.

We decided to try and cyclise an synthetic ten amino acid peptide sequence, which was similar to tyrocidine. In addition, we searched the cyclic peptide database for bioactive cyclic peptide which contained part of the extein scar. The sequences for both native peptides along with the sequence chosen for cyclisation experiments are shown in Table #MISSING.

	Cycloviolacin Y1 (33 aa)[29]	Tyrocidine (10 aa)
Native	GGTIFDCGETCFLGTCYTPGCSCGNYGFCYGTN	F_DPF_DNQYVOrnL
Synthetic	GGTIFDCGETCFLGTCYTPGCSCGNYGFCYGTN	EYCFNQYVKA
Extein (N/C)	GET/CFL	AEY/CFN

Instead of digestion nucleotide sequences for these short peptides, the insert was made usign two short single stranded DNA (ssDNA) oligos.

Cycloviolacin Y1	5'-CAACTGCTTCCTTGGCACATGCTACACACCTGGCTGCTCTTGCGGCAACTAC GGCTTCTGCTACGGCACAAACGGCGGCACAATCTTCGATTGCGGCGAAACA-3' 5'-AGCATGTTTCGCCGCAATCGAAGATTGTGCCGCCGTTTGTGCCGTAGCAGAA GCCGTAGTTGCCGCAAGAGCAGCCAGGTGTGTAGCATGTGCCAAGGAAGCA-3'
Tyrocidine-like	5'-CAACTGCTTCAACCAATACGTTAAAGCTGAATAC-3' 5'-AGCAGTATTCAGCTTTAACGTATTGGTTGAAGCA-3'

Methods

MISSING

Chomatographic analysis of cyclic peptides

Transformants for analysis were re-streaked onto LB agar plates containing 6

Discussion

It was not possible to detect cyclised proteins from cell-extracts my MALDI-TOF. The size of the unspliced protein is 19.4 kDA (cycloviolacin Y1) and 17.2 kDa (tyrocidine-like).

Detection of NRP

Detection of Cyclic Peptide Synthatase Products

Introduction:

Separation and identification of our non-ribosomal peptide synthase (NRPS) products was determined by high performance liquid chromatography coupled to mass spectrometry (HPLC-MS). NRPS variants were identified by changes in mass and column retention time as well as fragmentation patterns. Development of a matrix assisted laser desorption ionization time-of-flight mass spec (MALDI-TOF-MS) method will allow for future rapid analysis of oligo-recombineered strains producing a library of NRPS antibiotic products. DTU’s 2015 iGEM team was able to procure the assistance of the DTU Metabolomics Platform group, which specializes in analytical chromatography and is recognized in our attributions page (Missing Link???). With assistance from our advisor, a protocol was established to lyse the cells and extract the Tyrocidine or Surfactin molecules before they were run on the liquid chromatography mass spec (LCMS) for analysis.

Background:

Tyrocidine and surfactin can both be separated by liquid chromatography, which separates molecules in a liquid mobile phase as they pass over a solid stationary media in a column. Molecules bind to or elute off the column based on their differing physical properties; including electronegativity, polarity, hydrophobicity, or size. Different detection methods (eg. mass spectroscopy, fluorescence detection, UV/Visible light spectroscopy) can then be coupled to the HPLC to analyze the compounds that were separated from the original solution. The reversed phase liquid chromatography column used in our method has a non-polar stationary phase and polar mobile phase, which causes polar molecules to elute before non-polar compounds. Initial preparative steps remove large contaminants from the sample such as the cell membranes or organelles, which can clog and damage the columns.

As there are many different metabolites produced by prokaryotic and eukaryotic cells, it is important to have an idea of the chemical properties and mass of the target compound. Tyrocidine is an amphiphilic, cyclic peptide naturally produced by a non-ribosomal peptide synthase (NRPS) in Bacillus brevis with antimicrobial properties against gram-positive bacteria¹. It functions to disrupt cell membranes, but has been shown to have high hemolytic activity², making it unsuitable for intravenous use. Tyrocidine has been reported in the literature to have 5 main forms with the general peptide sequence of …D-Phe₁/Tyr₁ – Pro₂ – Phe₃/Trp₃/Tyr₃ – D-Phe₄/D-Trp₄/D-Tyr₄ – Asn₅ – Gln₆/Asp₆ – Val₈ – Orn₉ – Leu₁₀… ³

Figure 1: Surfactin, highlighted with the blue circle at the location of the mutation from an aspartic acid residue to asparagine

Figure 2: cyclic NRP, Tyrocidine A

Chip Library

References

Walsh, C. T. (2008). The Chemical Versatility of Natural-Product Assembly Lines. Acc. Chem. Res., 41(1), 4–10. doi:10.1021/ar7000414
Strieker, M., Tanović, A., & Marahiel, M. A. (2010). Nonribosomal peptide synthetases: structures and dynamics. Current Opinion in Structural Biology, 20(2), 234–240. doi:10.1016/j.sbi.2010.01.009
Caboche, S., Leclere, V., Pupin, M., Kucherov, G., & Jacques, P. (2010). Diversity of Monomers in Nonribosomal Peptides: towards the Prediction of Origin and Biological Activity. Journal of Bacteriology, 192(19), 5143–5150. doi:10.1128/jb.00315-10
DiMasi, J. A., Hansen, R. W., & Grabowski, H. G. (2003). The price of innovation: new estimates of drug development costs. Journal of Health Economics, 22(2), 151–185. doi:10.1016/s0167-6296(02)00126-1
DiMasi, J. A., Grabowski, H. G., & Hansen, R. W. (2015). The Cost of Drug Development. N Engl J Med, 372(20), 1972–1972. doi:10.1056/nejmc1504317
Lee, J.-H. (2010). Use of Antioxidants to Prevent Cyclosporine A Toxicity. Toxicological Research, 26(3), 163–170. doi:10.5487/tr.2010.26.3.163
Henderson, J. C., Fage, C. D., Cannon, J. R., Brodbelt, J. S., Keatinge-Clay, A. T., & Trent, M. S. (2014). Antimicrobial Peptide Resistance of Vibrio cholerae Results from an LPS Modification Pathway Related to Nonribosomal Peptide Synthetases . ACS Chemical Biology, 9(10), 2382–2392. doi:10.1021/cb500438x
Kohli, R. M., Walsh, C. T., & Burkart, M. D. (2002). Biomimetic synthesis and optimization of cyclic peptide antibiotics. Nature, 418(6898), 658–661. doi:10.1038/nature00907
Finking, R., & Marahiel, M. A. (2004). Biosynthesis of Nonribosomal Peptides 1 . Annu. Rev. Microbiol., 58(1), 453–488. doi:10.1146/annurev.micro.58.030603.123615
Stachelhaus, T., Mootz, H. D., & Marahiel, M. A. (1999). The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chemistry & Biology, 6(8), 493–505. doi:10.1016/s1074-5521(99)80082-9
Conti, E. (1997). Structural basis for the activation of phenylalanine in the non-ribosomal biosynthesis of gramicidin S. The EMBO Journal, 16(14), 4174–4183. doi:10.1093/emboj/16.14.4174
Lautru, S. (2004). Substrate recognition by nonribosomal peptide synthetase multi-enzymes. Microbiology, 150(6), 1629–1636. doi:10.1099/mic.0.26837-0
Medema, M. H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M. A., … Breitling, R. (2011). antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 39(suppl), W339–W346. doi:10.1093/nar/gkr466
Weber, T., Blin, K., Duddela, S., Krug, D., Kim, H. U., Bruccoleri, R., … Medema, M. H. (2015). antiSMASH 3.0—a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Research, 43(W1), W237–W243. doi:10.1093/nar/gkv437
Blin, K., Medema, M. H., Kazempour, D., Fischbach, M. A., Breitling, R., Takano, E., & Weber, T. (2013). antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Research, 41(W1), W204–W212. doi:10.1093/nar/gkt449
Sundlov, J. A., Shi, C., Wilson, D. J., Aldrich, C. C., & Gulick, A. M. (2012). Structural and Functional Investigation of the Intermolecular Interaction between NRPS Adenylation and Carrier Protein Domains. Chemistry & Biology, 19(2), 188–198. doi:10.1016/j.chembiol.2011.11.013
Minowa, Y., Araki, M., & Kanehisa, M. (2007). Comprehensive Analysis of Distinctive Polyketide and Nonribosomal Peptide Structural Motifs Encoded in Microbial Genomes. Journal of Molecular Biology, 368(5), 1500–1517. doi:10.1016/j.jmb.2007.02.099
CALNE, R. (1985). CYCLOSPORIN G: IMMUNOSUPPRESSIVE EFFECT IN DOGS WITH RENAL ALLOGRAFTS. The Lancet, 325(8441), 1342. doi:10.1016/s0140-6736(85)92844-2
Mosberg, J. A., Lajoie, M. J., & Church, G. M. (2010). Lambda Red Recombineering in Escherichia coli Occurs Through a Fully Single-Stranded Intermediate. Genetics, 186(3), 791–799. doi:10.1534/genetics.110.120782
Wang, H. H., Isaacs, F. J., Carr, P. A., Sun, Z. Z., Xu, G., Forest, C. R., & Church, G. M. (2009). Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460(7257), 894–898. doi:10.1038/nature08187
Wang, H. H., & Church, G. M. (2011). Multiplexed Genome Engineering and Genotyping Methods. Synthetic Biology, Part B - Computer Aided Design and DNA Assembly, 409–426. doi:10.1016/b978-0-12-385120-8.00018-8
Bonde, M. T., Kosuri, S., Genee, H. J., Sarup-Lytzen, K., Church, G. M., Sommer, M. O. A., & Wang, H. H. (2015). Direct Mutagenesis of Thousands of Genomic Targets Using Microarray-Derived Oligonucleotides. ACS Synthetic Biology, 4(1), 17–22. doi:10.1021/sb5001565
Bonde, M. T., Klausen, M. S., Anderson, M. V., Wallin, A. I. N., Wang, H. H., & Sommer, M. O. A. (2014). MODEST: a web-based design tool for oligonucleotide-mediated genome engineering and recombineering. Nucleic Acids Research, 42(W1), W408–W415. doi:10.1093/nar/gku428
Sun, Z., Deng, A., Hu, T., Wu, J., Sun, Q., Bai, H., … Wen, T. (2015). A high-efficiency recombineering system with PCR-based ssDNA in Bacillus subtilis mediated by the native phage recombinase GP35. Applied Microbiology and Biotechnology, 99(12), 5151–5162. doi:10.1007/s00253-015-6485-5
Vellani, T. S., & Myers, R. S. (2003). Bacteriophage SPP1 Chu Is an Alkaline Exonuclease in the SynExo Family of Viral Two-Component Recombinases. Journal of Bacteriology, 185(8), 2465–2474. doi:10.1128/jb.185.8.2465-2474.2003
Seco, E. M., Zinder, J. C., Manhart, C. M., Lo Piano, A., McHenry, C. S., & Ayora, S. (2012). Bacteriophage SPP1 DNA replication strategies promote viral and disable host replication in vitro. Nucleic Acids Research, 41(3), 1711–1721. doi:10.1093/nar/gks1290
Nakano MM, Magnuson R, Myers A, Curry J, Grossman AD, Zuber P. srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol. 1991 Mar;173(5):1770-8
CyBase. September 15, 2015. http://www.cybase.org.au
Thorstholm L, Craik DJ. Discovery and applications of naturally occurring cyclic peptides. Drug Discov Today Technol. 2012;9:e13–e21. doi: 10.1016/j.ddtec.2011.07.005.
Zettler, J., Schütz, V., & Mootz, H. D. (2009). The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Letters, 583(5), 909–914. doi:10.1016/j.febslet.2009.02.003
Cheriyan, M., Pedamallu, C. S., Tori, K., & Perler, F. (2013). Faster Protein Splicing with the Nostoc punctiforme DnaE Intein Using Non-native Extein Residues. Journal of Biological Chemistry, 288(9), 6202–6211. doi:10.1074/jbc.m112.433094

Technical University of Denmark
Department of Systems Biology
Søltofts Plads 221
2800 Kgs. Lyngby
Denmark
P: +45 45 25 25 25
M: dtu-igem-2015@googlegroups.com

@@ Line 5: / Line 5: @@
-     <link href="/Team:DTU-Denmark/bootstrap.css?action=raw&ctype=text/css" rel="stylesheet">
+     <link href="/Team:DTU-Denmark/loadphpcss?action=raw&ctype=text/css" rel="stylesheet">
-     <link href="/Team:DTU-Denmark/font-awesome.css?action=raw&ctype=text/css" rel="stylesheet">
+    <link href="/Team:DTU-Denmark/bootstrapcss?action=raw&ctype=text/css" rel="stylesheet">
-     <link href="/Team:DTU-Denmark/wiki.css?action=raw&ctype=text/css" rel="stylesheet">
+     <link href="/Team:DTU-Denmark/font-awesomecss?action=raw&ctype=text/css" rel="stylesheet">
-     <link href="/Team:DTU-Denmark/timeline.css?action=raw&ctype=text/css" rel="stylesheet">
+     <link href="/Team:DTU-Denmark/wikicss?action=raw&ctype=text/css" rel="stylesheet">
-     <link href="/Team:DTU-Denmark/menufix.css?action=raw&ctype=text/css" rel="stylesheet">
+     <link href="/Team:DTU-Denmark/timelinecss?action=raw&ctype=text/css" rel="stylesheet">
+     <link href="/Team:DTU-Denmark/menufixcss?action=raw&ctype=text/css" rel="stylesheet">
-     <script type="text/javascript" src="/Team:DTU-Denmark/jquery.js?action=raw&ctype=text/javascript"></script>
+     <script type="text/javascript" src="/Team:DTU-Denmark/jqueryjs?action=raw&ctype=text/javascript"></script>
-     <script type="text/javascript" src="/Team:DTU-Denmark/bootstrap.js?action=raw&ctype=text/javascript"></script>
+     <script type="text/javascript" src="/Team:DTU-Denmark/bootstrapjs?action=raw&ctype=text/javascript"></script>
-     <script type="text/javascript" src="/Team:DTU-Denmark/jquery.easing.js?action=raw&ctype=text/javascript"></script>
+     <script type="text/javascript" src="/Team:DTU-Denmark/jqueryeasingjs?action=raw&ctype=text/javascript"></script>
-     <script type="text/javascript" src="/Team:DTU-Denmark/wiki.js?action=raw&ctype=text/javascript"></script>
+     <script type="text/javascript" src="/Team:DTU-Denmark/wikijs?action=raw&ctype=text/javascript"></script>
      <!-- MathJax (LaTeX for the web) -->
      <script src="https://2015.igem.org/common/MathJax-2.5-latest/MathJax.js?config=TeX-AMS-MML_SVG"></script>
@@ Line 37: / Line 38: @@
      <nav class="navbar navbar-default navbar-fixed-top" role="navigation">
        <!-- Brand and toggle get grouped for better mobile display -->
-       <div class="container">
+       <div class="container-fluid">
          <div class="navbar-header">
            <button type="button" class="navbar-toggle" data-toggle="collapse" data-target="#nav-collapse">
              <span class="sr-only">Toggle navigation</span>
              <i class="fa fa-bars"></i>
-            <!--span class="icon-bar"></span>
-            <span class="icon-bar"></span>
-            <span class="icon-bar"></span-->
            </button>
            <a class="navbar-brand navimg" href="#"><img src="/wiki/images/b/b7/DTU-Denmark_dtulogo.png"></a>
          </div>
          <!-- Collect the nav links, forms, and other content for toggling -->
          <div class="collapse navbar-collapse" id="nav-collapse">
-          <ul class="nav navbar-nav navbar-right hidden-lg hidden-xs">
-            <li>
-              <a href="https://igem.org" target="_blank" class="navimg">
-                <img src="/wiki/images/a/af/DTU-Denmark_igemlogo.png">
-              </a>
-            </li>
-          </ul>
-          <ul class="nav navbar-nav navbar-right hidden-xs">
-            <li>
-              <a href="http://facebook.com/dtubiobuilders" data-toggle="tooltip" data-placement="bottom" title="Follow us on Facebook">
-                <i class="fa fa-facebook"></i>
-              </a>
-            </li>
-            <li>
-              <a href="https://twitter.com/IGEM_DTU" data-toggle="tooltip" data-placement="bottom" title="Follow us on Twitter">
-                <i class="fa fa-twitter"></i>
-              </a>
-            </li>
-          </ul>
            <ul class="nav nav-justified">
@@ Line 89: / Line 67: @@
              <li >
-               <a class="active" href="/Team:DTU-Denmark/Collaborations">Collaborations</a>
+               <a class="active" href="/Team:DTU-Denmark/Part_Collection">Parts</a>
              </li>
@@ Line 96: / Line 74: @@
              </li>
-          </ul>
+            <li >
-          <ul class="nav navbar-nav navbar-right visible-xs">
+              <a class="active" href="/Team:DTU-Denmark/Software">Software</a>
-             <li>
+            </li>
+            <li >
+              <a class="active" href="/Team:DTU-Denmark/Achivements">Achievements</a>
+            </li>
+            <li class="hidden-xs">
+              <a href="http://facebook.com/dtubiobuilders" data-toggle="tooltip" data-placement="bottom" title="Follow us on Facebook">
+                <i class="fa fa-facebook"></i><span class="visible-xs"> Follow us on Facebook</span>
+              </a>
+             </li>
+            <li class="visible-xs"><a href="http://facebook.com/dtubiobuilders"><i class="fa fa-facebook-square"></i> Follow us on Facebook</a></li>
+            <li class="hidden-xs">
+              <a href="https://twitter.com/IGEM_DTU" data-toggle="tooltip" data-placement="bottom" title="Follow us on Twitter">
+                <i class="fa fa-twitter"></i>
+              </a>
+            </li>
+            <li class="visible-xs"><a href="https://twitter.com/IGEM_DTU"><i class="fa fa-twitter-square"></i> Follow us on Twitter</a></li>
+            <li class="hidden-lg">
                <a href="https://igem.org" target="_blank" class="navimg">
                  <img src="/wiki/images/a/af/DTU-Denmark_igemlogo.png">
                </a>
              </li>
-            <li><a href="http://facebook.com/dtubiobuilders"><i class="fa fa-facebook-square"></i> Follow us on Facebook</a></li>
-            <li><a href="https://twitter.com/IGEM_DTU"><i class="fa fa-twitter-square"></i> Follow us on Twitter</a></li>
            </ul>
          </div><!-- /.navbar-collapse -->
@@ Line 110: / Line 104: @@
      </nav>
      <nav class="navbar navbar-default extrabar hidden-xs hidden" data-spy="affix">
-       <div class="container" id="scrollspy">
+       <div class="container-fluid" id="scrollspy">
          <ul class="nav nav-justified">
-           <li><a class="page-scroll" href="#The-Synthesizer">The Synthesizer</a></li><li><a class="page-scroll" href="#Theory">Theory</a></li><li><a class="page-scroll" href="#Hypotheses">Hypotheses</a></li><li><a class="page-scroll" href="#Parts">Parts</a></li><li><a class="page-scroll" href="#Results">Results</a></li><li><a class="page-scroll" href="#Modelling">Modelling</a></li><li><a class="page-scroll" href="#Discussions">Discussions</a></li><li><a class="page-scroll" href="#Conclusions">Conclusions</a></li><li><a class="page-scroll" href="#References">References</a></li>
+           <li><a class="page-scroll" href="#The-Synthesizer">The Synthesizer</a></li><li><a class="page-scroll" href="#Background">Background</a></li><li><a class="page-scroll" href="#Unleash-the-OGRE">Unleash the OGRE!</a></li><li><a class="page-scroll" href="#Optimization-of-OGRE">Optimization of OGRE</a></li><li><a class="page-scroll" href="#Oligo-Software">Oligo Software</a></li><li><a class="page-scroll" href="#Modifying-surfactin">Modifying surfactin</a></li><li><a class="page-scroll" href="#Expression-of-tyrocidine">Expression of tyrocidine</a></li><li><a class="page-scroll" href="#Lab-on-chip-Screening">Lab-on-chip Screening</a></li><li><a class="page-scroll" href="#Intein">Intein</a></li><li><a class="page-scroll" href="#Detection-of-NRP">Detection of NRP</a></li><li><a class="page-scroll" href="#Chip-Library">Chip Library</a></li><li><a class="page-scroll" href="#References">References</a></li>
          </ul>
        </div>
@@ Line 122: / Line 116: @@
          </a>
        </div>
-       <div class="container">
+       <div class="container-fluid">
          <div class="row hero-text">
            <div class="col-md-12">
@@ Line 137: / Line 131: @@
                <li>
-                 <a id="Theory-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Theory">Theory</a>
+                 <a id="Background-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Background">Background</a>
                </li>
                <li>
-                 <a id="Hypotheses-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Hypotheses">Hypotheses</a>
+                 <a id="Unleash-the-OGRE-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Unleash-the-OGRE">Unleash the OGRE!</a>
                </li>
                <li>
-                 <a id="Parts-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Parts">Parts</a>
+                 <a id="Optimization-of-OGRE-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Optimization-of-OGRE">Optimization of OGRE</a>
                </li>
                <li>
-                 <a id="Results-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Results">Results</a>
+                 <a id="Oligo-Software-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Oligo-Software">Oligo Software</a>
                </li>
                <li>
-                 <a id="Modelling-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Modelling">Modelling</a>
+                 <a id="Modifying-surfactin-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Modifying-surfactin">Modifying surfactin</a>
                </li>
                <li>
-                 <a id="Discussions-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Discussions">Discussions</a>
+                 <a id="Expression-of-tyrocidine-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Expression-of-tyrocidine">Expression of tyrocidine</a>
                </li>
                <li>
-                 <a id="Conclusions-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Conclusions">Conclusions</a>
+                 <a id="Lab-on-chip-Screening-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Lab-on-chip-Screening">Lab-on-chip Screening</a>
+              </li>
+              <li>
+                <a id="Intein-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Intein">Intein</a>
+              </li>
+              <li>
+                <a id="Detection-of-NRP-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Detection-of-NRP">Detection of NRP</a>
+              </li>
+              <li>
+                <a id="Chip-Library-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Chip-Library">Chip Library</a>
                </li>
@@ Line 176: / Line 182: @@
                <li>
-                 <a id="Theory-submenu" class="page-scroll" href="#Theory">Theory</a>
+                 <a id="Background-submenu" class="page-scroll" href="#Background">Background</a>
                </li>
                <li>
-                 <a id="Hypotheses-submenu" class="page-scroll" href="#Hypotheses">Hypotheses</a>
+                 <a id="Unleash-the-OGRE-submenu" class="page-scroll" href="#Unleash-the-OGRE">Unleash the OGRE!</a>
                </li>
                <li>
-                 <a id="Parts-submenu" class="page-scroll" href="#Parts">Parts</a>
+                 <a id="Optimization-of-OGRE-submenu" class="page-scroll" href="#Optimization-of-OGRE">Optimization of OGRE</a>
                </li>
                <li>
-                 <a id="Results-submenu" class="page-scroll" href="#Results">Results</a>
+                 <a id="Oligo-Software-submenu" class="page-scroll" href="#Oligo-Software">Oligo Software</a>
                </li>
                <li>
-                 <a id="Modelling-submenu" class="page-scroll" href="#Modelling">Modelling</a>
+                 <a id="Modifying-surfactin-submenu" class="page-scroll" href="#Modifying-surfactin">Modifying surfactin</a>
                </li>
                <li>
-                 <a id="Discussions-submenu" class="page-scroll" href="#Discussions">Discussions</a>
+                 <a id="Expression-of-tyrocidine-submenu" class="page-scroll" href="#Expression-of-tyrocidine">Expression of tyrocidine</a>
                </li>
                <li>
-                 <a id="Conclusions-submenu" class="page-scroll" href="#Conclusions">Conclusions</a>
+                 <a id="Lab-on-chip-Screening-submenu" class="page-scroll" href="#Lab-on-chip-Screening">Lab-on-chip Screening</a>
+              </li>
+              <li>
+                <a id="Intein-submenu" class="page-scroll" href="#Intein">Intein</a>
+              </li>
+              <li>
+                <a id="Detection-of-NRP-submenu" class="page-scroll" href="#Detection-of-NRP">Detection of NRP</a>
+              </li>
+              <li>
+                <a id="Chip-Library-submenu" class="page-scroll" href="#Chip-Library">Chip Library</a>
                </li>
@@ Line 228: / Line 246: @@
          The Synthesizer
        </h1>
-       <p><span class="fa fa-chevron-circle-down fa-spin fa-spin fa-spin fa-spin" style="color:rgb(0, 0, 0);"></span></p>
+       <p style="text-align: justify;"><img alt="" src="None" style="height: 300px; width: 300px; float: right;" />Nonribosomal petides (NRP) are a diverse class of short, bioactive peptides isolated from plant, fungi, and bacteria.&nbsp;Clinical uses of NRPs include antibiotics, immunosuppressants, antifungal, and antitumor drugs [1]. The diversity in bioactivity of&nbsp;these peptides can be explained in the way they are synthesized&nbsp;[2]. They are synthesized by highly modular enzymes called&nbsp;nonribosomal peptide synthetases (NRPS). Through repeated condensations of more than 500 different amino acids in an assembly line manner, &nbsp;they synthesize a range of&nbsp;diverse peptides with a range of different activities [3].&nbsp;Discovery of novel NRP has&nbsp;a large potential in drug discovery, but is limited by the accelarating&nbsp;cost of drug development [4,5]. Some existing&nbsp;nonribosomal peptide on the market are associated with severe side-effects [6] or reduced activity due to resistance [7], while the implementation of other&nbsp;potential NRP drugs are limited due to&nbsp;their toxicity [8].&nbsp;There is therefore the&nbsp;potential for improvement of already existing NRP drugs; an area&nbsp;which is largely unexploited due to the complexity of NRPS.&nbsp;The DTU Synthesizer Team sought to solve this problem by building a novel platform for generating libraries of NRP drugs that can be screened for improved activity, reduced side-effect, or toxicity. The libraries are made using directed evolution of NRPS using libraries of short single-stranded DNA (ssDNA). The four steps of The Synthesizer is: MISSING Expression, Libraries, Screening, and Modelling (Figure <span style="color:#FF0000;"># MISSING</span>). We sought to optimize each step of the cycle to improve the platform.&nbsp;In addition to potentially improving drugs, our platform can also expand our knowledge of these large multidomain proteins that due to their size are hard to study.</p>
      </div>
@@ Line 235: / Line 253: @@
-<div id="Theory">
+<div id="Background">
    <div class="container">
      <div class="row col-md-12">
        <h1>
-         Theory
+         Background
        </h1>
-       <h2>Non-Ribosomal Peptide Synthetases</h2>
+       <p style="text-align: justify;">Unlike proteins, nonribosomal peptides&nbsp;are not synthesized through translation, but rather by sequential condensation of amino acids by large multimodular enzymes called nonribosomal peptide synthetases (NRPS) [1,9]. In fact, it is these complex pattern of condensation of amino acids that attributes to the activity of these compounds. NRPSs&nbsp;do not rely on an external template for synthesis of their products. They can be divided up in modules&nbsp;that each are responsible for incorporating one additional amino acid onto the growing peptide chain much like an assembly line (Figure MISSING<span style="background-color:#FFFF00;">#</span>) [2]. At the end of the assembly line, the growing peptide is released as a linear peptide or through cyclization.</p>
-<p>Nonribosomal peptides (NRP) are&nbsp;class of peptide secondary metabolites with a broad range of biological activities. Clinical uses include antibiotics, immunosuppressants, antifungal and antitumor drugs [1].&nbsp;</p>
+<p style="text-align: justify;"><img alt="" src="None" style="width: 1200px; height: 257px;" /></p>
-<p>The diversity of these peptides can be explained by the way they are synthesized&nbsp;[2]. NRPs are not synthesized through translation but rather by sequential condensation of amino acids by large multimodular enzymes called nonribosomal peptide synthetases (NRPS) [1,3].&nbsp;These NRPSs do not rely on external templates in order to synthesize their products but carry their own within their amino acid sequence. They consist of multiple modules that each are responsible for incorporating one additional amino acid unto the growing peptide chain much like an assembly line&nbsp;[2].</p>
+<p style="text-align: justify;">Each module, with the exception of the initiation, consists of at least three domains.&nbsp;These domains are responsible for activating the monomer (adenylation (A) domain), holding the activated monomoer (peptidyl carrier protein (PCP) domain), and amino acid condensation (condensation (C) domain). The C-domain&nbsp;is lacking in initation modules and the terminal module contains an additional required domain responsible for termination and release of the product called thioesterase (TE) domain&nbsp;[9].</p>
-<p>Each module, with the exception of the initiation, consists of at least three domains, these domains are responsible for activating the monomer (adenylation (A) domain), holding the activated monomoer (peptidyl carrier protein (PCP) domain) and amino acid condensation (condensation (C) domain). The latter is lacking in initation modules and the terminal module contains an additional required domain responsible for termination and release of the product (thioesterase (TE) domain)&nbsp;[3].</p>
+<h4>Adenylation domains</h4>
-<p>In some modules the condensation domain is replaced by a cyclisation domain leading to cyclic structures and other optional modules mediate modifications of the incorporated monomers, such as methylation and oxidation domains. Epmerisation domains facilitate the incorporation of D-amino acids&nbsp;[4]. In fact more than 500 monomers have been identified in NRPs and these peptides often have a complex structure including branches and cycles giving them their biological activities&nbsp;[5]</p>
+<p style="text-align: justify;">The Adenylation domains are responsible for activating and attaching&nbsp;the amino acid monomers to the PCP domain. They act as&nbsp;gatekeepers, ensuring that only the desired monomers are incorporated. They may be highly specific, only binding a single amino acid, or as in the case with Tyrocidine, see below, allow multiple similar amino acids to be incorporated in the peptide [2].&nbsp;In the late 1990&#39;s the so called&nbsp;specificity-conferring code of A domains was revealed [10]. This code consists of the 10 amino acids, which were identified by sequence alignments to the first solved A domain crystal&nbsp;structure PheA [11], that are responsible for substrate binding (<span style="color:#FF0000;">READ MORE MISSING</span>).</p>
-<h3>Adenylation domains</h3>
+<h4>Peptidyl carrier protein domains</h4>
-<p>The Adenylation domains are responsible for activating and attaching&nbsp;the amino acid monomers to the PCP domain. They act as&nbsp;gatekeepers, ensuring that only the desired monomers are incorporated. They may be highly specific, only binding a single amino acid, or as in the case with Tyrocidine, see below, allow multiple similar amino acids to be incorporated in the peptide [2].</p>
+<p style="text-align: justify;">The monomers are covalently bound to the PCP domains through thioester bonds. Before they can accept the monomers, they must be activated by posttranslational modification. A 4&#39;-phosphopantetheinyl transferases (PPTase) transfers a&nbsp;4&#39;-phosphopantetheine&nbsp;(4&#39;-PP)&nbsp;moiety, carrying the sulfhydryl group required for thioester bond formation,&nbsp;from coenzyme A to a conserved serine residue in the PCP domain&nbsp;[9].</p>
-<p>In the late 1990&#39;s the so called&nbsp;specificity-conferring code of A domains was revealed [6]. This code consists of the 10 amino acids, which were identified by sequence alignments to the first solved A domain crystal&nbsp;structure PheA [7], that are responsible for substrate binding.</p>
+<h4>Condensation domains</h4>
-<h3>Peptidyl carrier protein domains</h3>
+<p style="text-align: justify;">Elongation of the peptidyl chain is performed by the C domains, which catalyze the condensation of the peptidyl chain bound to the upstream PCP domain and the amino acid bound to the downstream PCP domain. These domains have a strong stereoselectivity and may have some specificity towards the side chain of the amino acid incorporated by the A domain of the same module, whereas little specificity has been observed towards the peptidyl chain&nbsp;[12].</p>
-<p>The monomers are covalently bound to the PCP domains through thioester bonds. Before they can accept the monomers, they must be activated by posttranslational modification. A 4&#39;-phosphopantetheinyl transferases (PPTase) transfers a&nbsp;4&#39;-phosphopantetheine&nbsp;(4&#39;-PP)&nbsp;moiety, carrying the sulfhydryl group required for thioester bond formation,&nbsp;from coenzyme A to a conserved serine residue in the PCP domain&nbsp;[3].</p>
+<h4>Thioesterase domains</h4>
-<h3>Condensation domains</h3>
+<p style="text-align: justify;"><span style="color:#FF0000;">MISSING</span></p>
-<p>Elongation of the peptidyl chain is performed by the C domains, which catalyze the condensation of the peptidyl chain bound to the upstream PCP domain and the amino acid bound to the downstream PCP domain. These domains have a strong stereoselectivity and may have some specificity towards the side chain of the amino acid incorporated by the A domain of the same module, whereas little specificity has been observed towards the peptidyl chain&nbsp;[8].</p>
+<h2>Engineering of NRPS</h2>
-<h3>Thioesterase domains</h3>
+<p style="text-align: justify;">With a pool of more than 500 different amino acid monomers, a peptide of only nine&nbsp;monomers have almost infite possibilities of composition. Yet,&nbsp;to our knowledge, improvement of existing NRP drugs through&nbsp;genomic engineering of NRPS <em>in vivo </em>still remains unaccomplished. This is perhaps surprising as it for long has been possible to predict NRPS clusters/operon by genomic mining and in addition predict NRP products by analysis of adenylation domains&nbsp;[13?5]. A classical engineering approach is therefore to simple combine modules with known specificity into a synthetic assembly line. Two years ago, the iGEM team from Heidelberg tried to imrpove synthesis of synthetic peptides by combining different modules (MISSING LINK TO THEIR WIKI). In addition, they implemented a NRPS module (indC) which produces a blue compound and they combined this module with other NRPS module to produce&nbsp;tagged peptides. Such a tagging system would greatly improve the synthesis of synthetic NRPS-derived peptides, but to our knowledge, it has not been possible to repeat the experiment within the group at Heidelberg&nbsp;since then. The reason why synthetic modular-based design of NRPS is not yet possible, may be explained by recent insight into NRPS structure provided by structural analysis [11,16].&nbsp;Crystallization of NRPS is complicated by their large&nbsp;size and mobile structure, but domain-specific crystallisation and other structural analysis&nbsp;has&nbsp;highlighted&nbsp;that specific&nbsp;interactions between individual modules in NRPS is&nbsp;crucical for the catalytic acivity and subsequently transfer of the growing peptide to the next module [16].</p>
-<p>...</p>
+<h3><strong>Prediction of&nbsp;adenylation domain specificity</strong></h3>
-<h3>Epimerization domains</h3>
+<table align="right" border="0" cellpadding="0" cellspacing="0" class="table-responsive" style="font-size: 8pt; overflow-y: hidden; width: 35%; margin-left: 10px;">
+	<tbody>
+		<tr>
+			<td>
+			<p>&nbsp;</p>
-<p>D-amino acids may be incorporated directly in their D-form or may be the result of an epimerization domain, in which case the C domain controls the stereoselectivity, ensuring incorporation of the correct isomer&nbsp;[5,8].</p>
+			<p style="text-align: justify;"><strong>Table 1&nbsp;</strong>Stachelhaus code showing position in Stachelhaus code (as defined my multiple alignment) with A-domain specificity. The data consists of 160 A-domain. [10]</p>
-<h2>Tyrocidine</h2>
+			<table align="right" border="0" cellpadding="0" cellspacing="0" class="table table-hover" style="font-size:8pt;">
+				<thead>
+				</thead>
+				<tbody>
+					<tr>
+						<th>Domain</th>
+						<th colspan="10" rowspan="1" style="text-align: center;">Position (Stachelhaus code)</th>
+						<th>Similarity</th>
+					</tr>
+					<tr>
+						<td>&nbsp;</td>
+						<td style="text-align: center;">235</td>
+						<td style="text-align: center;">236</td>
+						<td style="text-align: center;">239</td>
+						<td style="text-align: center;">278</td>
+						<td style="text-align: center;">299</td>
+						<td style="text-align: center;">302</td>
+						<td style="text-align: center;">322</td>
+						<td style="text-align: center;">330</td>
+						<td style="text-align: center;">331</td>
+						<td style="text-align: center;">317</td>
+						<td style="text-align: center;">&nbsp;</td>
+					</tr>
+					<tr>
+						<td>Aad</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">P</td>
+						<td style="text-align: center;">R</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">N</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">94%</td>
+					</tr>
+					<tr>
+						<td>Ala</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">F</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">G</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">55%</td>
+					</tr>
+					<tr>
+						<td>Asn</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">E</span></td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">90%</td>
+					</tr>
+					<tr>
+						<td>Asp</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">H</td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Cys(1)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">H</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">S</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">96%</td>
+					</tr>
+					<tr>
+						<td>Cys(2)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">Y</span></td>
+						<td style="text-align: center;">N</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">S</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">88%</td>
+					</tr>
+					<tr>
+						<td>Dab</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">H</td>
+						<td style="text-align: center;">N</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">S</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Dhb/Sal</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">P</span></td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">P</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;">Q</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">N</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">83%</td>
+					</tr>
+					<tr>
+						<td>Gln</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">Q</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Glu(1)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;">H</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">G</span></td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">D</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">95%</td>
+					</tr>
+					<tr>
+						<td>Glu(2)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">95%</td>
+					</tr>
+					<tr>
+						<td>Ile(1)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">F</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">Y</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">92%</td>
+					</tr>
+					<tr>
+						<td>Ile(2)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">Y</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Leu(1)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">F</span></td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">N</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">99%</td>
+					</tr>
+					<tr>
+						<td>Leu(2)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">Y</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">M</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Leu(3)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">Y</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Leu(4)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">M</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">M</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">97%</td>
+					</tr>
+					<tr>
+						<td>Orn(1)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">M</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">N</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">N</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Orn(2)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">S</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">98%</td>
+					</tr>
+					<tr>
+						<td>Phe</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">T</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;">C</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">88%</td>
+					</tr>
+					<tr>
+						<td>Phg/hPhg</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">F</span></td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">C</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">80%</td>
+					</tr>
+					<tr>
+						<td>Pip/Pip-@</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">F</span></td>
+						<td style="text-align: center;">Q</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">75%</td>
+					</tr>
+					<tr>
+						<td>Pro</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">Q</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">H</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">87%</td>
+					</tr>
+					<tr>
+						<td>Ser</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;">H</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">L</span></td>
+						<td style="text-align: center;">S</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">90%</td>
+					</tr>
+					<tr>
+						<td>Thr/Dht</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">N</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">I</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">G</span></td>
+						<td style="text-align: center;">M</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">H</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">91%</td>
+					</tr>
+					<tr>
+						<td>Tyr(1)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">100%</td>
+					</tr>
+					<tr>
+						<td>Tyr(2)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">T</span></td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">80%</td>
+					</tr>
+					<tr>
+						<td>Tyr(3)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">S</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">T</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;">C</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">78%</td>
+					</tr>
+					<tr>
+						<td>Val(1)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">A</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">F</span></td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;">I</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">G</td>
+						<td style="text-align: center;">T</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">96%</td>
+					</tr>
+					<tr>
+						<td>Val(2)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">E</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">S</span></td>
+						<td style="text-align: center;"><span style="color:#FF0000;">T</span></td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">V</td>
+						<td style="text-align: center;">Y</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">94%</td>
+					</tr>
+					<tr>
+						<td>Val(3)</td>
+						<td style="text-align: center;">D</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">W</td>
+						<td style="text-align: center;">M</td>
+						<td style="text-align: center;">F</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;">A</td>
+						<td style="text-align: center;"><span style="color:#FF0000;">V</span></td>
+						<td style="text-align: center;">L</td>
+						<td style="text-align: center;">K</td>
+						<td style="text-align: center;">95%</td>
+					</tr>
+					<tr>
+						<td>Variability</td>
+						<td style="text-align: center;">3%</td>
+						<td style="text-align: center;">16%</td>
+						<td style="text-align: center;">16%</td>
+						<td style="text-align: center;"><span style="color:#0000FF;">39%</span></td>
+						<td style="text-align: center;"><span style="color:#0000FF;">52%</span></td>
+						<td style="text-align: center;">13%</td>
+						<td style="text-align: center;">26%</td>
+						<td style="text-align: center;">23%</td>
+						<td style="text-align: center;">26%</td>
+						<td style="text-align: center;">0%</td>
+						<td style="text-align: center;">&nbsp;</td>
+					</tr>
+				</tbody>
+			</table>
+			</td>
+		</tr>
+	</tbody>
+</table>
-<p>Tyrocidine is a commercially available mixture of&nbsp;non-ribosomal antibiotic synthesized by <em>Bacillus brevis</em>. It consists of four decapeptides varying at 3 amino acids. The tyrocidine synthetase is split across three enzymes, Tyrocidine Synthetase A-C, containing 1, 3 and 6 modules. The different analogues are all synthesized by the same enzymes and vary because some of the modules incorporate structurally similar amino acids <span style="color:#FF0000;">[REF]</span>.</p>
+<p style="text-align: justify;">antiSMASH&nbsp;predicts NRPS clusters by patially Hidden Markov Models. It also&nbsp;predicts a consensus product by integrating three different methods for&nbsp;predictions of adenylation domain specificity These methods are:&nbsp;NRPSpredictor2, Stachelhaus, and Minova <em>et al</em>. &nbsp;[15,17].&nbsp;Stachelhaus <em>et&nbsp;al.</em>&nbsp;alligned the binding pocket of 160 adenylation domains using a structural alignment approach. By trimming of the sequence 10 core amino acids encoding specificity in the binding pocket was identified giving rise to the Stachelhaus code (Table <span style="color:#FF0000;"># MISSING</span>). In addition, it was shown that by modying the binding pocket&nbsp;<em>in silico </em>substrate affinity could be altered or relaxed&nbsp; [10]<em>.</em></p>
-<table class="table table-condensed table-hover">
+<table align="right" border="0" cellpadding="0" cellspacing="0" class="table-responsive" style="overflow-y:hidden;">
-	<caption>Tyrocidine variability</caption>
+	<tbody>
+		<tr>
+			<td>
+			<p>&nbsp;</p>
+			</td>
+		</tr>
+	</tbody>
+</table>
+<p style="text-align: justify;">Prediction is sometimes complicated by the fact that adenylation domains sometimes show more or less variability in amino acid specificity. In addition, the Stachelhaus code show some redundance in the 160 sequences&nbsp;[10].&nbsp;Tyrocidine is an example of this. Tyrocidine is a commercially available mixture of&nbsp;non-ribosomal antibiotic synthesized by <em>Brevibacillus parabrevis</em>. It consists of four decapeptides varying at&nbsp;three&nbsp;amino acids (<span style="color:#FF0000;">MISSING</span> Table <span style="color:#FF0000;">#</span>) and is synthetiszed by the NRPS,&nbsp;Tyrocidine Synthetase A-C, containing 1, 3, and 6 modules, respetively.&nbsp;(Figure&nbsp;<span style="color:#FF0000;"># MISSING HIGHER UP MICHAEL</span>).</p>
+<p style="text-align: justify;">Tyrocidine has an unique mode of acton wherein it disrupts the function of the cell membrane. Unfortunately, it has high&nbsp;toxicity towards human blood and reproductive cells and can&nbsp;only be used in topical applications. This makes tyrocidine an interesting target for drug improvement. Under <span style="color:#FF0000;">MISSING </span>section you can read more about improvement of tyrocidine.</p>
+<table border="0" cellpadding="0" cellspacing="0" class="table table-condensed" style="width: 250px;">
 	<thead>
 		<tr>
-			<th scope="row">&nbsp;</th>
+			<th colspan="4">
-			<th colspan="3" rowspan="1" scope="col" style="text-align: center;">Amino acid position</th>
+			<table border="0" cellpadding="0" cellspacing="0" style="font-size:8pt;">
+				<tbody>
+					<tr>
+						<td><strong>Table 2&nbsp;</strong>&nbsp;Tyrocidine variability</td>
+					</tr>
+				</tbody>
+			</table>
+			</th>
+		</tr>
+		<tr>
+			<th style="text-align: justify;">&nbsp;</th>
+			<th colspan="3">
+			<p><strong>Amino acid position</strong></p>
+			</th>
 		</tr>
 		<tr>
-			<th>Tyrocidine</th>
+			<th>
-			<th>3</th>
+			<p style="text-align: right;"><strong>Tyrocidine</strong></p>
-			<th>4</th>
+			</th>
-			<th>7</th>
+			<th>
+			<p><strong>3</strong></p>
+			</th>
+			<th>
+			<p><strong>4</strong></p>
+			</th>
+			<th>
+			<p><strong>7</strong></p>
+			</th>
 		</tr>
 	</thead>
 	<tbody>
 		<tr>
-			<th scope="row">A</th>
+			<td>
-			<td>L-Phe</td>
+			<p style="text-align: right;"><strong>A</strong></p>
-			<td>D-Phe</td>
+			</td>
-			<td>L-Tyr</td>
+			<td>
+			<p style="text-align: justify;">L-Phe</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">D-Phe</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">L-Tyr</p>
+			</td>
 		</tr>
 		<tr>
-			<th scope="row">B</th>
+			<td>
-			<td>L-Trp</td>
+			<p style="text-align: right;"><strong>B</strong></p>
-			<td>D-Phe</td>
+			</td>
-			<td>L-Tyr</td>
+			<td>
+			<p style="text-align: justify;">L-Trp</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">D-Phe</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">L-Tyr</p>
+			</td>
 		</tr>
 		<tr>
-			<th scope="row">C</th>
+			<td>
-			<td>L-Trp</td>
+			<p style="text-align: right;"><strong>C</strong></p>
-			<td>D-Trp</td>
+			</td>
-			<td>L-Tyr</td>
+			<td>
+			<p style="text-align: justify;">L-Trp</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">D-Trp</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">L-Tyr</p>
+			</td>
 		</tr>
 		<tr>
-			<th scope="row">D</th>
+			<td>
-			<td>L-Trp</td>
+			<p style="text-align: right;"><strong>D</strong></p>
-			<td>D-Trp</td>
+			</td>
-			<td>L-Trp</td>
+			<td>
+			<p style="text-align: justify;">L-Trp</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">D-Trp</p>
+			</td>
+			<td>
+			<p style="text-align: justify;">L-Trp</p>
+			</td>
 		</tr>
 	</tbody>
 </table>
-<p>Tyrocidine has an unique mode of acton wherein it disrupts the function of the cell membrane. Unfortunately it is very toxic towards human blood and reproductive cells and can only be used topically. Due to these factors it is a favorable target for engineering derivatives <span style="color:#FF0000;">[REF]</span>.&nbsp;</p>
+<h3>Potential NRP targets for drug improvement</h3>
-<h2>Multiplex Automated Genome Engineering:<br />
+<p style="text-align: justify;">In addition to tyrocidine, ciclosporin (or cyclosporin) is an important nonribosomal peptide&nbsp;drug used as an immunosuppressant in transplantations [6]. It consists of eleven&nbsp;amino acids which are cyclized upon releasing from the NRPS, like&nbsp;tyrocidine and contains&nbsp;D-amino acids and amino acids with modifications (Figure <span style="color:#FF0000;">#</span>). It was first isolated from the filamentous fungi&nbsp;<em>Tolypocladium inflatum</em>&nbsp;in 1969 and in 1972, its function as immunosuppresant was discovered by Sandoz&nbsp;(now Novartis).&nbsp;Despite, its widely use in&nbsp;clinal applications it&nbsp;is associated with&nbsp;side&nbsp;effects (adverse drug reactions) [6]. In ciclosporin&nbsp;G which is also isolated from&nbsp;<em>Tolypocladium inflatum</em>, the&nbsp;a-aminobutyric acid residue in position 2 has been&nbsp;replaced by norvaline [18]. Ciclosporin G&nbsp;has reduced side effects in some clinical applications and it highlights the possibility of drug improvement by NRPS engineering. A total of 25&nbsp;derivates of ciclosporin are&nbsp;known&nbsp; [?]. Comparing the number of known derivates to&nbsp;the actual potential diversity in compounds of an 11-mer cyclic peptide (11<sup>500</sup>), only a very little fraction of potential compounds are known. Even substitution of a single amino acid would yield more than 5,000 different compounds that could be screened for improved function.</p>
-<img alt="" src="None" style="width: 400px; height: 423px; float: right;" title="Multiplex Automated Genome Engineering Cycle" /></h2>
-<p>Recombination-mediated genetic&nbsp;engineering (recombineering) utlises homologous recombination to facilitate genetic modifications at any desired target by flanking the mutated sequence with homologous regions. One system for recombineering in <i>E. coli</i>&nbsp;is the &lambda;&nbsp;phage derived&nbsp;&lambda; Red, consisting of the genes encoding three proteins, Gam, Exo and Beta. Gam prevents degradation of linear dsDNA by inhibition of nucleases, Exo degrades dsDNA in a 5&#39;-3&#39; direction yielding ssDNA and Beta facilitates recombination by binding to the ssDNA [9].</p>
+<h3>Hypothesis: Targetted engineering of adenylation domains using OGRE</h3>
-<p>Multiplex Automated Genome Engineering (MAGE) is a method for rapid and efficient targeted programming and evolution of cells through cyclical recombineering using multiple single-stranded DNA oligonucleotides (oligos) [10].</p>
+<p style="text-align: justify;">As highlihgted above, there are multiple potential NRPS&nbsp;candidates that can be used for drug improvement through screening of NRP products, synthesized by modifying the Stachelhaus code of the adenylation domain. The limitation has been the limited genetic tools available for engineering of NRPS. Considering that the Tyrocidine Synthase is 1.25*10<sup>6</sup>&nbsp;Da which is approximately the size of the large subunit of the prokaryotic ribosome, this is perhaps not surprising.&nbsp;Even though that the changes required to potentially alter the specificity of the A-domain (~1-10 amino acids) according to the Stachelhaus code, transformation requires introduction of selection a casettes. As each&nbsp;NRPS module is ~1,500 amino acid and often multiple modules are encoded in one&nbsp;open reading frame, even few&nbsp;modifications require assembly and introduction of large expression casettes. For example the NRPS responsible to ciclosporin synthesis in&nbsp;<em>Tolypocladium&nbsp;inflatum</em> is encoded in a single gene <em>simA </em>encoding one&nbsp;45.8 kb exon [?]. Amplification of 45.8 kb nucleotides is not feasable with standard PCR and would be considerable expensive to synthesize by even cheap errorprone DNA synthesis methods (calculated based on prices from IDT for gblock synthesis).</p>
-<p>Through MAGE it is possible to simultaneously target many different loci or target the same locus with a pool of multiple and/or degenerate&nbsp;oligos. By using multiple oligos targetting the same locus, it is possible to generate a library of mutants varying only at the target locus in a short amount of time. Thus it is easy to quickly generate&nbsp;a library of <em>e.g.</em>&nbsp;enzymes with modified active sites&nbsp;[11].</p>
+<p style="text-align: justify;">We hypothesized that NRPS directed evolution targetting the Stachelhaus code could lead to improvement of NRP drugs. We proposed that the recent advantge in oligo mediated reecombineering (OGRE) using short single-stranded DNA (ssDNA) can be applied to generate this diversity. While OGRE has low efficiencies, it is actually an advantge for generation of libraries, as multiplex and automated targetting with a library of oligos will create a library of different compounds.</p>
-<p>The genetic variation in the population will be a function of the degenerate pool complexity and combinatiorial arrangement of the modifications at different loci [10].</p>
+<h2>Oligo mediates recombineering</h2>
-<p>The MAGE protocol utilises the&nbsp;&lambda; Red recombination system in combination with an (temporary) inactivation of the mismatch repair system&nbsp;and consists of 7 steps that can be done with standard laboratory equipment&nbsp;[11]. As MAGE utilises oligos, only the Beta protein of the&nbsp;&lambda; Red system is required.</p>
+<p style="text-align: justify;">Recombination-mediated genetic&nbsp;engineering &nbsp;or&nbsp;recombineering (we call it OGRE) utlises homologous recombination to facilitate genetic modifications at any desired target by flanking the mutated sequence with homologous regions. One system for recombineering in <em>E. coli</em>&nbsp;is the &lambda;&nbsp;phage derived&nbsp;&lambda; Red, consisting of the genes encoding three proteins, Gam, Exo and Beta. Gam prevents degradation of linear dsDNA by inhibition of nucleases, Exo degrades dsDNA in a 5&#39;-3&#39; direction yielding ssDNA, and Beta facilitates recombination by binding to the ssDNA [19].</p>
-<p>First the cells are grown to mid-log phase, followed by induction of <em>beta</em>. The cells are then chilled to 4&deg;C and washed with cold water to make the cells competent. Then the oligos are added to the cells, which are electroporated and allowed to recover for 2-3 hours before repeating the cycle&nbsp;[11].<br />
+<h3><strong>Multiplex Automated Genome Engineering (MAGE)</strong></h3>
+<p style="text-align: justify;">Wang <em>et al.</em>&nbsp;developed a method for rapid&nbsp;and efficient targeted evolution of cells through cyclical recombineering with ssDNA (oligo) in <em>E. coli</em>. Using this automated method, they more than five-fold improved lycoprene production in&nbsp;<em>E. coli </em>in three days&nbsp; [20].&nbsp;Through MAGE it is possible to simultaneously target many different loci or target the same locus with a pool of multiple and/or degenerate&nbsp;oligos. By using multiple oligos targetting the same locus, it is possible to generate a library of mutants varying only at the target locus in a short amount of time. The genetic variation in the population of cells will be a function of the degenerate pool complexity and combinatorial arrangements of the modifications at different loci and can be used to modify <em>e.g.</em> the active site of an enzyme&nbsp;[20,21].</p>
+<p style="text-align: justify;">The MAGE protocol utilises the&nbsp;&lambda; Red recombination system in combination with an (temporary) inactivation of the mismatch repair system&nbsp;and consists of seven&nbsp;steps that can be done with standard laboratory equipment&nbsp;[21]. As MAGE utilises oligos, only the Beta protein of the&nbsp;&lambda; Red system is required. In short,&nbsp;the cells are grown to mid-log phase, followed by induction of <em>beta</em>. The cells are then chilled to 4&deg;C and washed with cold water to make the cells competent. The oligos are added to the cells which are then electroporated. The cycle is repeated every 2-3 hours allowing the cells to recover in between rounds of electroporations&nbsp;[21].<br />
 See figure.</p>
-<h2>Recombineering in <em>Bacillus subtilis</em>:</h2>
+<h4>Chip-based oligonucleotide synthesis</h4>
-<p>While the &lambda; Red system mentionen above facilitates efficient recombineering in&nbsp;<em>E. coli</em>&nbsp;this system is less efficient in the distantly related species&nbsp;<em>B. subtilis</em>.&nbsp;A more efficient recombineering system for&nbsp;<em>B. subtilis</em>&nbsp;can be obtained by utilizing the gene products of the gene regions 34-36 of&nbsp;the a native <i>B. subtilis</i>&nbsp;phage SPP1. This system yields higher efficiency compared to&nbsp;&lambda; Red&nbsp;in&nbsp;<em>B. subtilis</em>, but lower efficiency&nbsp;in&nbsp;<em>E. coli</em>. It appears that when developing recombineering systems for different bacteria, they should be based on native phages or those of close relatives&nbsp;[12].</p>
+<p style="text-align: justify;"><img alt="" src="None" style="width:400px;height:317px;float:left;" />Traditional column-based oligo synthesis is costly for large scale MAGE experiments. Synthesis of 1,000 90-mer column-based oligos costs about 36,000 USD [22]. An alternative to this method is to use Microchip DNA arrays to synthesize the oligos on, with the advantage that the price scales with the number of chips instead of the number of oligos. Thus it is possible to have up to&nbsp;12,472 130-mer oligos synthesized for 2,000 USD and up to&nbsp;92,918 oligos for 5,000 USD (http://customarrayinc.com/oligos_main.htm).</p>
-<p>In the SPP1 derived system the gene product of region 34 (GP34) encodes an endonuclease similar to &lambda; Exo and GP35 is a recombinase protein similar to Beta and GP36 is a ssDNA binding protein&nbsp;[13,14].</p>
+<p style="text-align: justify;">This method however comes with a few disadvantages. The oligo amount comes in the picomolar range and is delivered as a single mix of all the oligos. Because of these disadvantages, an extra processing step is required before they can be used in&nbsp;MAGE experiments.</p>
-<h2>Chip oligonucleotide synthesis:</h2>
+<p style="text-align: justify;">The oligos are synthesized with two 20 nucleotide&nbsp;flanking sequences (barcodes). These barcodes must include&nbsp;a thymidine immediately upstream and a DpnII restriction site immediately downstream of the oligo, while the rest of the barcodes can be designed for amplification with a specific primer. By using different barcodes, it is possible to design one oligo chip for multiple MAGE experiments.&nbsp;The thymidine allows amplification with an uracil-containing primer. In these primers U is substituted for T in the primer. The barcode can then be excited from the oligo using USER enzyme, DnpII,&nbsp;and a guide primer [22].</p>
-<p><img alt="" src="None" style="width: 400px; height: 317px; float: left;" />Traditional column-based oligo synthesis is costly for large scale MAGE experiments. Synthesis of 1000 90-mer oligos costs about 17,500 USD <span style="color:#FF0000;">[REF]</span>. An alternative to this method is to use Microchip DNA arrays to synthesize the oligos on, with the advantage that the price scales with the number of chips instead of the number of oligos. Thus it is possible to have up to&nbsp;12,472 130-mer oligos synthesized for 2,000 USD and up to&nbsp;92,918 oligos for 5,000 USD (http://customarrayinc.com/oligos_main.htm).</p>
+<h4>Oligo design</h4>
-<p>This method however comes with a few disadvantages. The oligo amount comes in the picomolar range and is delivered as a single mix of all the oligos. Because of these disadvantages an extra processing step is necessary in order to use them for MAGE experiments.</p>
+<p style="text-align: justify;">While the recombination frequency of MAGE can be increased by doing multiple cycles, care should be taken when designing oligos to ensure high efficiency for each individual cycle. There are several parameters that can be optimized to increase the recombination frequency.</p>
-<p>The oligos are synthesized with two 20 nucleotide&nbsp;flanking sequences (barcodes). These barcodes must add a thymidine immediately upstream and a DpnII restriction site immediately downstream of the oligo, while the rest of the barcodes can be designed for amplification with a specific primer.</p>
+<p style="text-align: justify;">The oligos should target the lagging strand of the replication fork as this is 10-100 times more efficient compared to targetting the leading strand, and the folding energy of the oligo should be considered, as it may form hairpins if it is too low, preventing incorporation.</p>
-<p>The thymidine allows amplification with an uracil-containing primer so that the barcodes can be excised from the oligos with USER enzyme, DnpII and a guide primer [15].</p>
+<p style="text-align: justify;">The frequency is also dependent on the length of the oligo, as shorter oligos are less efficient due to their lower hybridization energy to the chromosome, while longer oligos have a higher tendency to form hairpins. 70-90-mer oligos seem to be the most efficient in&nbsp;<em>E. coli</em>&nbsp;[21].</p>
-<h2>Oligo design:</h2>
+<p style="text-align: justify;">Designing&nbsp;many optimized oligos for MAGE experiment is a time consuming task. Considering a 90-mer oligo with a single mismatch and 15nt homology arms results in 60 possible oligos with different secondary structures and consequently different recombineering efficiencies. Much of the time spent on designing oligos can be saved by using the online tool <a href="http://modest.biosustain.dtu.dk">MODEST</a>&nbsp;[23].</p>
-<p>While the recombination frequency of MAGE can be increased by doing multiple cycles, care should be taken when designing oligos to ensure high efficiency for each individual cycle. There are several parameters that can be optimized to increase the recombination frequency.</p>
+<h3>Oligo mediated recombineering in <em>Bacillus subtilis</em></h3>
-<p>The oligos should target the lagging strand of the replication fork as this is 10-100 times more efficient compared to targetting the leading strand, and the folding energy of the oligo should be considered, as it may form hairpins if it is too low, preventing incorporation.</p>
+<p style="text-align: justify;">While the described &lambda; Red reecombineering system is well exploited in <em>E. coli&nbsp;</em>the last years, the technology has not been adopted&nbsp;for genome editing to the same extend in other microorganisms.&nbsp;Application of&nbsp;&lambda; Red reecombineering system has been described&nbsp;in&nbsp;<em>Bacillus subtilis (ARTICLE 2012)</em>, but with longer oligos of approx. 2,000 nucletoides generated by PCR [24]. Besides expression of Beta, Sun <em>et al.</em>&nbsp;also expressed homologous recombinases from other phages. The gene product of region&nbsp;35 (GP35) from&nbsp;the native <em>B. subtilis</em>&nbsp;phage SPP1&nbsp;to Beta. Gene product of region 34 (GP34) encodes an endonuclease similar to &lambda; Exo and GP35 is a recombinase protein homologous &nbsp;and GP36 is an ssDNA binding protein&nbsp;[25,26].&nbsp;This native <em>Bacilli</em>&nbsp;reecombineering system yielded&nbsp;higher efficiency compared to&nbsp;&lambda; Red&nbsp;in&nbsp;<em>B. subtilis</em>, but lower efficiency&nbsp;in&nbsp;<em>E. coli&nbsp;</em>[24]. Based on heteroloogus expression of many recombinases of different origin in&nbsp;<em>Bacillus subtilis</em>, it was included that recombineering efficiencies were&nbsp;optimised by using a recombinase derived from a phage which host was closely related to heterologous host. We&nbsp;noticed that codon usage of lambda beta is not optimal for expression of <em>B. subtilis</em> and that expression level (likeli due to codon usage) varried among the recombinases tested in the study. In addition, the length of the oligo tested is drastically different from the optimal length in <em>E. coli </em>based on the&nbsp;&lambda; Red Lambda recombineering system.</p>
-<p>The frequency is also dependent on the length of the oligo, as shorter oligos are less efficient due to their lower hybridization energy to the chromosome, while longer oligos have a higher tendency to form hairpins. 70-90-mer oligos seem to be the most efficient&nbsp;[11].</p>
+    </div>
+  </div>
+</div>
+<div id="Unleash-the-OGRE">
+  <div class="container">
+    <div class="row col-md-12">
+      <h1>
+        Unleash the OGRE!
+      </h1>
+      <p><em><strong>(Purpose: To make oligo reecombineering (we call this OGRE) in B. subtilis.)</strong></em></p>
-<p>Designing&nbsp;many optimized oligos for MAGE experiment is a time consuming task. Considering a 90-mer oligo with a single mismatch and 15nt homology arms results in 60 possible oligos with different secondary structures and consequently different recombineering efficiencies. Much of the time spent on designing oligos can be saved by using the online tool <a href="http://modest.biosustain.dtu.dk">MODEST</a>&nbsp;[16].</p>
+<p>Making small and prisice changes in the genome of a bacteria can be extreamly powerfull if you can standardize a method to do so.&nbsp;</p>
+<p>We made a method for inserting small changes in the genome of B. subtilis. By using our Oligo Recombineering&nbsp; (OGRE) method we inserted small changes in the genome we showed that we can change the function of different genes with a high efficiency. The method was shown to work by knocking out the upp gene and making Bacillus resistant to streptomycin<o:p></o:p></p>
+<p>&nbsp;</p>
+<p><strong>Knock out of upp and amyE </strong></p>
+<p>As a prof of concept we knocked out the amyE and upp locus in B. subtilis by using oligoes that insert a stop codon in the coding sequence of the coding sequence. The oligoes were designed using the program MODEST ( ? link til modest&nbsp; ). We tried to use amyE and upp to calculate the transformation efficiency of the OGRE technique, but the results were to unclear to measure efficiency. The upp selection indicated that the knockout was possible but that the transformant grew slowly. The amyE screening could not give any conclusive results. The starch plates and<span lang="DA" style="font-size:12.0pt;font-family:Cambria;
+mso-ascii-theme-font:minor-latin;mso-fareast-font-family:&quot;ＭＳ 明朝&quot;;mso-fareast-theme-font:
+minor-fareast;mso-hansi-theme-font:minor-latin;mso-bidi-font-family:&quot;Times New Roman&quot;;
+mso-bidi-theme-font:minor-bidi;mso-ansi-language:DA;mso-fareast-language:DA;
+mso-bidi-language:AR-SA"> 5-Fluorouracil (5-FU) plates were mixed with a deffined minimal medium ( ? see protocol for for minimal medium)</span></p>
+<p>&nbsp;</p>
+<table border="1" cellpadding="1" cellspacing="1" style="width: 500px;">
+	<tbody>
+		<tr>
+			<td><strong>Name</strong></td>
+			<td><strong>Oligo</strong></td>
+			<td><strong>Length</strong></td>
+			<td><strong>point mutation position</strong></td>
+		</tr>
+		<tr>
+			<td>mage_amyE-1</td>
+			<td><span id="docs-internal-guid-104a6dbc-cfb3-f2a0-a148-9cd39efff2c2" style="font-size:14.666666666666666px;font-family:Arial;color:#980000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">AAGTAACGGTTGCCAATTTGATACGATGTCGGCTGATACAGtCAtTACtAGTTCGACATGCTTTTATCTCCTTGATTCCCTTCCTTTACT</span></td>
+			<td>90</td>
+			<td>?</td>
+		</tr>
+		<tr>
+			<td>mage_upp-1</td>
+			<td><span id="docs-internal-guid-104a6dbc-cfb3-4fb6-c249-d25f4ed0efb8" style="font-size:14.666666666666666px;font-family:Arial;color:#0000ff;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">GGGTAATTTCAAATGCCATGAGTGTAGCCACTTCATCTACTtACTaTCaAAAATCCTTCGTACCTGTATTTTCATTCCGTATATATGTCA</span></td>
+			<td>90</td>
+			<td>?</td>
+		</tr>
+	</tbody>
+</table>
+<p><strong>Method </strong></p>
+<p>B. subtilis strain 168 with GP35 or lambda beta inserted in amyE or mutS knockouts were made electrocompetent using protocol ( ? link electro protocol). amyE and upp were electroporated with the oligoes shown above (see link to protocol ?). Prior to the experiment the mutant were grown over night in 5y neomycin. and plated on minimal medium with 1% starch for amyE or 25uM for 5-FU. ( ? see procol for minimal medium)</p>
+<p>&nbsp;</p>
+<p><strong>Results </strong></p>
+<p>The amyE screening showed to be too difficult to interpret clear results from therefor this selection was abandond. The 5-FU were incubated for 3 days before colonies were visible</p>
+<p><em>? SHow pictures </em></p>
+<p>It can be shown that some of the colonies had the upp locus knocked out there by making them resistent to the toxin 5-FU. This coused the cells to grew on the minimal plates shown on picture ?&nbsp;</p>
+<p>Because of the long growth time this selection was not effective or clear enough to calculate the frequency of tranformation.</p>
+<p>&nbsp;</p>
+<p><strong>Growth experiment for mutants</strong></p>
+<p>We were interested in testing if the mutations made in the amyE or mutS would change the growth rate of the B. subtilis compared to the wild type. It was indicated by <strong><span style="font-family:Times">Sun et al. 2015 (&nbsp;</span></strong>[24]<strong><span style="font-family:Times"> )</span></strong> that the growth rate of the GP35 mutant would be lower than the wild type strain. Our experiment could not suport this theory. It was not possible to find any significant different in the growthrates of any of the strains tested in this experiment.<o:p></o:p></p>
+<p><o:p>&nbsp;</o:p></p>
+<p><strong>Method </strong></p>
+<p>An over night culture of wild type, mutS:GP35, mutS:lambda beta, amyE:GP35 and amyE:lambda beta were inoculated in LB.<o:p></o:p></p>
+<p>A 16 fold dilution of each of the inoculated cultures was made in growth medium.<o:p></o:p></p>
+<p>The inoculated growth medium (LB with 0.5M sorbitol) was incubated at 30dec shaking at 200rpm.<o:p></o:p></p>
+<p>The OD was measured continually until it reached 0.85.<o:p></o:p></p>
+<p>&nbsp;</p>
+<p><strong>Results</strong></p>
+<p>It seems that the mutS:GP35 had a faster growth in the exponential phase. When looking at the function given from the graf it is clear that the growth rate is the same for all samples mesured.&nbsp;</p>
+<p><img alt="" src="None " style="width: 700px; height: 362px;" />Graf (?) Here all the OD mesurements can be seen.</p>
+<p>&nbsp;</p>
+<table border="1" cellpadding="1" cellspacing="1" style="width: 500px;">
+	<tbody>
+		<tr>
+			<td>B subtilis strain</td>
+			<td>rate (mu)</td>
+			<td>Generationrate</td>
+			<td>R<sup>2</sup></td>
+		</tr>
+		<tr>
+			<td>Wild type</td>
+			<td>0.0155</td>
+			<td>45min</td>
+			<td>0.9546</td>
+		</tr>
+		<tr>
+			<td>amyE:GP35</td>
+			<td>0.02</td>
+			<td>35min</td>
+			<td>0.9883</td>
+		</tr>
+		<tr>
+			<td>amyE:lambda beta</td>
+			<td>0.0193</td>
+			<td>36min</td>
+			<td>0.9849</td>
+		</tr>
+		<tr>
+			<td>mutS:GP35</td>
+			<td>0.0184</td>
+			<td>38min</td>
+			<td>0.9330</td>
+		</tr>
+		<tr>
+			<td>mutS:lambda beta</td>
+			<td>0.0178</td>
+			<td>39min</td>
+			<td>0.9450</td>
+		</tr>
+	</tbody>
+</table>
+<p>Table of calculated results from experiment.</p>
+<p>&nbsp;</p>
+<p><img alt="" src="None " style="width: 700px; height: 354px;" />Plot ?. The four different mutants generationrate can here be compared to the wild type. The errorbares indicate the 5% error of every generationrate. The y axes is mesured in minuttes.</p>
+<p>&nbsp;</p>
+<p><strong>Incerting streptomycine recistens with one point mutation </strong></p>
+<p>The streptomycin resistance only requires one point mutation in the gene known as rpsL. This point mutation is lysine to arginine at position 56.<o:p></o:p></p>
+<p>An oligo with the necessary change was transformed by electroporation of the B. subtilis.</p>
+<p><o:p></o:p></p>
+<p><strong>&nbsp;Method </strong></p>
+<ol>
+	<li>
+	<p><strong>Protocol for electrocompetent Bacillus subtilis 168</strong></p>
+	</li>
+</ol>
+<p>An over night culture of bacillus subtilis 168 with lambda beta incerted into mutS was prepared in LB media with 5y neo at 37dec shaken at 200rpm.</p>
+<p>The protol for making electrocompetent Bacillus was followed. ? see link to protocol</p>
+<p>&nbsp;</p>
+<ol>
+	<li>
+	<p><b style="mso-bidi-font-weight:normal"><span lang="EN-GB" style="font-size:12.0pt;font-family:Cambria;mso-ascii-theme-font:minor-latin;
+mso-fareast-font-family:&quot;ＭＳ 明朝&quot;;mso-fareast-theme-font:minor-fareast;
+mso-hansi-theme-font:minor-latin;mso-bidi-font-family:&quot;Times New Roman&quot;;
+mso-bidi-theme-font:minor-bidi;mso-ansi-language:EN-GB;mso-fareast-language:
+DA;mso-bidi-language:AR-SA">Protocol for multiplex OGRE cycles in Bacillus subtilis 168</span></b></p>
+	</li>
+</ol>
+<p>&nbsp;</p>
+<p>We hypothesized that if the OGRE protocol was repeated multiple times the amount of transformants would rise. This was tested by running four cycles of the OGRE protocol. The progress could be followed by plating a dilution of the sample on streptomycin plates after every round and calculating the start value of the culture from the OD<sub>600</sub> measurements.</p>
+<p>&nbsp;</p>
+<p><strong>Materials </strong></p>
+<p>( ? see procol for multiplex OGRE)</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
      </div>
@@ Line 368: / Line 1,126: @@
-<div id="Hypotheses">
+<div id="Optimization-of-OGRE">
    <div class="container">
      <div class="row col-md-12">
        <h1>
-         Hypotheses
+         Optimization of OGRE
        </h1>
-       <p>The first hypotheses of our project was, that we could design a <em>B. subtilis</em> capable of oligo mediated transformation.<br />
+       <p>Purpose: tp optimise the conditions, tests of oligos</p>
-To do this, we decided to make a knockout of the&nbsp;<em>mutS</em><em>L</em>&nbsp;operon and insert either&nbsp;<em>beta</em>&nbsp;from the <i>E. coli</i>&nbsp;lambda phage or&nbsp;<em>gene 35</em>&nbsp;from the&nbsp;<em>B. subtilis&nbsp;</em>phage SPP1.</p>
-<p>The second hypotheses was, that using oligos we could specifically alter the specificities of NRPS A domains, to generate libraries of NRPS derivatives. This approach may however be somewhat limited by C domain specificities.</p>
+<p>why</p>
+<p>To optimize our new OGRE method we made different experiment testing the optimal amount of oligo and length. The mismatch frequency for multiple mismatches was also quantified.</p>
+<p>how</p>
+<p>&nbsp;</p>
+<p><strong>optimal olig amount for OGRE </strong></p>
+<p>The same protcol as shown for streptomycine ( make link ? ) was used where the amount of oligo used was veried form 0.2-25uL</p>
+<p>&nbsp;</p>
+<p><strong>OD calculator </strong></p>
+<p>The <a href="https://2008.igem.org/Team:Imperial_College">Imperial iGEM 2008</a> team has made a equation for calculating CFU from OD600. We tried to validate there formulary by using our own results. The hope was to make a calculator that could calculate what type of dilution would be needed to give you accurate results with out having to use up a lot of agar plates for unnecessary dilutions. We could not get measurements that were accurate enough to validate the Imperical iGEM 2008.</p>
+<p>&nbsp;</p>
+<p>Results</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p>compare with impirial 2008 formula and show data.</p>
+<p>put link to there page and make link to own data.</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p><strong>finding frequency of mutation </strong></p>
+<p>Same protcol as shown for streptomycine ( make link ? ) where the oligoes with 1-6 mismatches were tested.</p>
+<p><strong>optimizing oligo length</strong></p>
+<p>the protocol for changing streptomycin ( ? incert link ) was used for oligo&#39;s with one mismatch but with verying lengths from 50-100nt were also tested.</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p>Materials</p>
+<p>same materials used as in protocol for changing streptomcine resistens ( ? incert link)</p>
+<p>&nbsp;</p>
      </div>
@@ Line 384: / Line 1,195: @@
-<div id="Parts">
+<div id="Oligo-Software">
    <div class="container">
      <div class="row col-md-12">
        <h1>
-         Parts
+         Oligo Software
        </h1>
-       <table class="table table-hover">
+    </div>
+  </div>
+</div>
+<div id="Modifying-surfactin">
+  <div class="container">
+    <div class="row col-md-12">
+      <h1>
+        Modifying surfactin
+      </h1>
+      <p><img alt="" src="None" style="height: 249px; width: 350px; float: right;" />As a proof of concept, we tried to modify surfactin synthase to substitute aspartic acid&nbsp;in surfactin with aspargine using oligo mediated recombineering.</p>
+<h2>Achivements</h2>
+<p><span style="color:#FF0000;">MISSING</span></p>
+<h2>Experimental design</h2>
+<p style="text-align: justify;">Surfactin (Figure <span style="color:#FF0000;"># MISSING</span>) is a surfactant&nbsp;cyclic lipopeptide produced by&nbsp;<em>Bacillus subtilis. </em>It is important for sporulation in&nbsp;<em>B. subtilis</em>&nbsp;[27]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). antiSMASH prediction of adenylation domain specificity corresponds&nbsp;to surfactant. The NRPS modules are divided out on three contigs (ctg1_353-5) with 3, 3, and 1 module, respectively&nbsp;(Figure <span style="color:#FF0000;"># MISSING</span>).</p>
+<p style="text-align: justify;">The second module (or module 5) of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp-&gt;Asn. Three different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table <span style="color:#FF0000;">MISSING</span>), yielding different number of mismatches in the oligo.</p>
+<p><span style="font-size:8px;"><strong>Table #MISSING&nbsp;</strong>List of oligos used to modify surfactin NRPS.</span><br />
+<span style="font-size:8px;"></span></p>
+<table border="0" cellpadding="1" cellspacing="1" class="table table-hover">
 	<thead>
 		<tr>
-			<th scope="col">Name</th>
+			<th scope="col"><strong>Name</strong></th>
-			<th scope="col">Type</th>
+			<th scope="col"><strong>Oligo</strong></th>
-			<th scope="col">Description</th>
+			<th scope="col"><strong>Length</strong></th>
-			<th scope="col">Length</th>
+			<th scope="col"><strong>Mutations (Stacelhaus)</strong></th>
 		</tr>
 	</thead>
 	<tbody>
 		<tr>
-			<td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_">BBa_</a></td>
+			<td>Oligo1</td>
-			<td>...</td>
+			<td>catacagatcaacccgcccggcgatggcgccgaCcgttgcttctgtcgggccgtaCtCattgataaattcggtatgtccatacatcttac</td>
-			<td>Beta</td>
+			<td>90</td>
-			<td>...</td>
+			<td>H322E, I330S&nbsp;</td>
 		</tr>
 		<tr>
-			<td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_">BBa_</a></td>
+			<td>Oligo3</td>
-			<td>...</td>
+			<td>ttcgcaaatgcatccggctcatacagatcaacccgcccggcgatggcgccgaCcgttgcttctgtcgggccgtaCtCattgataaattc<br />
-			<td>GP35</td>
+			ggtatgtccatacatcttacggaaggcgataacatcagtcgggatgattttttctcctcccaagaGgatcaagcgcaaggattcaaagttc<br />
-			<td>...</td>
+			gcatcttttgcaaaactggc</td>
+			<td>200</td>
+			<td>V299L,&nbsp;H322E, I330S&nbsp;</td>
 		</tr>
 	</tbody>
 </table>
+<h2>Methods</h2>
+<h2 style="font-style:italic;"><span style="color:#FF0000;"></span></h2>
+<p><strong><em>(??? whay is there 3 oligoes displated above !!??) </em></strong></p>
+<p>Electrocompetent B. subtilis was used with a mutS:lambda beta mutation was used. (see protocol for making eletrocompetent bacillus ? )</p>
+<p>three oligoes were used for this experiment. Two different surfactin oligoes were used separately, and one streptomycin resisters oligo was used to select for the desired change.</p>
+<p>100uL of cells was mixed with 5uL of the surfactine changing oligo and 0.5uL of an streptomycin resistance oligo was mixed in electroporation cuvettes, and incubated for 7min.</p>
+<p>The electroporation cuvettes were electroporated with 2.2kV (1mm cuvettes). The run time should be 5.0-6ms. Optimal run time is 5.5ms</p>
+<p>Immediately after electroporation the electroprated cells were incubated in 3mL Recovery Medium.</p>
+<p>The cells were incubated for 4 hours at 30dec shaking at 220rpm.</p>
+<p>after incubation OD was measured for each sample.</p>
+<p>Samples were diluted to 10<sup>3</sup> and 10<sup>4</sup> .</p>
+<p>The dilutions were plated on 500y streptomycin plates.</p>
+<p>Plates were incubated for 2 days at 37dec.</p>
 <p>&nbsp;</p>
+<h2>Results</h2>
+<p>Oligo reecombineering competent strain (mutS&Delta;::GP35) was electroporated with oligo1 and oligo2 from Table <span style="color:#FF0000;">MISSING</span>. After recovery of cells for 3 hours, dilutions were plated on LB agar plates containing 5</p>
      </div>
@@ Line 422: / Line 1,292: @@
-<div id="Results">
+<div id="Expression-of-tyrocidine">
    <div class="container">
      <div class="row col-md-12">
        <h1>
-         Results
+         Expression of tyrocidine
        </h1>
-       <p>Bacillus subtilis capable of oligo mediated genome engineering ...&nbsp;</p>
+       <p>Tyrocidine has an unique mode of acton wherein it disrupts the function of the cell membrane. Unfortunately, it has high&nbsp;toxicity towards human blood and reproductive cells and can&nbsp;only be used in topical applications. This makes tyrocidine an interesting target for drug improvement. Under MISSING section you can read more about improvement of tyrocidine.</p>
-<p>NRPS A domain modification ...</p>
-<p>Allellic replacement efficiency.</p>
-<p>1-5 mm 90-mer oligos.</p>
-<p>50-110-mer 1 mm oligos.</p>
      </div>
@@ Line 443: / Line 1,305: @@
-<div id="Modelling">
+<div id="Lab-on-chip-Screening">
    <div class="container">
      <div class="row col-md-12">
        <h1>
-         Modelling
+         Lab-on-chip Screening
        </h1>
-       <h2>Allelic replacement</h2>
+    </div>
+  </div>
+</div>
+<div id="Intein">
+  <div class="container">
+    <div class="row col-md-12">
+      <h1>
+        Intein
+      </h1>
+      <p style="text-align: justify;">During the laboratory work, we experienced great difficulties with heterologous expression of the tyrocidine operon in&nbsp;<i>Bacillus subtilis</i>&nbsp;[read more link MISSING]. This inspired us to think of&nbsp;alternative approaches for production of nonribosomal&nbsp;peptide drugs than by NRPS. We came up with a peculiar&nbsp;idea of generating short cyclised peptides using inteins. Inteins are short peptide sequences that do not have an endogenous role in proteins. They&nbsp;are removed post translation by auto-catalysation. This forms a peptide bond between two amino acids while splicing out the N-intein and C-intein (Figure #MISSING).&nbsp; If the N-intein and C-intein are placed at each end of a polypeptide;&nbsp;cyclisation would give&nbsp;a cyclised protein - or in our case a short peptide.</p>
-<p>While allelic replacement efficiencies is high in some cases such as 1-bp mismatches, the efficiency decreases with the increase in size of replacement. The lower efficiency can be overcome by cyclic&nbsp;iterations with the oligo pool on the same cell population [11].</p>
+<table align="right" border="0" cellpadding="1" cellspacing="1" style="margin-left: 10px; font-size: 8pt; width: 300px;">
+	<tbody>
+		<tr>
+			<td><img alt="" longdesc="" src="None" style="width: 300px; height: 303px; float: right;" title="" /></td>
+		</tr>
+		<tr>
+			<td style="text-align: justify;"><strong>Figure #Missing</strong> N-intein and C-intein is spliced out by forming a leftover extein scar of the size of the N-extein and C-extein. The size and amino acid sequenceof the scar depends on the source of the intein.</td>
+		</tr>
+	</tbody>
+</table>
-<p>We tested allelic replacement with 90-mer oligos containing 1-5 mismatches and 50-110-mer oligos containing 1 mismatch.</p>
+<h2 style="text-align: justify;">Achivements</h2>
-<p>The frequency of allelic replacement after n cycles can be calculated by:</p>
+<ul>
+	<li style="text-align: justify;">Designed construct for expression of two short cyclic peptides using BioBrick <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>&nbsp;and two short primers.</li>
+	<li style="text-align: justify;">Made the cyclisation construct in the laboratory.</li>
+	<li style="text-align: justify;">Analyzed constructs by chomotography, though no products could be detected.</li>
+	<li style="text-align: justify;">Improved characterization of BioBrick&nbsp;<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>.</li>
+</ul>
-<p><span class="math-tex">\(f = 1-(1-RE)^n\)</span></p>
+<h2 style="text-align: justify;">Background</h2>
-<p>Leading to N required cycles to obtain a&nbsp;frequency F:</p>
+<p style="text-align: justify;">Nonribosomal peptide synthetases do not have monopolly on production of bioactive nonribosomal peptides. CyBase contains&nbsp;818 entries for&nbsp;&nbsp;ribosomal head-to-tail cyclised peptides from 105 different spieces [28]. The length of these cyclic peptides varry from 8-80 amino acids and they are often chracterized by having internal cysteine bridges [29]. Reported activities include&nbsp;anti-HIV, anti-cancer, anti-bacterial, and toxins and&nbsp;due to their high thermostability and&nbsp;resistantance against degredation by proteases, they&nbsp;may be used to&nbsp;increase&nbsp;bioavailability of peptide drugs. Alternatively, their biosynthesis&nbsp;may propose an alternative approach for synthesis of nonribosomal peptide drugs independently of NRPS.</p>
-<p><span class="math-tex">\(N = {log(1-F) \over log(1-RE)}\)</span></p>
+<p style="text-align: justify;">Cyclisation of these protein occurs post translation and is mediated by short peptides that have autocatalytic activity. In one mechanism (Figure #MISSING), self-splicing peptide sequences&nbsp;(inteins) bind and catalyze their own excission while forming a peptide bond between the N-extein and C-extein. Numerous of inteins have been characterized including split intein&nbsp;Npu DnaE from <i>Nostoc punctiforme</i> PCC73102&nbsp;(Npu) (Figure #MISSING)&nbsp;[30,31]. When the Npu DnaE intein auto-catalyze its own excisions, it leaves the six amino acid extein-scar behind. The native scar (AEY-CFN) can be modified at some positions and still yield splicing [31]. The cysteine of the first position in the C-extein was the only amino acid that could not be substituted.</p>
+<p style="text-align: justify;">The&nbsp;BioBrick&nbsp;<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>&nbsp;was introduced by Heidelberg in 2014. It contains Npu DnaE inteins surrounding a negative RFP selection marker, which can be exided by cutting with&nbsp;<em>BsaI</em>. Digestion with&nbsp;<em>BsaI&nbsp;</em>generates to overhangs with different sequence, thereby making direction specific introduction of coding sequence (CDS) for portein of interest into the cyclisation construct possible. The BioBrick was used to cyclise different proteins, but was to our knowledge not used to cyclise short peptides.</p>
+<p style="text-align: justify;">We decided to try and cyclise an synthetic ten&nbsp;amino acid peptide sequence, which was similar to tyrocidine. In addition, we searched the cyclic peptide database for bioactive cyclic peptide which contained part of the extein scar. The sequences for both native peptides along with the sequence chosen for cyclisation experiments are shown in Table #MISSING.</p>
+<table border="0" cellpadding="1" cellspacing="1" class="table table-hover">
+	<thead>
+		<tr>
+			<th scope="row">&nbsp;</th>
+			<th scope="col">Cycloviolacin Y1 (33 aa)[29]</th>
+			<th scope="col">Tyrocidine (10 aa)</th>
+		</tr>
+	</thead>
+	<tbody>
+		<tr>
+			<th scope="row" style="text-align: left;">Native</th>
+			<td>GGTIFDCGETCFLGTCYTPGCSCGNYGFCYGTN</td>
+			<td>F<sub>D</sub>PF<sub>D</sub>NQYVOrnL</td>
+		</tr>
+		<tr>
+			<th scope="row" style="text-align: left;">Synthetic</th>
+			<td>GGTIFDC<u>GETCFL</u>GTCYTPGCSCGNYGFCYGTN</td>
+			<td><u>EYCFN</u>QYVK<u>A</u></td>
+		</tr>
+		<tr>
+			<th scope="row" style="text-align: left;">Extein (N/C)</th>
+			<td>GET/CFL</td>
+			<td>AEY/CFN</td>
+		</tr>
+	</tbody>
+</table>
+<p style="text-align: justify;">Instead of digestion nucleotide sequences for these short peptides, the insert was made usign two short single stranded DNA (ssDNA) oligos.</p>
+<table border="0" cellpadding="1" cellspacing="1" class="table table-hover" style="width: 100%;">
+	<tbody>
+		<tr>
+			<th scope="row" style="text-align: left;">Cycloviolacin Y1</th>
+			<td>
+			<p>5&#39;-CAACTGCTTCCTTGGCACATGCTACACACCTGGCTGCTCTTGCGGCAACTAC<br />
+			&nbsp; &nbsp; GGCTTCTGCTACGGCACAAACGGCGGCACAATCTTCGATTGCGGCGAAACA-3&#39;<br />
+&#39;-AGCATGTTTCGCCGCAATCGAAGATTGTGCCGCCGTTTGTGCCGTAGCAGAA<br />
+			&nbsp;&nbsp; &nbsp;GCCGTAGTTGCCGCAAGAGCAGCCAGGTGTGTAGCATGTGCCAAGGAAGCA-3&#39;</p>
+			</td>
+		</tr>
+		<tr>
+			<th scope="row" style="text-align: left;">Tyrocidine-like</th>
+			<td>5&#39;-CAACTGCTTCAACCAATACGTTAAAGCTGAATAC-3&#39;<br />
+&#39;-AGCAGTATTCAGCTTTAACGTATTGGTTGAAGCA-3&#39;</td>
+		</tr>
+	</tbody>
+</table>
+<h2 style="text-align: justify;">Methods</h2>
+<p style="text-align: justify;">MISSING</p>
+<h3 style="text-align: justify;">Chomatographic&nbsp;analysis of cyclic peptides</h3>
+<p style="text-align: justify;">Transformants for analysis were&nbsp;re-streaked onto LB agar plates containing&nbsp;6</p>
+<h2 style="text-align: justify;">Discussion</h2>
+<p style="text-align: justify;">It was not possible to detect cyclised proteins from cell-extracts my MALDI-TOF. The size of the unspliced protein is 19.4&nbsp;kDA (cycloviolacin Y1) and 17.2 kDa (tyrocidine-like).</p>
      </div>
@@ Line 468: / Line 1,420: @@
-<div id="Discussions">
+<div id="Detection-of-NRP">
    <div class="container">
      <div class="row col-md-12">
        <h1>
-         Discussions
+         Detection of NRP
        </h1>
-       <p>We have decided to focus on the adenylation domains of nonribosomal peptide synthetases in this project. However, as was described above, condensation domains may also exhibit some levels of selectivity towards the incorporated amino acids. Our approach could also be extended towards C domain specificity in order to investigate and elaborate on how C domain specificity is determined.</p>
+       <h1>Detection of Cyclic Peptide Synthatase Products</h1>
-<p>For our <em>B. subtilis</em> strain, we decided to go with a complete knockout of the <em>mutSL</em>&nbsp;operon, which is likely to result in a genomically unstable strain that is not suitable for industrial fermentations etc. An improved strain would contain elements for inducible repression of MutSL and expression of Beta/GP35.</p>
+<h2>Introduction:</h2>
+<p>Separation and identification of our non-ribosomal peptide synthase (NRPS) products was determined by high performance liquid chromatography coupled to mass spectrometry (HPLC-MS). NRPS variants were identified by changes in mass and column retention time as well as fragmentation patterns. Development of a matrix assisted laser desorption ionization time-of-flight mass spec (MALDI-TOF-MS) method will allow for future rapid analysis of oligo-recombineered strains producing a library of NRPS antibiotic products. DTU&rsquo;s 2015 iGEM team was able to procure the assistance of the DTU Metabolomics Platform group, which specializes in analytical chromatography and is recognized in our attributions page <span style="background-color:#FFFF00;">(Missing Link???)</span>. With assistance from our advisor, a protocol was established to lyse the cells and extract the Tyrocidine or Surfactin molecules before they were run on the liquid chromatography mass spec (LCMS) for analysis.</p>
+<h2><strong>Background: </strong></h2>
+<p>Tyrocidine and surfactin can both be separated by liquid chromatography, which separates molecules in a liquid mobile phase as they pass over a solid stationary media in a column. Molecules bind to or elute off the column based on their differing physical properties; including electronegativity, polarity, hydrophobicity, or size. Different detection methods (eg. mass spectroscopy, fluorescence detection, UV/Visible light spectroscopy) can then be coupled to the HPLC to analyze the compounds that were separated from the original solution. The reversed phase liquid chromatography column used in our method has a non-polar stationary phase and polar mobile phase, which causes polar molecules to elute before non-polar compounds. Initial preparative steps remove large contaminants from the sample such as the cell membranes or organelles, which can clog and damage the columns.</p>
+<p>As there are many different metabolites produced by prokaryotic and eukaryotic cells, it is important to have an idea of the chemical properties and mass of the target compound. Tyrocidine is an amphiphilic, cyclic peptide naturally produced by a non-ribosomal peptide synthase (NRPS) in <em>Bacillus brevis </em>with antimicrobial properties against gram-positive bacteria<sup>1</sup>. It functions to disrupt cell membranes, but has been shown to have high hemolytic activity<sup>2</sup>, making it unsuitable for intravenous use. Tyrocidine has been reported in the literature to have 5 main forms with the general peptide sequence of &hellip;D-Phe<sub>1</sub>/Tyr<sub>1</sub> &ndash; Pro<sub>2</sub> &ndash; Phe<sub>3</sub>/Trp<sub>3</sub>/Tyr<sub>3</sub> &ndash; D-Phe<sub>4</sub>/D-Trp<sub>4</sub>/D-Tyr<sub>4&shy;</sub> &ndash; Asn<sub>5</sub> &ndash; Gln<sub>6</sub>/Asp<sub>6</sub> &ndash; Val<sub>8</sub> &ndash; Orn<sub>9</sub> &ndash; Leu<sub>10</sub>&hellip; <sup>3</sup></p>
+<p>&nbsp;</p>
+<p><img alt="" src="None" style="width: 300px; height: 214px; border-width: 1px; border-style: solid;" /></p>
+<p>Figure 1: Surfactin, highlighted with the blue circle at the location of the mutation from an aspartic acid residue to asparagine</p>
+<p><img alt="" src="None" style="width: 300px; height: 288px; border-width: 1px; border-style: solid;" /></p>
+<p>Figure 2: cyclic NRP,&nbsp;Tyrocidine A</p>
      </div>
@@ Line 483: / Line 1,453: @@
-<div id="Conclusions">
+<div id="Chip-Library">
    <div class="container">
      <div class="row col-md-12">
        <h1>
-         Conclusions
+         Chip Library
        </h1>
-       <p>Our experiments show, that Beta/GP35 in combination with a MutSL knockout is capable of efficient oligo mediated genome engineering.</p>
-<p>Adenylation domain conclusions ..</p>
      </div>
    </div>
@@ Line 510: / Line 1,477: @@
            <li>Strieker, M., Tanović, A., & Marahiel, M. A. (2010). Nonribosomal peptide synthetases: structures and dynamics. Current Opinion in Structural Biology, 20(2), 234–240. <a href="http://dx.doi.org/10.1016/j.sbi.2010.01.009" target="_blank">doi:10.1016/j.sbi.2010.01.009</a></li>
-           <li>Finking, R., & Marahiel, M. A. (2004).  Biosynthesis of Nonribosomal Peptides 1 . Annu. Rev. Microbiol., 58(1), 453–488. <a href="http://dx.doi.org/10.1146/annurev.micro.58.030603.123615" target="_blank">doi:10.1146/annurev.micro.58.030603.123615</a></li>
+           <li>Caboche, S., Leclere, V., Pupin, M., Kucherov, G., & Jacques, P. (2010). Diversity of Monomers in Nonribosomal Peptides: towards the Prediction of Origin and Biological Activity. Journal of Bacteriology, 192(19), 5143–5150. <a href="http://dx.doi.org/10.1128/jb.00315-10" target="_blank">doi:10.1128/jb.00315-10</a></li>
-           <li>Caboche, S., Pupin, M., Leclere, V., Fontaine, A., Jacques, P., & Kucherov, G. (2007). NORINE: a database of nonribosomal peptides. Nucleic Acids Research, 36(Database), D326–D331. <a href="http://dx.doi.org/10.1093/nar/gkm792" target="_blank">doi:10.1093/nar/gkm792</a></li>
+           <li>DiMasi, J. A., Hansen, R. W., & Grabowski, H. G. (2003). The price of innovation: new estimates of drug development costs. Journal of Health Economics, 22(2), 151–185. <a href="http://dx.doi.org/10.1016/s0167-6296(02)00126-1" target="_blank">doi:10.1016/s0167-6296(02)00126-1</a></li>
-           <li>Caboche, S., Leclere, V., Pupin, M., Kucherov, G., & Jacques, P. (2010). Diversity of Monomers in Nonribosomal Peptides: towards the Prediction of Origin and Biological Activity. Journal of Bacteriology, 192(19), 5143–5150. <a href="http://dx.doi.org/10.1128/jb.00315-10" target="_blank">doi:10.1128/jb.00315-10</a></li>
+           <li>DiMasi, J. A., Grabowski, H. G., & Hansen, R. W. (2015). The Cost of Drug Development. N Engl J Med, 372(20), 1972–1972. <a href="http://dx.doi.org/10.1056/nejmc1504317" target="_blank">doi:10.1056/nejmc1504317</a></li>
+          <li>Lee, J.-H. (2010). Use of Antioxidants to Prevent Cyclosporine A Toxicity. Toxicological Research, 26(3), 163–170. <a href="http://dx.doi.org/10.5487/tr.2010.26.3.163" target="_blank">doi:10.5487/tr.2010.26.3.163</a></li>
+          <li>Henderson, J. C., Fage, C. D., Cannon, J. R., Brodbelt, J. S., Keatinge-Clay, A. T., & Trent, M. S. (2014).  Antimicrobial Peptide Resistance of Vibrio cholerae Results from an LPS Modification Pathway Related to Nonribosomal Peptide Synthetases . ACS Chemical Biology, 9(10), 2382–2392. <a href="http://dx.doi.org/10.1021/cb500438x" target="_blank">doi:10.1021/cb500438x</a></li>
+          <li>Kohli, R. M., Walsh, C. T., & Burkart, M. D. (2002). Biomimetic synthesis and optimization of cyclic peptide antibiotics. Nature, 418(6898), 658–661. <a href="http://dx.doi.org/10.1038/nature00907" target="_blank">doi:10.1038/nature00907</a></li>
+          <li>Finking, R., & Marahiel, M. A. (2004).  Biosynthesis of Nonribosomal Peptides 1 . Annu. Rev. Microbiol., 58(1), 453–488. <a href="http://dx.doi.org/10.1146/annurev.micro.58.030603.123615" target="_blank">doi:10.1146/annurev.micro.58.030603.123615</a></li>
            <li>Stachelhaus, T., Mootz, H. D., & Marahiel, M. A. (1999). The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chemistry & Biology, 6(8), 493–505. <a href="http://dx.doi.org/10.1016/s1074-5521(99)80082-9" target="_blank">doi:10.1016/s1074-5521(99)80082-9</a></li>
@@ Line 521: / Line 1,496: @@
            <li>Lautru, S. (2004). Substrate recognition by nonribosomal peptide synthetase multi-enzymes. Microbiology, 150(6), 1629–1636. <a href="http://dx.doi.org/10.1099/mic.0.26837-0" target="_blank">doi:10.1099/mic.0.26837-0</a></li>
+          <li>Medema, M. H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M. A., … Breitling, R. (2011). antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 39(suppl), W339–W346. <a href="http://dx.doi.org/10.1093/nar/gkr466" target="_blank">doi:10.1093/nar/gkr466</a></li>
+          <li>Weber, T., Blin, K., Duddela, S., Krug, D., Kim, H. U., Bruccoleri, R., … Medema, M. H. (2015). antiSMASH 3.0—a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Research, 43(W1), W237–W243. <a href="http://dx.doi.org/10.1093/nar/gkv437" target="_blank">doi:10.1093/nar/gkv437</a></li>
+          <li>Blin, K., Medema, M. H., Kazempour, D., Fischbach, M. A., Breitling, R., Takano, E., & Weber, T. (2013). antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Research, 41(W1), W204–W212. <a href="http://dx.doi.org/10.1093/nar/gkt449" target="_blank">doi:10.1093/nar/gkt449</a></li>
+          <li>Sundlov, J. A., Shi, C., Wilson, D. J., Aldrich, C. C., & Gulick, A. M. (2012). Structural and Functional Investigation of the Intermolecular Interaction between NRPS Adenylation and Carrier Protein Domains. Chemistry & Biology, 19(2), 188–198. <a href="http://dx.doi.org/10.1016/j.chembiol.2011.11.013" target="_blank">doi:10.1016/j.chembiol.2011.11.013</a></li>
+          <li>Minowa, Y., Araki, M., & Kanehisa, M. (2007). Comprehensive Analysis of Distinctive Polyketide and Nonribosomal Peptide Structural Motifs Encoded in Microbial Genomes. Journal of Molecular Biology, 368(5), 1500–1517. <a href="http://dx.doi.org/10.1016/j.jmb.2007.02.099" target="_blank">doi:10.1016/j.jmb.2007.02.099</a></li>
+          <li>CALNE, R. (1985). CYCLOSPORIN G: IMMUNOSUPPRESSIVE EFFECT IN DOGS WITH RENAL ALLOGRAFTS. The Lancet, 325(8441), 1342. <a href="http://dx.doi.org/10.1016/s0140-6736(85)92844-2" target="_blank">doi:10.1016/s0140-6736(85)92844-2</a></li>
            <li>Mosberg, J. A., Lajoie, M. J., & Church, G. M. (2010). Lambda Red Recombineering in Escherichia coli Occurs Through a Fully Single-Stranded Intermediate. Genetics, 186(3), 791–799. <a href="http://dx.doi.org/10.1534/genetics.110.120782" target="_blank">doi:10.1534/genetics.110.120782</a></li>
@@ Line 527: / Line 1,514: @@
            <li>Wang, H. H., & Church, G. M. (2011). Multiplexed Genome Engineering and Genotyping Methods. Synthetic Biology, Part B - Computer Aided Design and DNA Assembly, 409–426. <a href="http://dx.doi.org/10.1016/b978-0-12-385120-8.00018-8" target="_blank">doi:10.1016/b978-0-12-385120-8.00018-8</a></li>
+          <li>Bonde, M. T., Kosuri, S., Genee, H. J., Sarup-Lytzen, K., Church, G. M., Sommer, M. O. A., & Wang, H. H. (2015). Direct Mutagenesis of Thousands of Genomic Targets Using Microarray-Derived Oligonucleotides. ACS Synthetic Biology, 4(1), 17–22. <a href="http://dx.doi.org/10.1021/sb5001565" target="_blank">doi:10.1021/sb5001565</a></li>
+          <li>Bonde, M. T., Klausen, M. S., Anderson, M. V., Wallin, A. I. N., Wang, H. H., & Sommer, M. O. A. (2014). MODEST: a web-based design tool for oligonucleotide-mediated genome engineering and recombineering. Nucleic Acids Research, 42(W1), W408–W415. <a href="http://dx.doi.org/10.1093/nar/gku428" target="_blank">doi:10.1093/nar/gku428</a></li>
            <li>Sun, Z., Deng, A., Hu, T., Wu, J., Sun, Q., Bai, H., … Wen, T. (2015). A high-efficiency recombineering system with PCR-based ssDNA in Bacillus subtilis mediated by the native phage recombinase GP35. Applied Microbiology and Biotechnology, 99(12), 5151–5162. <a href="http://dx.doi.org/10.1007/s00253-015-6485-5" target="_blank">doi:10.1007/s00253-015-6485-5</a></li>
@@ Line 534: / Line 1,525: @@
            <li>Seco, E. M., Zinder, J. C., Manhart, C. M., Lo Piano, A., McHenry, C. S., & Ayora, S. (2012). Bacteriophage SPP1 DNA replication strategies promote viral and disable host replication in vitro. Nucleic Acids Research, 41(3), 1711–1721. <a href="http://dx.doi.org/10.1093/nar/gks1290" target="_blank">doi:10.1093/nar/gks1290</a></li>
-           <li>Bonde, M. T., Kosuri, S., Genee, H. J., Sarup-Lytzen, K., Church, G. M., Sommer, M. O. A., & Wang, H. H. (2015). Direct Mutagenesis of Thousands of Genomic Targets Using Microarray-Derived Oligonucleotides. ACS Synthetic Biology, 4(1), 17–22. <a href="http://dx.doi.org/10.1021/sb5001565" target="_blank">doi:10.1021/sb5001565</a></li>
+           <li>Nakano MM, Magnuson R, Myers A, Curry J, Grossman AD, Zuber P. srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol. 1991 Mar;173(5):1770-8</li>
-           <li>Bonde, M. T., Klausen, M. S., Anderson, M. V., Wallin, A. I. N., Wang, H. H., & Sommer, M. O. A. (2014). MODEST: a web-based design tool for oligonucleotide-mediated genome engineering and recombineering. Nucleic Acids Research, 42(W1), W408–W415. <a href="http://dx.doi.org/10.1093/nar/gku428" target="_blank">doi:10.1093/nar/gku428</a></li>
+           <li>CyBase. September 15, 2015. http://www.cybase.org.au</li>
+          <li>Thorstholm L, Craik DJ. Discovery and applications of naturally occurring cyclic peptides. Drug Discov Today Technol. 2012;9:e13–e21. doi: 10.1016/j.ddtec.2011.07.005.</li>
+          <li>Zettler, J., Schütz, V., & Mootz, H. D. (2009). The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Letters, 583(5), 909–914. <a href="http://dx.doi.org/10.1016/j.febslet.2009.02.003" target="_blank">doi:10.1016/j.febslet.2009.02.003</a></li>
+          <li>Cheriyan, M., Pedamallu, C. S., Tori, K., & Perler, F. (2013). Faster Protein Splicing with the Nostoc punctiforme DnaE Intein Using Non-native Extein Residues. Journal of Biological Chemistry, 288(9), 6202–6211. <a href="http://dx.doi.org/10.1074/jbc.m112.433094" target="_blank">doi:10.1074/jbc.m112.433094</a></li>
        </ol>
@@ Line 543: / Line 1,540: @@
 </div>
-     <footer class="container">
+     <div class="container">
        <div class="row">
          <div class="col-md-2 col-md-offset-2">
@@ Line 567: / Line 1,564: @@
          </div>
        </div>
-     </footer>
+     </div>
      <div class="sponsors">
-       <div class="container">
+       <div class="container-fluid">
          <div class="row">

Difference between revisions of "Team:DTU-Denmark/Project"

Revision as of 14:31, 16 September 2015

Project

The Synthesizer

Background

Adenylation domains

Peptidyl carrier protein domains

Condensation domains

Thioesterase domains

Engineering of NRPS

Prediction of adenylation domain specificity

Potential NRP targets for drug improvement

Hypothesis: Targetted engineering of adenylation domains using OGRE

Oligo mediates recombineering

Multiplex Automated Genome Engineering (MAGE)

Chip-based oligonucleotide synthesis

Oligo design

Oligo mediated recombineering in Bacillus subtilis

Unleash the OGRE!

Optimization of OGRE

Oligo Software

Modifying surfactin

Achivements

Experimental design

Methods

Results

Expression of tyrocidine

Lab-on-chip Screening

Intein

Achivements

Background

Methods

Chomatographic analysis of cyclic peptides

Discussion

Detection of NRP

Detection of Cyclic Peptide Synthatase Products

Introduction:

Background:

Chip Library

References