Too much work to scroll? Click on the following Links to Jump to a Topic!
Objective
Project Proposal
Parts
OBJECTIVE:
The objective of this research project is to develop a novel mechanism of detecting and eradicating the carcinogenic pathogen, Helicobacter pylori, from its stomach dwelling microbiota. Escherichia coli will be engineered with a specific ArsR regulated promoter in order to detect a low pH environment, similar to the physiology of the human stomach. In response to low pH detection, the strain will produce the phenotypic response, production of yellow fluorescent protein. Once the promoter activity at different pH levels is quantified, the E. coli will be further engineered to produce an inhibitory 6mer peptide, identified previously in phage display studies to inhibit urease activity, a necessary extracellular enzyme produced by H. pylori in order to colonize the human stomach. The results of this project will provide the scientific community with a new potential approach of H. pylori bacteria therapy. This concept could further be extended as a possible treatment option for any pathogenic infection via engineered probiotics.
Back to Top
PROJECT PROPOSAL:
Helicobacter pylori, a Gram-negative bacterium, is classified as a class I carcinogen. An H. pylori infection causes gastric duodenal ulcers, gastric lymphoma, and chronic gastritis, which is a precursor to gastric carcinoma. H. pylori infects about half of the human population, with high prevalence in developing countries. H. pylori-induced gastric inflammation usually does not cause symptoms in the infected person, meaning the prevention of gastric ulcers is virtually impossible. The current method of treating an infection of H. pylori is with the use of antibiotics, including Protein Pump Inhibitor (PPI), amoxicillin, clarithromycin, and metronidazole2. The rising complication with using antibiotics, however, is the propagation of antibiotic resistant bacteria, as well as the eradication of predominantly beneficial gut bacteria. In the absence of antibiotic therapy, H. pylori can live in the stomach for decades, or even an entire lifetime. What is most notable about H. pylori is its ability to secrete products that are linked with its ability to evade the host's innate immune system1. There is a great need for a new approach of eliminating H. pylori from the body.
Urease is an extracellular enzyme, produced by H. pylori, which allows the microenvironment surrounding H. pylori to be buffered against the harsh acidity of the mammalian stomach via the cleavage of urea to ammonia and carbon dioxide by urease.3 Synthetic peptides have been produced in studies utilizing phage display, which demonstrate a non-competitive interaction with urease by a unique 6mer peptide. It has been suggested that this particular peptide (YDFYWW) interacts with urease via hydrophilic/hydrophobic interactions, causing a spatial modification to the enzyme’s catalytic core, thus inhibiting urea cleavage.4 Given this information, and the requirement of H. pylori to have the ability to buffer its microenvironment via urea cleavage by urease, we hypothesize that an environment physiologically similar to the mammalian stomach and appropriately saturated with this particular 6mer peptide could potentially inhibit the growth of H. pylori, or any other non-acidophile, as the pH of the environment would be sufficient to inhibit growth.
Additionally, studies into the regulation of urease production and acid-tolerance of H. pylori have shown that, in acidic environments, a promoter region directly upstream of the ureA and ureB genes, encoding the ureA and ureB subunits of urease, is regulated by the well-studied ArsR regulatory system, which is present in Escherichia coli.5 The utilization of a pH promoter, PureA, in a biological system designed to minimize antibiotic “noise”, in the form of molecules intended to inhibit microbiological growth, appears to be desirable.
Therefore, it is our intention to design a biological system to regulate production of a 6mer peptide in host organism E. coli, and to produce the 6mer when in an acidic environment, as regulated naturally by PureA in H. pylori as apart of its innate metabolic regulatory machinery. Additionally, we will couple the 6mer peptide to a Twin-Arginine Translocation tag sequence, in order for the 6mer to be recognized by the innate TAT peptide secretion mechanism in E. coli. With a construct containing these genetic components, and additional subsets of these components coupled with standard laboratory reporter genes, we will be able to test and quantify the efficacy of this novel, organism-specific, anatomically specific anti-H. pylori biological treatment system.
References
1. Scott Algood H, Cover T. “Helicobacter pylori Persistence: an Overview of Interactions between H. pylori and Host Immune Defenses.” Clinical Microbial Review. 2006; 19(4): 597-613.
2. Zou Q, Wei W. “Phage Therapy: Promising For H. pylori Infection.” Clinical Microbiology. 2013; 2: 112.
3. Blanke S, Ye D. Alternative Mechanisms of Protein Release. In: Mobley H, Mendz G, Hazell S, editors. Helicobacter pylori: Physiology and Genetics Washington DC: ASM Press; 2001. Chapter 20.
4. Houimel M, Mach J, Corthesy-Theulaz I, Corthesy B, Fisch I. New inhibitors of Helicobacter pylori urease holoenzyme selected from phage-displayed peptide libraries. Eur J Biochem. 1999; 262:774-780.
5. Pflock M, Kennard S, Delany I, Scarlato V, Beier D. Acid-Induced Activation of the Urease Promoters Is Mediated Directly by the ArsRS Two-Component System of Helicobacter pylori. Infect Immun. 2005; 73(10): 6437-6445.
Back to Top
PARTS:
1.) KTP6merNG3
Individual components
Prefix (with start codon): GTTTCTTCGAATTCGCGGCCGCTTCTAG
RBS
BBa_B0030 : ATTAAAGAGGAGAAA
torA
BBa_K1012002:
ATGAACAATAACGATCTCTTTCAGGCATCACGTCGGCGTTTTCTGGCACAACTCGGCGGCTTAACCGTGGCCGGGA
TGCTGGGGCCGTCATTGTTAACGCCGCGACGTGCGACTGCGGCGCAAGCG
6-mer: TATGATTTTTATTGGTGG
Suffix (Double stop codon):
TAATAATACTAGTAGCGGCCGCTGCAGGAAGAAAC
KTP6merNG3 – Composite part
GTTTCTTCGAATTCGCGGCCGCTTCTAGATTAAAGAGGAGAAAATGAACAATAACGATCTCTTTCAGGCATCACGT
CGGCGTTTTCTGGCACAACTCGGCGGCTTAACCGTGGCCGGGATGCTGGGGCCGTCATTGTTAACGCCGCGACG
TGCGACTGCGGCGCAAGCGTATGATTTTTATTGGTGGTAATAATACTAGTAGCGGCCGCTGCAGGAAGAAAC
KTP6merNG3 schematic:
KTP6merNG3 purpose:
The KTP6merNG3 synthetic gene is a construct designed by the UMass-Dartmouth iGEM team to accomplish the goal of integrating a composite part, comprised of a strong RBS, a TorA TAT signaling sequence, and the AA sequence for the 6mer urease inhibitory peptide, into a standard 3A assembly biobrick vector. The construct is then capable of coupling with any promoter part for regulation of the gene product, which will eventually be just the secreted 6mer.
2.) PureA promoter
Individual components:
Promoter Prefix (without start codon):
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG
PureA isolated via PCR from H. pylori:
AACACTAATTCATTTTAAATAATAATTAGTTAATGAACGCTTCTGTTAA
TCTTAGTAAATCAAAACATTGCTACAATTACATCCAACCTTGATTTCGT
TATGTCTTCAAGGAAAAACACTTTAAGAATAGGAGAATAAG
Upstream part suffix:
TACTAGTAGCGGCCGCTGCAGGAAGAAAC
PureA promoter part:
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAACACTAATTCATTTTAAATAATAATTAGTTAATGAACGCTTCTGT
TAATCTTAGTAAATCAAAACATAATTACATCCAACCTTGATTTCGTTATGTCTTCAAGGAAAAACACTTTAAG
AATAGGAGAATAAGTACTAGTAGCGGCCGCTGCAGGAAGAAAC
PureA promoter schematic:
PureA promoter purpose:
PureA is naturally regulated by the ArsR regulatory system in E. coli, named after the stress response to arsenic, however this system has been shown to also be the regulatory machinery for production of gene products when in an acidic environment in H. pylori. This ArsR system positively regulates gene products directly downstream of the PureA promoter sequence in response to both stress-response inducing acidic conditions, and arsenic contamination, making it a useful regulatory promoter for biological systems.
Back to Top