Difference between revisions of "Team:DTU-Denmark/Project/Surfactin"

Line 299: Line 299:
 
         Achievements
 
         Achievements
 
       </h1>
 
       </h1>
       <p><img alt="" src="/wiki/images/7/78/DTU-Denmark_surfactin_highlight.png" style="height: 285px; width: 400px;" /></p>
+
       <p><img alt="" src="/wiki/images/7/78/DTU-Denmark_surfactin_highlight.png" style="height: 285px; width: 400px;" /><span style="font-size:14px;">Figure 1. Picture of surfactin</span></p>
  
 
<p>As a proof of concept, we tried to modify the surfactin synthase by substituting aspartic acid with aspargine using oligo mediated recombineering.</p>
 
<p>As a proof of concept, we tried to modify the surfactin synthase by substituting aspartic acid with aspargine using oligo mediated recombineering.</p>
Line 314: Line 314:
 
         Experimental design
 
         Experimental design
 
       </h1>
 
       </h1>
       <p>Surfactin (Figure # MISSING) is a surfactant&nbsp;cyclic lipopeptide produced by&nbsp;<em>Bacillus subtilis. </em>It is important for sporulation in&nbsp;<em>B. subtilis</em>&nbsp;[1]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). antiSMASH prediction of adenylation domain specificity corresponds&nbsp;to surfactant. The NRPS modules are divided out on three contigs (ctg1_353-5) with 3, 3, and 1 module, respectively&nbsp;(Figure # MISSING).</p>
+
       <p>Surfactin (Figure 1) is a surfactant&nbsp;cyclic lipopeptide produced by&nbsp;<em>Bacillus subtilis. </em>It is important for sporulation in&nbsp;<em>B. subtilis</em>&nbsp;[1]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). antiSMASH prediction of adenylation domain specificity corresponds&nbsp;to surfactant. The NRPS modules are divided out on three contigs (ctg1_353-5) with 3, 3, and 1 module, respectively&nbsp;(Figure # MISSING).</p>
  
 
<p>The second module (or module 5) of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp-&gt;Asn. Three different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table MISSING), yielding different number of mismatches in the oligo.</p>
 
<p>The second module (or module 5) of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp-&gt;Asn. Three different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table MISSING), yielding different number of mismatches in the oligo.</p>
  
<p><strong>Table #MISSING&nbsp;</strong>List of oligos used to modify surfactin NRPS.</p>
+
<p><strong>Table 1 </strong>List of oligos used to modify surfactin NRPS.</p>
  
 
<p><span style="font-size:14px;"></span></p>
 
<p><span style="font-size:14px;"></span></p>
Line 330: Line 330:
 
<tbody>
 
<tbody>
 
<tr>
 
<tr>
<td>name</td>
+
<td>&nbsp;oligo name</td>
 
<td>sequence</td>
 
<td>sequence</td>
 
<td>LengthMutation(Stacelhaus)</td>
 
<td>LengthMutation(Stacelhaus)</td>
<td>length of oligo</td>
+
<td>
 +
<p>length</p>
 +
</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
Line 374: Line 376:
 
<h2><span style="font-size:20px;">Methods</span></h2>
 
<h2><span style="font-size:20px;">Methods</span></h2>
  
<p>Electrocompetent <em>B. subtilis&Delta;mutS::beta-neo<sup>R</sup> </em>or&nbsp;<em>&Delta;mutS::GP35-neo<sup>R</sup></em>&nbsp; mutation was used. (see protocol for making eletrocompetent bacillus MISSING ) Three oligoes were used for this experiment. The two showed in table ? was used separately, and the streptomycin resisters oligo called B_sub_Mods0007.1mutationrpsL (link to primer list MISSING) was used to select for the desired change. 100uL of cells was mixed with 5uL of the surfactine changing oligo and 0.5uL of an streptomycin resistance oligo was used in accordance with the protocol for electroporation. (link MISSING)</p>
+
<p>Electrocompetent <em>B. subtilis&Delta;mutS::beta-neo<sup>R</sup> </em>or&nbsp;<em>&Delta;mutS::GP35-neo<sup>R</sup></em>&nbsp; mutation was used.&nbsp; Three oligoes were used for this experiment. The two showed in table ? was used separately, and the streptomycin resisters oligo called B_sub_Mods0007.1mutationrpsL was used to select for the desired change. 100uL of cells was mixed with 5uL of the surfactine changing oligo and 0.5uL of an streptomycin resistance oligo was used in accordance with the protocol for electroporation. (link MISSING)</p>
  
 
     </div>
 
     </div>

Revision as of 03:23, 19 September 2015

Achievements

Figure 1. Picture of surfactin

As a proof of concept, we tried to modify the surfactin synthase by substituting aspartic acid with aspargine using oligo mediated recombineering.

Experimental design

Surfactin (Figure 1) is a surfactant cyclic lipopeptide produced by Bacillus subtilis. It is important for sporulation in B. subtilis [1]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). antiSMASH prediction of adenylation domain specificity corresponds to surfactant. The NRPS modules are divided out on three contigs (ctg1_353-5) with 3, 3, and 1 module, respectively (Figure # MISSING).

The second module (or module 5) of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp->Asn. Three different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table MISSING), yielding different number of mismatches in the oligo.

Table 1 List of oligos used to modify surfactin NRPS.

 oligo name sequence LengthMutation(Stacelhaus)

length

Oligo_surf_

Asp->Asn_1_l

C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGA

TAAATTCGGTATGTCCATACATCTTAC

H322E, I330S 200
oligo_surf asp->Asn_2_I

T*T*CGCAAATGCATCCGGCTCATACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCT

GTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTACGGAAGGCGATAACATCAGTCGG

GATGATTTTTTCTCCTCCCAAGAGGATCAAGCGCAAGGATTCAAAGTTCGCATCTTTTGCAAAACTGGC

V299L, H322E, I330S  200

 

Methods

Electrocompetent B. subtilisΔmutS::beta-neoR or ΔmutS::GP35-neoR  mutation was used.  Three oligoes were used for this experiment. The two showed in table ? was used separately, and the streptomycin resisters oligo called B_sub_Mods0007.1mutationrpsL was used to select for the desired change. 100uL of cells was mixed with 5uL of the surfactine changing oligo and 0.5uL of an streptomycin resistance oligo was used in accordance with the protocol for electroporation. (link MISSING)

Results

Oligo reecombineering competent strain (mutSΔ::GP35) was electroporated with Oligo_surf_Asp->Asn_1_l

and Oligo_surf_Asp->Asn_2_l from Table MISSING. After recovery of cells for 3 hours, dilutions were plated on LB agar plates containing 5.

References

  1. Nakano MM, Magnuson R, Myers A, Curry J, Grossman AD, Zuber P. srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol. 1991 Mar;173(5):1770-8
Technical University of Denmark
Department of Systems Biology
Søltofts Plads 221
2800 Kgs. Lyngby
Denmark
P: +45 45 25 25 25
M: dtu-igem-2015@googlegroups.com