Team:DTU-Denmark/Project
The Synthesizer
Nonribosomal petides (NRP) are a diverse class of short, bioactive peptides isolated from plant, fungi, and bacteria. Clinical uses of NRPs include antibiotics, immunosuppressants, antifungal, and antitumor drugs [1]. The diversity in bioactivity of these peptides can be explained in the way they are synthesized [2]. They are synthesized by highly modular enzymes called nonribosomal peptide synthetases (NRPS). Through repeated condensations of more than 500 different amino acids in an assembly line manner, they synthesize a range of diverse peptides with a range of different activities [3]. Discovery of novel NRP has a large potential in drug discovery, but is limited by the accelarating cost of drug development [4,5]. Some existing nonribosomal peptide on the market are associated with severe side-effects [6] or reduced activity due to resistance [7], while the implementation of other potential NRP drugs are limited due to their toxicity [8]. There is therefore the potential for improvement of already existing NRP drugs; an area which is largely unexploited due to the complexity of NRPS. The DTU Synthesizer Team sought to solve this problem by building a novel platform for generating libraries of NRP drugs that can be screened for improved activity, reduced side-effect, or toxicity. The libraries are made using directed evolution of NRPS using libraries of short single-stranded DNA (ssDNA). The four steps of The Synthesizer is: MISSING Expression, Libraries, Screening, and Modelling (Figure # MISSING). We sought to optimize each step of the cycle to improve the platform. In addition to potentially improving drugs, our platform can also expand our knowledge of these large multidomain proteins that due to their size are hard to study.
Background
Unlike proteins, nonribosomal peptides are not synthesized through translation, but rather by sequential condensation of amino acids by large multimodular enzymes called nonribosomal peptide synthetases (NRPS) [1,9]. In fact, it is these complex pattern of condensation of amino acids that attributes to the activity of these compounds. NRPSs do not rely on an external template for synthesis of their products. They can be divided up in modules that each are responsible for incorporating one additional amino acid onto the growing peptide chain much like an assembly line (Figure MISSING#) [2]. At the end of the assembly line, the growing peptide is released as a linear peptide or through cyclization.
Each module, with the exception of the initiation, consists of at least three domains. These domains are responsible for activating the monomer (adenylation (A) domain), holding the activated monomoer (peptidyl carrier protein (PCP) domain), and amino acid condensation (condensation (C) domain). The C-domain is lacking in initation modules and the terminal module contains an additional required domain responsible for termination and release of the product called thioesterase (TE) domain [9].
Adenylation domains
The Adenylation domains are responsible for activating and attaching the amino acid monomers to the PCP domain. They act as gatekeepers, ensuring that only the desired monomers are incorporated. They may be highly specific, only binding a single amino acid, or as in the case with Tyrocidine, see below, allow multiple similar amino acids to be incorporated in the peptide [2]. In the late 1990's the so called specificity-conferring code of A domains was revealed [10]. This code consists of the 10 amino acids, which were identified by sequence alignments to the first solved A domain crystal structure PheA [11], that are responsible for substrate binding (READ MORE MISSING).
Peptidyl carrier protein domains
The monomers are covalently bound to the PCP domains through thioester bonds. Before they can accept the monomers, they must be activated by posttranslational modification. A 4'-phosphopantetheinyl transferases (PPTase) transfers a 4'-phosphopantetheine (4'-PP) moiety, carrying the sulfhydryl group required for thioester bond formation, from coenzyme A to a conserved serine residue in the PCP domain [9].
Condensation domains
Elongation of the peptidyl chain is performed by the C domains, which catalyze the condensation of the peptidyl chain bound to the upstream PCP domain and the amino acid bound to the downstream PCP domain. These domains have a strong stereoselectivity and may have some specificity towards the side chain of the amino acid incorporated by the A domain of the same module, whereas little specificity has been observed towards the peptidyl chain [12].
Thioesterase domains
MISSING
Engineering of NRPS
With a pool of more than 500 different amino acid monomers, a peptide of only nine monomers have almost infite possibilities of composition. Yet, to our knowledge, improvement of existing NRP drugs through genomic engineering of NRPS in vivo still remains unaccomplished. This is perhaps surprising as it for long has been possible to predict NRPS clusters/operon by genomic mining and in addition predict NRP products by analysis of adenylation domains [13?5]. A classical engineering approach is therefore to simple combine modules with known specificity into a synthetic assembly line. Two years ago, the iGEM team from Heidelberg tried to imrpove synthesis of synthetic peptides by combining different modules (MISSING LINK TO THEIR WIKI). In addition, they implemented a NRPS module (indC) which produces a blue compound and they combined this module with other NRPS module to produce tagged peptides. Such a tagging system would greatly improve the synthesis of synthetic NRPS-derived peptides, but to our knowledge, it has not been possible to repeat the experiment within the group at Heidelberg since then. The reason why synthetic modular-based design of NRPS is not yet possible, may be explained by recent insight into NRPS structure provided by structural analysis [11,16]. Crystallization of NRPS is complicated by their large size and mobile structure, but domain-specific crystallisation and other structural analysis has highlighted that specific interactions between individual modules in NRPS is crucical for the catalytic acivity and subsequently transfer of the growing peptide to the next module [16].
Prediction of adenylation domain specificity
antiSMASH predicts NRPS clusters by patially Hidden Markov Models. It also predicts a consensus product by integrating three different methods for predictions of adenylation domain specificity These methods are: NRPSpredictor2, Stachelhaus, and Minova et al. [15,17]. Stachelhaus et al. alligned the binding pocket of 160 adenylation domains using a structural alignment approach. By trimming of the sequence 10 core amino acids encoding specificity in the binding pocket was identified giving rise to the Stachelhaus code (Table # MISSING). In addition, it was shown that by modying the binding pocket in silico substrate affinity could be altered or relaxed [10].
Prediction is sometimes complicated by the fact that adenylation domains sometimes show more or less variability in amino acid specificity. In addition, the Stachelhaus code show some redundance in the 160 sequences [10]. Tyrocidine is an example of this. Tyrocidine is a commercially available mixture of non-ribosomal antibiotic synthesized by Brevibacillus parabrevis. It consists of four decapeptides varying at three amino acids (MISSING Table #) and is synthetiszed by the NRPS, Tyrocidine Synthetase A-C, containing 1, 3, and 6 modules, respetively. (Figure # MISSING HIGHER UP MICHAEL).
Tyrocidine has an unique mode of acton wherein it disrupts the function of the cell membrane. Unfortunately, it has high toxicity towards human blood and reproductive cells and can only be used in topical applications. This makes tyrocidine an interesting target for drug improvement. Under MISSING section you can read more about improvement of tyrocidine.
|
||||
|---|---|---|---|---|
|
Amino acid position |
||||
|
Tyrocidine |
3 |
4 |
7 |
|
|
A |
L-Phe |
D-Phe |
L-Tyr |
|
|
B |
L-Trp |
D-Phe |
L-Tyr |
|
|
C |
L-Trp |
D-Trp |
L-Tyr |
|
|
D |
L-Trp |
D-Trp |
L-Trp |
|
Potential NRP targets for drug improvement
In addition to tyrocidine, ciclosporin (or cyclosporin) is an important nonribosomal peptide drug used as an immunosuppressant in transplantations [6]. It consists of eleven amino acids which are cyclized upon releasing from the NRPS, like tyrocidine and contains D-amino acids and amino acids with modifications (Figure #). It was first isolated from the filamentous fungi Tolypocladium inflatum in 1969 and in 1972, its function as immunosuppresant was discovered by Sandoz (now Novartis). Despite, its widely use in clinal applications it is associated with side effects (adverse drug reactions) [6]. In ciclosporin G which is also isolated from Tolypocladium inflatum, the a-aminobutyric acid residue in position 2 has been replaced by norvaline [18]. Ciclosporin G has reduced side effects in some clinical applications and it highlights the possibility of drug improvement by NRPS engineering. A total of 25 derivates of ciclosporin are known [?]. Comparing the number of known derivates to the actual potential diversity in compounds of an 11-mer cyclic peptide (11500), only a very little fraction of potential compounds are known. Even substitution of a single amino acid would yield more than 5,000 different compounds that could be screened for improved function.
Hypothesis: Targetted engineering of adenylation domains using OGRE
As highlihgted above, there are multiple potential NRPS candidates that can be used for drug improvement through screening of NRP products, synthesized by modifying the Stachelhaus code of the adenylation domain. The limitation has been the limited genetic tools available for engineering of NRPS. Considering that the Tyrocidine Synthase is 1.25*106 Da which is approximately the size of the large subunit of the prokaryotic ribosome, this is perhaps not surprising. Even though that the changes required to potentially alter the specificity of the A-domain (~1-10 amino acids) according to the Stachelhaus code, transformation requires introduction of selection a casettes. As each NRPS module is ~1,500 amino acid and often multiple modules are encoded in one open reading frame, even few modifications require assembly and introduction of large expression casettes. For example the NRPS responsible to ciclosporin synthesis in Tolypocladium inflatum is encoded in a single gene simA encoding one 45.8 kb exon [?]. Amplification of 45.8 kb nucleotides is not feasable with standard PCR and would be considerable expensive to synthesize by even cheap errorprone DNA synthesis methods (calculated based on prices from IDT for gblock synthesis).
We hypothesized that NRPS directed evolution targetting the Stachelhaus code could lead to improvement of NRP drugs. We proposed that the recent advantge in oligo mediated reecombineering (OGRE) using short single-stranded DNA (ssDNA) can be applied to generate this diversity. While OGRE has low efficiencies, it is actually an advantge for generation of libraries, as multiplex and automated targetting with a library of oligos will create a library of different compounds.
Oligo mediates recombineering
Recombination-mediated genetic engineering or recombineering (we call it OGRE) utlises homologous recombination to facilitate genetic modifications at any desired target by flanking the mutated sequence with homologous regions. One system for recombineering in E. coli is the λ phage derived λ Red, consisting of the genes encoding three proteins, Gam, Exo and Beta. Gam prevents degradation of linear dsDNA by inhibition of nucleases, Exo degrades dsDNA in a 5'-3' direction yielding ssDNA, and Beta facilitates recombination by binding to the ssDNA [19].
Multiplex Automated Genome Engineering (MAGE)
Wang et al. developed a method for rapid and efficient targeted evolution of cells through cyclical recombineering with ssDNA (oligo) in E. coli. Using this automated method, they more than five-fold improved lycoprene production in E. coli in three days [20]. Through MAGE it is possible to simultaneously target many different loci or target the same locus with a pool of multiple and/or degenerate oligos. By using multiple oligos targetting the same locus, it is possible to generate a library of mutants varying only at the target locus in a short amount of time. The genetic variation in the population of cells will be a function of the degenerate pool complexity and combinatorial arrangements of the modifications at different loci and can be used to modify e.g. the active site of an enzyme [20,21].
The MAGE protocol utilises the λ Red recombination system in combination with an (temporary) inactivation of the mismatch repair system and consists of seven steps that can be done with standard laboratory equipment [21]. As MAGE utilises oligos, only the Beta protein of the λ Red system is required. In short, the cells are grown to mid-log phase, followed by induction of beta. The cells are then chilled to 4°C and washed with cold water to make the cells competent. The oligos are added to the cells which are then electroporated. The cycle is repeated every 2-3 hours allowing the cells to recover in between rounds of electroporations [21].
See figure.
Chip-based oligonucleotide synthesis
Traditional column-based oligo synthesis is costly for large scale MAGE experiments. Synthesis of 1,000 90-mer column-based oligos costs about 36,000 USD [22]. An alternative to this method is to use Microchip DNA arrays to synthesize the oligos on, with the advantage that the price scales with the number of chips instead of the number of oligos. Thus it is possible to have up to 12,472 130-mer oligos synthesized for 2,000 USD and up to 92,918 oligos for 5,000 USD (http://customarrayinc.com/oligos_main.htm).
This method however comes with a few disadvantages. The oligo amount comes in the picomolar range and is delivered as a single mix of all the oligos. Because of these disadvantages, an extra processing step is required before they can be used in MAGE experiments.
The oligos are synthesized with two 20 nucleotide flanking sequences (barcodes). These barcodes must include a thymidine immediately upstream and a DpnII restriction site immediately downstream of the oligo, while the rest of the barcodes can be designed for amplification with a specific primer. By using different barcodes, it is possible to design one oligo chip for multiple MAGE experiments. The thymidine allows amplification with an uracil-containing primer. In these primers U is substituted for T in the primer. The barcode can then be excited from the oligo using USER enzyme, DnpII, and a guide primer [22].
Oligo design
While the recombination frequency of MAGE can be increased by doing multiple cycles, care should be taken when designing oligos to ensure high efficiency for each individual cycle. There are several parameters that can be optimized to increase the recombination frequency.
The oligos should target the lagging strand of the replication fork as this is 10-100 times more efficient compared to targetting the leading strand, and the folding energy of the oligo should be considered, as it may form hairpins if it is too low, preventing incorporation.
The frequency is also dependent on the length of the oligo, as shorter oligos are less efficient due to their lower hybridization energy to the chromosome, while longer oligos have a higher tendency to form hairpins. 70-90-mer oligos seem to be the most efficient in E. coli [21].
Designing many optimized oligos for MAGE experiment is a time consuming task. Considering a 90-mer oligo with a single mismatch and 15nt homology arms results in 60 possible oligos with different secondary structures and consequently different recombineering efficiencies. Much of the time spent on designing oligos can be saved by using the online tool MODEST [23].
Oligo mediated recombineering in Bacillus subtilis
While the described λ Red reecombineering system is well exploited in E. coli the last years, the technology has not been adopted for genome editing to the same extend in other microorganisms. Application of λ Red reecombineering system has been described in Bacillus subtilis (ARTICLE 2012), but with longer oligos of approx. 2,000 nucletoides generated by PCR [24]. Besides expression of Beta, Sun et al. also expressed homologous recombinases from other phages. The gene product of region 35 (GP35) from the native B. subtilis phage SPP1 to Beta. Gene product of region 34 (GP34) encodes an endonuclease similar to λ Exo and GP35 is a recombinase protein homologous and GP36 is an ssDNA binding protein [25,26]. This native Bacilli reecombineering system yielded higher efficiency compared to λ Red in B. subtilis, but lower efficiency in E. coli [24]. Based on heteroloogus expression of many recombinases of different origin in Bacillus subtilis, it was included that recombineering efficiencies were optimised by using a recombinase derived from a phage which host was closely related to heterologous host. We noticed that codon usage of lambda beta is not optimal for expression of B. subtilis and that expression level (likeli due to codon usage) varried among the recombinases tested in the study. In addition, the length of the oligo tested is drastically different from the optimal length in E. coli based on the λ Red Lambda recombineering system.
Unleash the OGRE!
(Purpose: To make oligo reecombineering (we call this OGRE) in B. subtilis.)
Making small and prisice changes in the genome of a bacteria can be extreamly powerfull if you can standardize a method to do so.
We made a method for inserting small changes in the genome of B. subtilis. By using our Oligo Recombineering (OGRE) method we inserted small changes in the genome we showed that we can change the function of different genes with a high efficiency. The method was shown to work by knocking out the upp gene and making Bacillus resistant to streptomycin
Knock out of upp and amyE
As a prof of concept we knocked out the amyE and upp locus in B. subtilis by using oligoes that insert a stop codon in the coding sequence of the coding sequence. The oligoes were designed using the program MODEST ( ? link til modest ). We tried to use amyE and upp to calculate the transformation efficiency of the OGRE technique, but the results were to unclear to measure efficiency. The upp selection indicated that the knockout was possible but that the transformant grew slowly. The amyE screening could not give any conclusive results. The starch plates and 5-Fluorouracil (5-FU) plates were mixed with a deffined minimal medium ( ? see protocol for for minimal medium)
| Name | Oligo | Length | point mutation position |
| mage_amyE-1 | AAGTAACGGTTGCCAATTTGATACGATGTCGGCTGATACAGtCAtTACtAGTTCGACATGCTTTTATCTCCTTGATTCCCTTCCTTTACT | 90 | ? |
| mage_upp-1 | GGGTAATTTCAAATGCCATGAGTGTAGCCACTTCATCTACTtACTaTCaAAAATCCTTCGTACCTGTATTTTCATTCCGTATATATGTCA | 90 | ? |
Method
B. subtilis strain 168 with GP35 or lambda beta inserted in amyE or mutS knockouts were made electrocompetent using protocol ( ? link electro protocol). amyE and upp were electroporated with the oligoes shown above (see link to protocol ?). Prior to the experiment the mutant were grown over night in 5y neomycin. and plated on minimal medium with 1% starch for amyE or 25uM for 5-FU. ( ? see procol for minimal medium)
Results
The amyE screening showed to be too difficult to interpret clear results from therefor this selection was abandond. The 5-FU were incubated for 3 days before colonies were visible
? SHow pictures
It can be shown that some of the colonies had the upp locus knocked out there by making them resistent to the toxin 5-FU. This coused the cells to grew on the minimal plates shown on picture ?
Because of the long growth time this selection was not effective or clear enough to calculate the frequency of tranformation.
Growth experiment for mutants
We were interested in testing if the mutations made in the amyE or mutS would change the growth rate of the B. subtilis compared to the wild type. It was indicated by Sun et al. 2015 ( [24] ) that the growth rate of the GP35 mutant would be lower than the wild type strain. Our experiment could not suport this theory. It was not possible to find any significant different in the growthrates of any of the strains tested in this experiment.
Method
An over night culture of wild type, mutS:GP35, mutS:lambda beta, amyE:GP35 and amyE:lambda beta were inoculated in LB.
A 16 fold dilution of each of the inoculated cultures was made in growth medium.
The inoculated growth medium (LB with 0.5M sorbitol) was incubated at 30dec shaking at 200rpm.
The OD was measured continually until it reached 0.85.
Results
It seems that the mutS:GP35 had a faster growth in the exponential phase. When looking at the function given from the graf it is clear that the growth rate is the same for all samples mesured.
Graf (?) Here all the OD mesurements can be seen.
| B subtilis strain | rate (mu) | Generationrate | R2 |
| Wild type | 0.0155 | 45min | 0.9546 |
| amyE:GP35 | 0.02 | 35min | 0.9883 |
| amyE:lambda beta | 0.0193 | 36min | 0.9849 |
| mutS:GP35 | 0.0184 | 38min | 0.9330 |
| mutS:lambda beta | 0.0178 | 39min | 0.9450 |
Table of calculated results from experiment.
Plot ?. The four different mutants generationrate can here be compared to the wild type. The errorbares indicate the 5% error of every generationrate. The y axes is mesured in minuttes.
Incerting streptomycine recistens with one point mutation
The streptomycin resistance only requires one point mutation in the gene known as rpsL. This point mutation is lysine to arginine at position 56.
An oligo with the necessary change was transformed by electroporation of the B. subtilis.
Method
-
Protocol for electrocompetent Bacillus subtilis 168
An over night culture of bacillus subtilis 168 with lambda beta incerted into mutS was prepared in LB media with 5y neo at 37dec shaken at 200rpm.
The protol for making electrocompetent Bacillus was followed. ? see link to protocol
-
Protocol for multiplex OGRE cycles in Bacillus subtilis 168
We hypothesized that if the OGRE protocol was repeated multiple times the amount of transformants would rise. This was tested by running four cycles of the OGRE protocol. The progress could be followed by plating a dilution of the sample on streptomycin plates after every round and calculating the start value of the culture from the OD600 measurements.
Materials
( ? see procol for multiplex OGRE)
Optimization of OGRE
Purpose: tp optimise the conditions, tests of oligos
why
To optimize our new OGRE method we made different experiment testing the optimal amount of oligo and length. The mismatch frequency for multiple mismatches was also quantified.
how
optimal olig amount for OGRE
The same protcol as shown for streptomycine ( make link ? ) was used where the amount of oligo used was veried form 0.2-25uL
OD calculator
The Imperial iGEM 2008 team has made a equation for calculating CFU from OD600. We tried to validate there formulary by using our own results. The hope was to make a calculator that could calculate what type of dilution would be needed to give you accurate results with out having to use up a lot of agar plates for unnecessary dilutions. We could not get measurements that were accurate enough to validate the Imperical iGEM 2008.
Results
compare with impirial 2008 formula and show data.
put link to there page and make link to own data.
finding frequency of mutation
Same protcol as shown for streptomycine ( make link ? ) where the oligoes with 1-6 mismatches were tested.
optimizing oligo length
the protocol for changing streptomycin ( ? incert link ) was used for oligo's with one mismatch but with verying lengths from 50-100nt were also tested.
Materials
same materials used as in protocol for changing streptomcine resistens ( ? incert link)
Oligo Software
Modifying surfactin
As a proof of concept, we tried to modify surfactin synthase to substitute aspartic acid in surfactin with aspargine using oligo mediated recombineering.
Achivements
MISSING
Experimental design
Surfactin (Figure # MISSING) is a surfactant cyclic lipopeptide produced by Bacillus subtilis. It is important for sporulation in B. subtilis [27]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). antiSMASH prediction of adenylation domain specificity corresponds to surfactant. The NRPS modules are divided out on three contigs (ctg1_353-5) with 3, 3, and 1 module, respectively (Figure # MISSING).
The second module (or module 5) of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp->Asn. Three different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table MISSING), yielding different number of mismatches in the oligo.
Table #MISSING List of oligos used to modify surfactin NRPS.
| Name | Oligo | Length | Mutations (Stacelhaus) |
|---|---|---|---|
| Oligo1 | catacagatcaacccgcccggcgatggcgccgaCcgttgcttctgtcgggccgtaCtCattgataaattcggtatgtccatacatcttac | 90 | H322E, I330S |
| Oligo3 | ttcgcaaatgcatccggctcatacagatcaacccgcccggcgatggcgccgaCcgttgcttctgtcgggccgtaCtCattgataaattc ggtatgtccatacatcttacggaaggcgataacatcagtcgggatgattttttctcctcccaagaGgatcaagcgcaaggattcaaagttc gcatcttttgcaaaactggc |
200 | V299L, H322E, I330S |
Methods
(??? whay is there 3 oligoes displated above !!??)
Electrocompetent B. subtilis was used with a mutS:lambda beta mutation was used. (see protocol for making eletrocompetent bacillus ? )
three oligoes were used for this experiment. Two different surfactin oligoes were used separately, and one streptomycin resisters oligo was used to select for the desired change.
100uL of cells was mixed with 5uL of the surfactine changing oligo and 0.5uL of an streptomycin resistance oligo was mixed in electroporation cuvettes, and incubated for 7min.
The electroporation cuvettes were electroporated with 2.2kV (1mm cuvettes). The run time should be 5.0-6ms. Optimal run time is 5.5ms
Immediately after electroporation the electroprated cells were incubated in 3mL Recovery Medium.
The cells were incubated for 4 hours at 30dec shaking at 220rpm.
after incubation OD was measured for each sample.
Samples were diluted to 103 and 104 .
The dilutions were plated on 500y streptomycin plates.
Plates were incubated for 2 days at 37dec.
Results
Oligo reecombineering competent strain (mutSΔ::GP35) was electroporated with oligo1 and oligo2 from Table MISSING. After recovery of cells for 3 hours, dilutions were plated on LB agar plates containing 5
Expression of tyrocidine
Tyrocidine has an unique mode of acton wherein it disrupts the function of the cell membrane. Unfortunately, it has high toxicity towards human blood and reproductive cells and can only be used in topical applications. This makes tyrocidine an interesting target for drug improvement. Under MISSING section you can read more about improvement of tyrocidine.
Lab-on-chip Screening
Intein
During the laboratory work, we experienced great difficulties with heterologous expression of the tyrocidine operon in Bacillus subtilis [read more link MISSING]. This inspired us to think of alternative approaches for production of nonribosomal peptide drugs than by NRPS. We came up with a peculiar idea of generating short cyclised peptides using inteins. Inteins are short peptide sequences that do not have an endogenous role in proteins. They are removed post translation by auto-catalysation. This forms a peptide bond between two amino acids while splicing out the N-intein and C-intein (Figure #MISSING). If the N-intein and C-intein are placed at each end of a polypeptide; cyclisation would give a cyclised protein - or in our case a short peptide.
| Figure #Missing N-intein and C-intein is spliced out by forming a leftover extein scar of the size of the N-extein and C-extein. The size and amino acid sequenceof the scar depends on the source of the intein. |
Achivements
- Designed construct for expression of two short cyclic peptides using BioBrick BBa_K1362000 and two short primers.
- Made the cyclisation construct in the laboratory.
- Analyzed constructs by chomotography, though no products could be detected.
- Improved characterization of BioBrick BBa_K1362000.
Background
Nonribosomal peptide synthetases do not have monopolly on production of bioactive nonribosomal peptides. CyBase contains 818 entries for ribosomal head-to-tail cyclised peptides from 105 different spieces [28]. The length of these cyclic peptides varry from 8-80 amino acids and they are often chracterized by having internal cysteine bridges [29]. Reported activities include anti-HIV, anti-cancer, anti-bacterial, and toxins and due to their high thermostability and resistantance against degredation by proteases, they may be used to increase bioavailability of peptide drugs. Alternatively, their biosynthesis may propose an alternative approach for synthesis of nonribosomal peptide drugs independently of NRPS.
Cyclisation of these protein occurs post translation and is mediated by short peptides that have autocatalytic activity. In one mechanism (Figure #MISSING), self-splicing peptide sequences (inteins) bind and catalyze their own excission while forming a peptide bond between the N-extein and C-extein. Numerous of inteins have been characterized including split intein Npu DnaE from Nostoc punctiforme PCC73102 (Npu) (Figure #MISSING) [30,31]. When the Npu DnaE intein auto-catalyze its own excisions, it leaves the six amino acid extein-scar behind. The native scar (AEY-CFN) can be modified at some positions and still yield splicing [31]. The cysteine of the first position in the C-extein was the only amino acid that could not be substituted.
The BioBrick BBa_K1362000 was introduced by Heidelberg in 2014. It contains Npu DnaE inteins surrounding a negative RFP selection marker, which can be exided by cutting with BsaI. Digestion with BsaI generates to overhangs with different sequence, thereby making direction specific introduction of coding sequence (CDS) for portein of interest into the cyclisation construct possible. The BioBrick was used to cyclise different proteins, but was to our knowledge not used to cyclise short peptides.
We decided to try and cyclise an synthetic ten amino acid peptide sequence, which was similar to tyrocidine. In addition, we searched the cyclic peptide database for bioactive cyclic peptide which contained part of the extein scar. The sequences for both native peptides along with the sequence chosen for cyclisation experiments are shown in Table #MISSING.
| Cycloviolacin Y1 (33 aa)[29] | Tyrocidine (10 aa) | |
|---|---|---|
| Native | GGTIFDCGETCFLGTCYTPGCSCGNYGFCYGTN | FDPFDNQYVOrnL |
| Synthetic | GGTIFDCGETCFLGTCYTPGCSCGNYGFCYGTN | EYCFNQYVKA |
| Extein (N/C) | GET/CFL | AEY/CFN |
Instead of digestion nucleotide sequences for these short peptides, the insert was made usign two short single stranded DNA (ssDNA) oligos.
| Cycloviolacin Y1 |
5'-CAACTGCTTCCTTGGCACATGCTACACACCTGGCTGCTCTTGCGGCAACTAC |
|---|---|
| Tyrocidine-like | 5'-CAACTGCTTCAACCAATACGTTAAAGCTGAATAC-3' 5'-AGCAGTATTCAGCTTTAACGTATTGGTTGAAGCA-3' |
Methods
MISSING
Chomatographic analysis of cyclic peptides
Transformants for analysis were re-streaked onto LB agar plates containing 6
Discussion
It was not possible to detect cyclised proteins from cell-extracts my MALDI-TOF. The size of the unspliced protein is 19.4 kDA (cycloviolacin Y1) and 17.2 kDa (tyrocidine-like).
Detection of NRP
Detection of Cyclic Peptide Synthatase Products
Introduction:
Separation and identification of our non-ribosomal peptide synthase (NRPS) products was determined by high performance liquid chromatography coupled to mass spectrometry (HPLC-MS). NRPS variants were identified by changes in mass and column retention time as well as fragmentation patterns. Development of a matrix assisted laser desorption ionization time-of-flight mass spec (MALDI-TOF-MS) method will allow for future rapid analysis of oligo-recombineered strains producing a library of NRPS antibiotic products. DTU’s 2015 iGEM team was able to procure the assistance of the DTU Metabolomics Platform group, which specializes in analytical chromatography and is recognized in our attributions page (Missing Link???). With assistance from our advisor, a protocol was established to lyse the cells and extract the Tyrocidine or Surfactin molecules before they were run on the liquid chromatography mass spec (LCMS) for analysis.
Background:
Tyrocidine and surfactin can both be separated by liquid chromatography, which separates molecules in a liquid mobile phase as they pass over a solid stationary media in a column. Molecules bind to or elute off the column based on their differing physical properties; including electronegativity, polarity, hydrophobicity, or size. Different detection methods (eg. mass spectroscopy, fluorescence detection, UV/Visible light spectroscopy) can then be coupled to the HPLC to analyze the compounds that were separated from the original solution. The reversed phase liquid chromatography column used in our method has a non-polar stationary phase and polar mobile phase, which causes polar molecules to elute before non-polar compounds. Initial preparative steps remove large contaminants from the sample such as the cell membranes or organelles, which can clog and damage the columns.
As there are many different metabolites produced by prokaryotic and eukaryotic cells, it is important to have an idea of the chemical properties and mass of the target compound. Tyrocidine is an amphiphilic, cyclic peptide naturally produced by a non-ribosomal peptide synthase (NRPS) in Bacillus brevis with antimicrobial properties against gram-positive bacteria1. It functions to disrupt cell membranes, but has been shown to have high hemolytic activity2, making it unsuitable for intravenous use. Tyrocidine has been reported in the literature to have 5 main forms with the general peptide sequence of …D-Phe1/Tyr1 – Pro2 – Phe3/Trp3/Tyr3 – D-Phe4/D-Trp4/D-Tyr4 – Asn5 – Gln6/Asp6 – Val8 – Orn9 – Leu10… 3
Figure 1: Surfactin, highlighted with the blue circle at the location of the mutation from an aspartic acid residue to asparagine
Figure 2: cyclic NRP, Tyrocidine A
Chip Library
References
- Walsh, C. T. (2008). The Chemical Versatility of Natural-Product Assembly Lines. Acc. Chem. Res., 41(1), 4–10. doi:10.1021/ar7000414
- Strieker, M., Tanović, A., & Marahiel, M. A. (2010). Nonribosomal peptide synthetases: structures and dynamics. Current Opinion in Structural Biology, 20(2), 234–240. doi:10.1016/j.sbi.2010.01.009
- Caboche, S., Leclere, V., Pupin, M., Kucherov, G., & Jacques, P. (2010). Diversity of Monomers in Nonribosomal Peptides: towards the Prediction of Origin and Biological Activity. Journal of Bacteriology, 192(19), 5143–5150. doi:10.1128/jb.00315-10
- DiMasi, J. A., Hansen, R. W., & Grabowski, H. G. (2003). The price of innovation: new estimates of drug development costs. Journal of Health Economics, 22(2), 151–185. doi:10.1016/s0167-6296(02)00126-1
- DiMasi, J. A., Grabowski, H. G., & Hansen, R. W. (2015). The Cost of Drug Development. N Engl J Med, 372(20), 1972–1972. doi:10.1056/nejmc1504317
- Lee, J.-H. (2010). Use of Antioxidants to Prevent Cyclosporine A Toxicity. Toxicological Research, 26(3), 163–170. doi:10.5487/tr.2010.26.3.163
- Henderson, J. C., Fage, C. D., Cannon, J. R., Brodbelt, J. S., Keatinge-Clay, A. T., & Trent, M. S. (2014). Antimicrobial Peptide Resistance of Vibrio cholerae Results from an LPS Modification Pathway Related to Nonribosomal Peptide Synthetases . ACS Chemical Biology, 9(10), 2382–2392. doi:10.1021/cb500438x
- Kohli, R. M., Walsh, C. T., & Burkart, M. D. (2002). Biomimetic synthesis and optimization of cyclic peptide antibiotics. Nature, 418(6898), 658–661. doi:10.1038/nature00907
- Finking, R., & Marahiel, M. A. (2004). Biosynthesis of Nonribosomal Peptides 1 . Annu. Rev. Microbiol., 58(1), 453–488. doi:10.1146/annurev.micro.58.030603.123615
- Stachelhaus, T., Mootz, H. D., & Marahiel, M. A. (1999). The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chemistry & Biology, 6(8), 493–505. doi:10.1016/s1074-5521(99)80082-9
- Conti, E. (1997). Structural basis for the activation of phenylalanine in the non-ribosomal biosynthesis of gramicidin S. The EMBO Journal, 16(14), 4174–4183. doi:10.1093/emboj/16.14.4174
- Lautru, S. (2004). Substrate recognition by nonribosomal peptide synthetase multi-enzymes. Microbiology, 150(6), 1629–1636. doi:10.1099/mic.0.26837-0
- Medema, M. H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M. A., … Breitling, R. (2011). antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 39(suppl), W339–W346. doi:10.1093/nar/gkr466
- Weber, T., Blin, K., Duddela, S., Krug, D., Kim, H. U., Bruccoleri, R., … Medema, M. H. (2015). antiSMASH 3.0—a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Research, 43(W1), W237–W243. doi:10.1093/nar/gkv437
- Blin, K., Medema, M. H., Kazempour, D., Fischbach, M. A., Breitling, R., Takano, E., & Weber, T. (2013). antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Research, 41(W1), W204–W212. doi:10.1093/nar/gkt449
- Sundlov, J. A., Shi, C., Wilson, D. J., Aldrich, C. C., & Gulick, A. M. (2012). Structural and Functional Investigation of the Intermolecular Interaction between NRPS Adenylation and Carrier Protein Domains. Chemistry & Biology, 19(2), 188–198. doi:10.1016/j.chembiol.2011.11.013
- Minowa, Y., Araki, M., & Kanehisa, M. (2007). Comprehensive Analysis of Distinctive Polyketide and Nonribosomal Peptide Structural Motifs Encoded in Microbial Genomes. Journal of Molecular Biology, 368(5), 1500–1517. doi:10.1016/j.jmb.2007.02.099
- CALNE, R. (1985). CYCLOSPORIN G: IMMUNOSUPPRESSIVE EFFECT IN DOGS WITH RENAL ALLOGRAFTS. The Lancet, 325(8441), 1342. doi:10.1016/s0140-6736(85)92844-2
- Mosberg, J. A., Lajoie, M. J., & Church, G. M. (2010). Lambda Red Recombineering in Escherichia coli Occurs Through a Fully Single-Stranded Intermediate. Genetics, 186(3), 791–799. doi:10.1534/genetics.110.120782
- Wang, H. H., Isaacs, F. J., Carr, P. A., Sun, Z. Z., Xu, G., Forest, C. R., & Church, G. M. (2009). Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460(7257), 894–898. doi:10.1038/nature08187
- Wang, H. H., & Church, G. M. (2011). Multiplexed Genome Engineering and Genotyping Methods. Synthetic Biology, Part B - Computer Aided Design and DNA Assembly, 409–426. doi:10.1016/b978-0-12-385120-8.00018-8
- Bonde, M. T., Kosuri, S., Genee, H. J., Sarup-Lytzen, K., Church, G. M., Sommer, M. O. A., & Wang, H. H. (2015). Direct Mutagenesis of Thousands of Genomic Targets Using Microarray-Derived Oligonucleotides. ACS Synthetic Biology, 4(1), 17–22. doi:10.1021/sb5001565
- Bonde, M. T., Klausen, M. S., Anderson, M. V., Wallin, A. I. N., Wang, H. H., & Sommer, M. O. A. (2014). MODEST: a web-based design tool for oligonucleotide-mediated genome engineering and recombineering. Nucleic Acids Research, 42(W1), W408–W415. doi:10.1093/nar/gku428
- Sun, Z., Deng, A., Hu, T., Wu, J., Sun, Q., Bai, H., … Wen, T. (2015). A high-efficiency recombineering system with PCR-based ssDNA in Bacillus subtilis mediated by the native phage recombinase GP35. Applied Microbiology and Biotechnology, 99(12), 5151–5162. doi:10.1007/s00253-015-6485-5
- Vellani, T. S., & Myers, R. S. (2003). Bacteriophage SPP1 Chu Is an Alkaline Exonuclease in the SynExo Family of Viral Two-Component Recombinases. Journal of Bacteriology, 185(8), 2465–2474. doi:10.1128/jb.185.8.2465-2474.2003
- Seco, E. M., Zinder, J. C., Manhart, C. M., Lo Piano, A., McHenry, C. S., & Ayora, S. (2012). Bacteriophage SPP1 DNA replication strategies promote viral and disable host replication in vitro. Nucleic Acids Research, 41(3), 1711–1721. doi:10.1093/nar/gks1290
- Nakano MM, Magnuson R, Myers A, Curry J, Grossman AD, Zuber P. srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol. 1991 Mar;173(5):1770-8
- CyBase. September 15, 2015. http://www.cybase.org.au
- Thorstholm L, Craik DJ. Discovery and applications of naturally occurring cyclic peptides. Drug Discov Today Technol. 2012;9:e13–e21. doi: 10.1016/j.ddtec.2011.07.005.
- Zettler, J., Schütz, V., & Mootz, H. D. (2009). The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Letters, 583(5), 909–914. doi:10.1016/j.febslet.2009.02.003
- Cheriyan, M., Pedamallu, C. S., Tori, K., & Perler, F. (2013). Faster Protein Splicing with the Nostoc punctiforme DnaE Intein Using Non-native Extein Residues. Journal of Biological Chemistry, 288(9), 6202–6211. doi:10.1074/jbc.m112.433094
Department of Systems Biology
Søltofts Plads 221
2800 Kgs. Lyngby
Denmark
P: +45 45 25 25 25
M: dtu-igem-2015@googlegroups.com
