Team:DTU-Denmark/Project/Surfactin
Achievements
Figure 1. Picture of surfactin
As a proof of concept, we tried to modify the surfactin synthase by substituting aspartic acid with aspargine using oligo mediated recombineering.
Experimental design
Surfactin (Figure 1) is a surfactant cyclic lipopeptide produced by Bacillus subtilis. It is important for sporulation in B. subtilis [1]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). antiSMASH prediction of adenylation domain specificity corresponds to surfactant. The NRPS modules are divided out on three contigs (ctg1_353-5) with 3, 3, and 1 module, respectively (Figure 1).
The second module (or module 5) of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp->Asn. Three different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table 1), yielding different number of mismatches in the oligo.
Table 1 List of oligos used to modify surfactin NRPS.
| oligo name | sequence | LengthMutation(Stacelhaus) |
length |
|
Oligo_surf_ Asp->Asn_1_l |
C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGA TAAATTCGGTATGTCCATACATCTTAC |
H322E, I330S | 200 |
| oligo_surf asp->Asn_2_I |
T*T*CGCAAATGCATCCGGCTCATACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCT GTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTACGGAAGGCGATAACATCAGTCGG GATGATTTTTTCTCCTCCCAAGAGGATCAAGCGCAAGGATTCAAAGTTCGCATCTTTTGCAAAACTGGC |
V299L, H322E, I330S | 200 |
Methods
Electrocompetent B. subtilisΔmutS::beta-neoR or ΔmutS::GP35-neoR mutation was used. Three oligoes were used for this experiment. The two showed in table 1 was used separately, and the streptomycin resisters oligo called B_sub_Mods0007.1mutationrpsL was used to select for the desired change. 100uL of cells was mixed with 5uL of the surfactine changing oligo and 0.5uL of an streptomycin resistance oligo was used in accordance with the protocol for electroporation.
Results
Oligo reecombineering competent strain (mutSΔ::GP35) was electroporated with Oligo_surf_Asp->Asn_1_l
and Oligo_surf_Asp->Asn_2_l from Table 1. After recovery of cells for 3 hours, dilutions were plated on LB agar plates containing 5.
References
- Nakano MM, Magnuson R, Myers A, Curry J, Grossman AD, Zuber P. srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol. 1991 Mar;173(5):1770-8
Department of Systems Biology
Søltofts Plads 221
2800 Kgs. Lyngby
Denmark
P: +45 45 25 25 25
M: dtu-igem-2015@googlegroups.com
