Team:Groningen/Notebook/PCR a21
Blue Bio Energy
PCR_a21
PCR with purified DNA from Bacilllus subtilis BD1807 strain and Bacilllus subtilis 168 strain. Bacillus subtilis BD1807 has abrB knocked out by a DNA insert in the abrB locus. Bacilllus subtilis 168 was as control as this strain does not have abrB knocked out. PCR products should differ in length.
To knock out abrB in Bacillus subtilis strains to obtain a more rigid biofilm. AbrB suppresses biofilm formation. Knocking out AbrB should result in a more rigid biofilm.
No differences were found in length between products on agarose gel.
PCR
00:00, 3 September 2015 - 00:00, 3 September 2015
PCR with purified DNA of abrB KO BD1807 and control 168 Bacillus subtilis strains.
Sequence primer forward:
Type of primer
sequence
Sequence primer forward
GAAGTGTACGATGCTTACC
Sequence primer reverse
CGGTAGTTTCCAAGACATTACTG
Recombination primer forward
CTGCAGCGGCCGCTACTAGTAGCGGAAGATACGAGGCAAAC
Recombination primer reverse
GAATTCGCGGCCGCTTCTAGAGAGACGATCCGCGTATTTCCC
Primer sequences
The was primer sequenced for sequencing the pcr product.
Recombination primers for creating abrB knockout in a biobrick.
The bands of both PCR products had similar lenghts. Nonetheless, transformation preparations were performed with these samples since these PCR results were not interpreted as wrong at first. They were rightly interpreted at a later date.