Team:Groningen/Notebook/Transformation th24
Blue Bio Energy
Colony PCR (th24)
Colony PCR of thrC locus with tasA, bslA or slrR as inserts
extra integration of DNA in thrC locus
Each tested construct had at least on positive colony
Colony PCR
00:00, 7 September 2015 - 00:00, 7 September 2015
White colonies were checked with colony PCR with the prefix and suffix primers.
Prefix primer:
CAGGCAGTTGAATTCGCGGCCGCTTCTAGA
Suffix primer:
CTTGAGCTCCTGCAGCGGCCGCTACTAGTA