Difference between revisions of "Team:Mingdao/Parts"

 
(21 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
<html>
 
<html>
 
<head>
 
<head>
 
<meta http-equiv="Content-type" content="text/html;charset=UTF-8"/>
 
  <meta name="generator" content="7.4.30.244"/>
 
  <title>BioBrick</title>
 
  <!-- CSS -->
 
  <link rel="stylesheet" type="text/css" href="https://2014hs.igem.org/Mingdao_CSS_site_global?action=raw&ctype=text/css"/>
 
  <link rel="stylesheet" type="text/css" href="https://2014hs.igem.org/Mingdao_CSS_master_main-template?action=raw&ctype=text/css"/>
 
  <link rel="stylesheet" type="text/css" href="https://2014hs.igem.org/Mingdao_CSS_bio-brick?action=raw&ctype=text/css" id="pagesheet"/>
 
  <!-- Other scripts -->
 
  <script type="text/javascript">
 
  document.documentElement.className += ' js';
 
</script>
 
 
 
 
<style>
 
<style>
 
.firstHeading {
 
.firstHeading {
Line 236: Line 222:
 
border-color: #000000;
 
border-color: #000000;
 
background-color: #E9D9C7;
 
background-color: #E9D9C7;
background-color: rgba(198, 156, 109, 0.38);
+
background-color: rgba(0,0,0,0);
 
position: relative;
 
position: relative;
-pie-background: rgba(198, 156, 109, 0.38);
+
-pie-background: rgba(0,0,0,0);
 
}
 
}
  
Line 2,072: Line 2,058:
 
         <nav class="MenuBar clearfix grpelem" id="menuu1133"><!-- horizontal box -->
 
         <nav class="MenuBar clearfix grpelem" id="menuu1133"><!-- horizontal box -->
 
         <div class="MenuItemContainer clearfix grpelem" id="u5103"><!-- vertical box -->
 
         <div class="MenuItemContainer clearfix grpelem" id="u5103"><!-- vertical box -->
           <a class="nonblock nontext MenuItem MenuItemWithSubMenu MuseMenuActive rgba-background clearfix colelem" id="u5104" href="https://2015.igem.org/Team:Mingdao"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u5107-4"><!-- rasterized frame --><div id="u5107-4_clip"><img id="u5107-4_img" alt="Home" width="136" height="32" src="https://static.igem.org/mediawiki/2015/9/9d/Mingdao-u5107-4.png"/></div></div></a>
+
           <a class="nonblock nontext MenuItem MenuItemWithSubMenu rgba-background clearfix colelem" id="u5104" href="https://2015.igem.org/Team:Mingdao"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u5107-4"><!-- rasterized frame --><div id="u5107-4_clip"><img id="u5107-4_img" alt="Home" width="136" height="32" src="https://static.igem.org/mediawiki/2015/9/9d/Mingdao-u5107-4.png"/></div></div></a>
 
         </div>
 
         </div>
 
         <div class="MenuItemContainer clearfix grpelem" id="u1134"><!-- vertical box -->
 
         <div class="MenuItemContainer clearfix grpelem" id="u1134"><!-- vertical box -->
Line 2,081: Line 2,067:
 
         </div>
 
         </div>
 
         <div class="MenuItemContainer clearfix grpelem" id="u1148"><!-- vertical box -->
 
         <div class="MenuItemContainer clearfix grpelem" id="u1148"><!-- vertical box -->
           <a class="nonblock nontext MenuItem MenuItemWithSubMenu rgba-background clearfix colelem" id="u1179" href="https://2015.igem.org/Team:Mingdao/Parts"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u1181-6"><!-- rasterized frame --><div id="u1181-6_clip"><img id="u1181-6_img" alt="Gene
+
           <a class="nonblock nontext MenuItem MenuItemWithSubMenu MuseMenuActive rgba-background clearfix colelem" id="u1179" href="https://2015.igem.org/Team:Mingdao/Parts"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u1181-6"><!-- rasterized frame --><div id="u1181-6_clip"><img id="u1181-6_img" alt="Gene
 
Block" width="137" height="64" src="https://static.igem.org/mediawiki/2015/0/06/Mingdao-u1181-6.png"/></div></div></a>
 
Block" width="137" height="64" src="https://static.igem.org/mediawiki/2015/0/06/Mingdao-u1181-6.png"/></div></div></a>
 
         </div>
 
         </div>
Line 2,098: Line 2,084:
 
     <div class="clearfix grpelem" id="u100"><!-- group -->
 
     <div class="clearfix grpelem" id="u100"><!-- group -->
 
       <div class="clip_frame grpelem" id="u8651"><!-- image -->
 
       <div class="clip_frame grpelem" id="u8651"><!-- image -->
       <img class="block" id="u8651_img" src="https://static.igem.org/mediawiki/2015/7/73/Mingdao-alllogo.png" alt="" width="317" height="249"/>
+
       <object type="application/x-shockwave-flash" height=300 width=400 data="https://static.igem.org/mediawiki/2015/6/6b/Mingdao-alllogo.swf" style="position:relative; left:-60px; top:-20px;">
 +
<param name="movie" value="https://static.igem.org/mediawiki/2015/6/6b/Mingdao-alllogo.swf" />
 +
<param name="quality" value="high" />
 +
<param name="" value="Exactfit"/>
 +
<param name="wmode" value="transparent">
 +
</object>
 
       </div>
 
       </div>
 
     </div>
 
     </div>
Line 2,466: Line 2,457:
 
   <!-- Other scripts -->
 
   <!-- Other scripts -->
 
   <script>if (window.runOnloadHook) runOnloadHook();</script>
 
   <script>if (window.runOnloadHook) runOnloadHook();</script>
   </body>
+
<!-- JS includes -->
 +
  <script type="text/javascript">
 +
   if (document.location.protocol != 'https:') document.write('\x3Cscript src="http://musecdn.businesscatalyst.com/scripts/4.0/jquery-1.8.3.min.js" type="text/javascript">\x3C/script>');
 +
</script>
 +
  <script type="text/javascript">
 +
  window.jQuery || document.write('\x3Cscript src="scripts/jquery-1.8.3.min.js" type="text/javascript">\x3C/script>');
 +
</script>
 +
<script src="https://2014hs.igem.org/Mingdao_JS_museutils?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
  <script src="https://2014hs.igem.org/Mingdao_JS_jquery.tobrowserwidth?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
  <script src="https://2014hs.igem.org/Mingdao_JS_jquery.musemenu?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
  <script src="https://2014hs.igem.org/Mingdao_JS_jquery.watch?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
  <script src="https://2014hs.igem.org/Mingdao_JS_jquery.scrolleffects?action=raw&ctype=text/javascript" type="text/javascript"></script>
 +
  <!-- Other scripts -->
 +
  <script type="text/javascript">
 +
  $(document).ready(function() { try {
 +
Muse.Utils.transformMarkupToFixBrowserProblemsPreInit();/* body */
 +
$('.browser_width').toBrowserWidth();/* browser width elements */
 +
Muse.Utils.prepHyperlinks(true);/* body */
 +
Muse.Utils.initWidget('.MenuBar', function(elem) { return $(elem).museMenu(); });/* unifiedNavBar */
 +
$('#u2764').registerPositionScrollEffect([{"speed":[0,1],"in":[-Infinity,36.95]},{"speed":[0,1],"in":[36.95,Infinity]}]);/* scroll effect */
 +
Muse.Utils.fullPage('#page');/* 100% height page */
 +
Muse.Utils.showWidgetsWhenReady();/* body */
 +
Muse.Utils.transformMarkupToFixBrowserProblems();/* body */
 +
} catch(e) { }});
 +
</script>
 +
 
 +
</body>
 
</html>
 
</html>

Latest revision as of 15:28, 18 September 2015

Parts

Gene Block

*

*

In our project, we cloned two genes, SR and SRPK from the materials kindly gave by Dr. Woan-Yuh Tarn at Academia Sinica in Taiwan. Phosphoserine and arginine (highest nitrogen contents among 20 amino acids) play important roles in fire retardance. We found a novel fire retardant protein, SR protein, through protein database mining. SR proteins are post-translationally phosphorylated by SR protein kinase (SRPK). We co-transformed E. coli BL21 with two vectors simultaneously to express phosphorylated SR proteins.

Gene

Serine/arginine-rich splicing factor 1 (SRSF1) is a protein found on chromosome 17 in humans. SRSF1 is also known as alternative splicing factor 1 (ASF1), pre-mRNA-splicing factor SF2 (SF2), which is involved in alternative splicing, mRNA nuclear export and translation. It contains two functional domains. One in the N-terminus is RNA recognition motifs which interact with RNA and splicing factors. The other in the C-terminus is rich in serine and arginine residues (SR domain) and regulate the protein activity through phosphorylation by SR protein kinase.

 

SRSF protein kinase 1 (SRPK1) is a serine/arginine-rich protein specific kinase, which phosphorylates SR proteins on serine residues in SR domain. It plays an important role in the regulation of SR protein activity. Disorders in SRPK1 may be observed in certain cancer cells.

 

BioBrick

We cloned the genes of SR and SRPK as well as the composite DNA fragments of Ptac-GST-SR and Pt7-SRPK-His onto the standard backbone of pSB1C3 biobrick.

SR/pSB1C3

Part No.: BBa_K1608000

We designed two primers to amplify the SR genes by PCR, followed by XbaI and PstI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation.

Primers:

1. SR-XbaI-F: 5'- AAAAGGTCTAGATGTCGGGAGGTGGTGTGATTCGTG -3'

2. SR-SpeI-PstI-R: 5'-AAGAAACTGCAGCGGCCGCTACTAGTATTATGTACGAGAGCGAGA -3'

PCR product size: ~785 bp

 

SRPK/pSB1C3

Part No.: BBa_K1608001

We designed two primers to amplify SRPK1 gene by PCR, followed by EcoRI and SpeI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. However, there’re two PstI sites on the sequence of SRPK1 gene. We’re trying to mutate them to fit the standard biobrick parts.

Primers:

1. SRPK1-EcoRI-XbaI-F: 5'- AAAAGAATTCGCGGCCGCTTCTAGATGGAGCGGAAAGTGCTTGCGCTCCAG -3'

2. SRPK1-SpeI-R: 5'- GGGGGGACTAGTATTAGGAGTTAAGCCAAGGGTG -3'

PCR product size: ~1995 bp

Plasmid map:

 

In order to express SR and SRPK gene more conveniently, we made two composite biobricks with promoter, RBS and a fusion tag.

GST-SR/pSB1C3

Part No.: BBa_K1608002

We designed two primers to amplify Ptac-GST-SR DNA fragment by PCR from SR/pGEX-2T, followed by XbaI and PstI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. The SR gene is fused with GST tag and driven by Ptac promoter along with a lac operator downstream.

Primers:

1. Ptac (pGEX)-XbaI-F: 5'- GAGGGGTCTAGAGTTTTTGCGCCGACATCATAAC -3'

2. SR-SpeI-PstI-R: 5'- AAGAAACTGCAGCGGCCGCTACTAGTATTATGTACGAGAGCGAGA -3'

PCR product size: ~1572 bp

Plasmid map:

 

In order to express SR and SRPK gene more conveniently, we made two composite biobricks with promoter, RBS and a fusion tag.

SRPK-His/pSB1C3

Part No.: BBa_K1608003

 We designed two primers to amplify Pt7-SRPK1-His DNA fragment by PCR from SRPK/pET-29b, followed by EcoRI and SpeI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. However, there’re two PstI sites one XbaI site on the amplified sequence. We’re trying to mutate them to fit the standard biobrick parts. The SRPK1 gene is fused with 6XHis tag and driven by Pt7 promoter along with a lac operator downstream.

Primers:

1. Pt7(pET)-EcoRI-XbaI-F: 5'- AAAAAAGAATTCGCGGCCGCTTCTAGAGCACGATGCGTCCGGCGTA -3'

2. His (pET)-SpeI-R: 5'- AGGGAAACTAGTATCAGTGGTGGTGGTGGTGGT -3'

PCR product size: ~2294 bp

Plasmid map:

Data

(1) PCR of SR, SRPK, Ptac-GST-SR and Pt7-SRPK-His

Lanes:

1. 1kb DNA marker

2. Pt7-SRPK-His: 2294 bp

3. Ptac-GST-SR: 1572 bp

4. SR: 785 bp

5. SRPK: 1995 bp

(2) Restriction enzyme digestion of inserts and vectors

Lanes:

1. 1kb DNA marker

2. Pt7-SRPK-His: EcoRI + SpeI → 2294 bp

3. SRPK: EcoRI + SpeI →1995 bp

4. pSB1C3: EcoRI + SpeI → 2047 + 1092 bp*

5. Ptac-GST-SR: XbaI + PstI→ 1572 bp

6. SR: XbaI + PstI → 785 bp

7. pSB1C3: XbaI + PstI → 2044 + 1095 bp*

 

*Bands shifted were caused by the fluorescent DNA loading dye. We confirmed with the specialist and sequenced the plasmid. The plasmids were correct but it bothers us for a long time. Just be very careful to use a ready-to-use fluorescent DNA loading dye.

(3)Colony PCR for SRPK/pSB1C3 and SR/pSB1C3

Left panel: Colony PCR with primers of SRPK1-EcoRI-XbaI-F and VR to check SRPK/pSB1C3 (2162 bp)

 

Right panel: Colony PCR with primers of SR-XbaI-F + VR to check SR/pSB1C3 (941 bp)

 

(4)Colony PCR for Ptac-GST-SR/pSB1C3 and Pt7-SRPK-His/pSB1C3

Lane 1 & 17: 1kb DNA marker

Lane 2-8: Colony PCR with primers of Ptac (pGEX)-XbaI-F and VR to check Ptac-GST-SR/pSB1C3 (1731 bp)

Lane 9-16: Colony PCR with primers of Pt7(pET)-EcoRI-XbaI-F and VR to check Pt7-SRPK-His/pSB1C3 (2452 bp)

 

(5) Restriction enzyme check for SRPK/pSB1C3, SR/pSB1C3 and Pt7-SRPK-His/pSB1C3

Left panel:

1. SRPK/pSB1C3: EcoRI → 4036 bp

2. SRPK/pSB1C3: PstI → 2747 + 1238 + 51 bp

3. 1kb DNA marker

4. SR/pSB1C3: XbaI → 2815 bp

5. SR/pSB1C3: EcoRI + PstI → 2029 + 786 bp

 

Right panel:

1. Pt7-SRPK-His/pSB1C3: EcoRI → 4326 bp

2. Pt7-SRPK-His/pSB1C3: PstI → 2980 + 1295 + 51 bp

3. 1kb DNA marker

(6) Restriction enzyme check for Ptac-GST-SR/pSB1C3

Lanes:

1. 1kb DNA marker

2. Ptac-GST-SR/pSB1C3: uncut

3. Ptac-GST-SR/pSB1C3: BamHI → 3614 bp

4. Ptac-GST-SR/pSB1C3: EcoRI + PstI → 1581 + 2033 bp

(7) Sequencing data with primers of VF2 and VR

a. SR/pSB1C3 (VF2 & VR)

b. SRPK/pSB1C3 (VF2 & VR)

c. Ptac-GST-SR/pSB1C3 (VF2 & VR)

d. Pt7-SRPK-His/pSB1C3 (VF2 & VR)

 

Download

 

Vector

In order to express proteins abundantly and efficiently, we transferred the genes of SR and SRPK into two commercial expression vectors of pGEX-2T and pET-29b, respectively.

SR/pGEX-2T

We cloned SR gene with BamHI and XbaI onto pGEX-2T, in which the gene expression is fused with GST tag in the 5’ end and driven under Ptac promoter as well as regulated by lac operator. The pGEX-2T backbone contains lacI repressor gene, pBR322 replication origin and ampicillin resistance cassette (AmpR).

Plasmid map:

 

SRPK/pET-29b

We cloned SRPK gene with EcoRV and HindIII onto pET-29b, in which the gene expression is fused with 6XHis tag in the 3’ end and driven under Pt7 promoter as well as regulated by lac operator. The pET-29b backbone contains lacI repressor gene, ColE1 replication origin and kanamycin resistance cassette (KanR).

Plasmid map:

DATA

 

Protein Induction

We co-transformed SR/pGEX-2T and SRPK/pET-29b into E. coli BL21, which expresses T7 RNA polymerase under LacI repressor regulation. The bacteria were cultured in LB media supplemented with ampicillin and kanamycin. IPTG was added when the bacteria grew to OD600 value at 0.6-1.0. And the protein lysates were collected after 4 hours of IPTG induction. SDS-PAGE, Coomassie Blue Staining and Western Blotting were performed through the manufacturers’ instruction.

Coomassie Blue Staining

Lanes of lysates:

1. Control: pGEX-2T & pET-29b

2. SR: SR/pGEX-2T & pET-29b

3. SRPK: pGEX-2T & SRPK1/pET-29b

 

Result:

SR was expressed at the expected size of 53 kDa. and SRPK was expressed at the expected size of 93 kDa. In addition, free forms of GST were observed at 27 kDa in the lanes 1 & 3.

 

Western Blotting

(1) SRPK-His protein expression

Procedure:
↓ mouse α-His primary Ab
↓ goat α-mouse IgG-AP secondary Ab
↓ BCIP/NBT chromogen Lanes of lysates:
1. Control: pGEX-2T & pET-29b
2. SR: SR/pGEX-2T & pET-29b 3. SRPK: pGEX-2T & SRPK1/pET-29b
4. P-SR: SR/pGEX-2T & SRPK1/pET-29b Result:
SRPK-His was detected by anti-His antibody at the expected size of 93 kDa, as shown in the lanes 3 & 4.

(2) GST-SR protein expression

Procedure:
↓ rabbit α-GST primary Ab
↓ goat α-rabbit IgG-HRP secondary Ab
↓ DAB chromogen Lanes of lysates:
1. Control: pGEX-2T & pET-29b
2. SR: SR/pGEX-2T & pET-29b 3. SRPK: pGEX-2T & SRPK1/pET-29b
4. P-SR: SR/pGEX-2T & SRPK1/pET-29b

Result

GST-SR was detected by anti-GST antibody at the expected size of 53 kDa, as shown in the lanes 2 & 4. It is worth to note that the bands in lane 4 were shifted around 53 kDa, indicating protein modification of GST-SR possibly by SRPK kinase phosphorylation (SR and SRPK exist in the bacteria all together). Moreover, the free forms of GST around 27 kDa were also observed.

 

Summary

We cloned the genes encoding SR and SRPK to BioBricks (pSB1C3) and expression vectors (pGEX-2T and pET-29b). After protein induction by IPTG in E. coli BL21, the SR and SRPK as well as phosphorylated SR proteins were detected in SDS-PAGE with Coomassie Blue staining and Western Blotting by anti-His antibody and anti-GST antibody. The results showed that we successfully expressed phosphorylated SR proteins in E. coli bacteria by transformed with SR/pGEX-2T and SRPK/pET-29b.