Difference between revisions of "Team:Paris Bettencourt/Differentiation"

Revision as of 10:30, 11 August 2015

1 Advancement on E. coli
2 Cloning inside the replication vector
3 Chromosomal integration with GalK
4 Function testing
5 CRE recombinase expression
- 5.1 Monday 07/06
6 Thursday 07/09
7 Monday 07/20
8 Wednesday 07/22
- 8.1 PCR-linerization of the R6K backbone
- 8.2 Bad news from IDT about the gene synthesis
9 Thursday, 07/23
10 Tuesday, 07/28
- 10.1 Reception of gBlocks Colibow A, B, C
- 10.2 PCR of Colibow gBlocks
11 Wednesday, 07/29
12 Thursday, 07/30
13 Wednesday, 8/5
14 Monday, 08/10

Advancement on E. coli

The whole brainbow system will be integrated chromosomally at the GalK site. It will be synthesized as three gBlocks.

It should allow expression of mCherry first, then upon expression of the CRE recombinase, differentiation in two states (YFP and CFP).

It also contains a landing pad that allow insertion of a third state, which would subsequently lower the probability of states 1 and 2 so the three outcomes are possible.

Writing the artificial gene

Promoter J23199 from the Biobrick collection

4 LoxP sites used together in mammalian brainbow plasmids

RBS from Ihab

ORF for mCerulean and mVenus from Ihab

ORF for mCherry from Antoine

rrnBT1 terminator used on the pOSIP plasmids

Landing Pad (PhiC31 attB TT site)

Check for secondary structure in the RBS Done

Check for RBS in the LoxP array Done

Split to have two ~1500 bp gblocks Done

Design overlaps for Gibson in R6K vector Done

Check for Biobrick restriction sites Done

Fix gBlocks problems

Palindroms between LoxP sites Done
Repeats in terminator: replaced with Lambda T0 terminator Done
Repeat in RBS Done
More GC in the LoxP array Done
More GC at the end of fragment 1Done
Repeat at the end of mVenus and mCerulean Done
More GC at the beginning of fragment 2 Done

It is very difficult to solve these -> make 3 fragments Done

Fragment A: 0 - 1143

Fragment B: 1105 - 2006

Fragment C: 1981 - 2946

Change the RBS for Fragment A -> “New RBS” Done

Order gBlocks Done 07/13

Design + order oligos for gBlocks amplification Done

Overlaps melting points are 62, 67, 54, 74.

The overlap between fragments B and C should be increased to >62.

R6K LinR	tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag	o15.80
R6K LinF	CGGGCGCGTACTCCAgaagggcatcgatggc	o15.81
Colibow A F	ttgacagctagctcagtcctag	o15.82
Colibow A R	GGCCATTCACATCACCATC	o15.83
Colibow B F	GCCGATTCTTGTTGAACTTG	o15.84
Colibow B R	CCATGGTACCTCCTCCTTACTTCTATAACTTC	o15.85
Colibow C F	GATACTTTATACGAAGTTATAGAAGTAAGGAGGAG	o15.86
Colibow C R	gccatcgatgcccttcTGGAGTACGCGCCCG	o15.87

Overlap melting points: 62, 67, 62, 72.

Design + order oligos for cassette sequencing Done

>50 bp before the interest region

800 bp max contigs

Obtain Pir+ strain Done

Overnight of Pir+ strain Done

Glycerol of Pir+ strain Done

Cloning inside the replication vector

Order oligos linR and linF Done

Obtain R6K vector from Ihab Done

Overnight culture of the R6K vector propagation strain

Failed New attempt with less harsh growth conditions. Done

Only 20 ug/ml of Kanamycine
6 ul of Thyamine in 3 ul of LB
Culture at 30°C

Miniprep of the R6K vector Done

Glycerol of R6K strain Done

Linearization of the R6K vector by PCR Done

Primer linF:

CCCTTGGGCTCCCCGGGCGCGTACTCCAgaagggcatcgatggc

(28 bases: longest possible overlap without having a hairpin at 50°)

Tm = 55°

Primer linR:

tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag

(33 bases overlap)

Tm = 62°

Product length: 2276 bp

Synthetize, reconstitute and dilute primers Done

Run gel for size checking Done

PCR purification Done

Obtain gBlocks Done

PCR of colibow fragments A, B and C Done

PCR purification of amplicon Done

Obtain Gibson mix Done

Make overnight culture of Pir+ strain Done

Make electrocompetent cells out of the Pir+ strain Done

Gibson assembly of 3 gblocks with the R6K backbone. Done

The vector can only replicate in Pir+ strain. Transform into Pir+ strain Got colonies

Check transformant: colony PCR before culture Failed

Liquid culture + miniprep

Analytical digestion or sequencing (find enzymes)

SeqF1	o15.88	cttagtacgttagccatgagg
SeqF2	o15.89	CTAATTTTCCATCTGATGGCC
SeqF3	o15.90	CAAGCTCACGCTCAAATTC
SeqF4	o15.91	ACAACCATTACCTGTCGACG
SeqF5	o15.92	CGACATTAGGGTATGGGCTG
SeqR1	o15.93	TATAAACATTATGGCTATTATAG
SeqR2	o15.94	TTTAGAGAGTTTTGACTGCG
SeqR3	o15.95	TTTGCCAGTCGTACAGATGAA
SeqR4	o15.96	TCTTCTTCTGCATCACCGGGC

Chromosomal integration with GalK

PCR of the purified R6K plasmid. Done

PCR-linerization of the R6K backbone

Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
Primers: 15.80 (LinR) et 15.81(LinF) -> 1 ul each
Eau qsp 25 ul
Master mix 25 ul

1’30’’ extension, 50°C annealing.

Find oligos (already there) Done

IntR:

GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAACCATATGAATATCCTCCTTAGTTCCTATTCCG

Alternatively, with only one binding site:

GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAAttagccatggtccatatgaatatcctccttag

IntF:

TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCGGGTTGAACTGCGGATCTTGCGGC

Italique: Homology region with E. coli GalK site.

Length: 4908 bp

Attention, autre site potentiel d’amorçage, produit de 3515 bp

Purification

Overnight culture de E. coli Lambda Red

Competent cells out of Lambda Red strain

Transformation of E. coli with pKD46 that carries Lambda Red recombinase

Transformation of the Colibow PCR product

Function testing

Tecan + Flux cytometry

CRE recombinase expression

pFHC2938 should work.

It expresses CRE and has a temperature sensitive ORI (30°C)

Monday 07/06

Research about the synthetic integron

It might make the landing pads better than with brainbow because the recombination site is always the same.

Plate culture of E. coli pIT5-KL and pIT5-KH

Very important: grow @30

-> Make a liquid culture of each and freeze at -80

-> Miniprep from pIT5-KL for first construct

These two strains produce the vector plasmids for clonetegration. They have to be linearized with EcoR1 and Pst1, and then Gibson assembled to get the self-integrating plasmids.

The integrase they carry is expressed only at 37 degrees.

They are resistant to Kanamycine.

KH integrates into the HK022 phage’s site, while KL integrates into the Lambda phage site. We will probably only need one of them but I took both just in case. If needed there is a whole collection of such vectors.

Plate culture of E. coli pE-FLP

Grow @ 30

This strain produces the pE-FLP plasmid, which expresses the flippase. It will be useful to remove the backbone after the clonetegration. It’s resistant to ampicillin.

It has a temperature-sensitive ORI and will disappear if grown at 37.

New primers

LC81, LC85, LC82, LC86: used in the PCR to check integration with pIT5 KH.

LC81, LC87, LC83, LC84: used in the PCR to check integration with pIT5 KL.

Thursday 07/09

Prepared 10 tubes of 1 ml Kanamycine, 50 mg/ml
Inoculated pIT5-KL and pIT5-KH E. coli in 2 ml LB Kan+50
Inoculated pE-FLP E. coli in 2ml LB Amp+100
Cultured these three tubes @ 30

Monday 07/20

Reception of two plates from Ihab

Shortened R6K vector -> Kan+ and thyamine auxotrophy. Thyamine 1000x is available in an eppendorf tube.
Pir 116 strain for propagation of the vector.

-> Overnight culture for miniprep for PCR and gleezing

R6K in LB Kan Thyamine (in antibiotics box)
Pir116 in LB with a control tube

Started cultures for Colibow

pThy 1.0 aka pBrainbow 1.0 in 3 ml LB-Amp -> Miniprepcr

pR6K in LB-Kan-Thyamine -> Miniprepcr and Glycerol freezing

Pir116 for replication of pR6K-vectors -> LB

Control without innoculation -> LB

All of them, culture @ 37° overnight.

No need to culture pKT174 because we already have the purified version. It may be a good idea to transform DH5a with it in case we run out of plasmid.

Reception of oligos o15.76 to o15.96

Yeastbow SOE
R6K linearization
Colibow gBlock Amp
Colibow Sequencing

The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.

-> Oligo reconstitution and dilution

-> Miniprep of R6K vector

-> PCR of R6K vector

-> Miniprep of pBrainbow 1.0

-> PCR of pBrainbow 1.0

-> PCR of pThy Ura3

Reconstituted all primers to 100 ug/ml.

Miniprep of pR6K and pBrainbow 1.0

For PCR, using Promega kit w/ double wash. Elution in 30 ul

Final concentration: 93 ng/ul

Re-start of the R6K culture

The first culture failed: let’s try again with less harsh conditions.

Only 20 ug/ml of Kanamycine
6 ul of Thyamine in 3 ul of LB
Culture at 30°C

Wednesday 07/22

PCR-linerization of the R6K backbone

Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
Primers: 15.80 (LinR) et 15.81(LinF) -> 1 ul each
Eau qsp 25 ul
Master mix 25 ul

1’30’’ extension, 50°C annealing -> 2276 bp

Bad news from IDT about the gene synthesis

« I would like to notify you about a best effort for gBlock ‘Colibow C’. Even after multiple attempts at trying to correct this issue, the Final QC data for the best prep is not meeting our quality standards. The final prep (mfg# 188635671) has desired peak. A secondary peak is also present. The target mass was found in the chromatogram, but not as the most abundant product in any of the chromatographic peaks for mass spectrometry, and the sequence has been verified.

If you are using this sequence for cloning and/or qPCR you should not have any problems with this sequence. It may require you to screen additional colonies. However, if your intentions with using this gBlock was for other purposes, we might need to cancel the gBlock and redesign. I have provided the trace below. »

Thursday, 07/23

Glycerol stock for pR6K

1 ml of overnight culture of E. coli pR6K.

1 ml of glycerol.

-> -20°C

Gel for linearized R6K pcr

1% agar TAE, with 1 kb+ generuler.

5 ul PCR product + 1 ul LB.

-> band at the right size (2276 bp) , the PCR worked.

linearized R6K pcr cleanup

Using the Qiagen kit, taken back in 50 ul water

Titration: about 80 ng/ul, but very bad 260/230 ratio (presence of organic molecules).

Pir116 electrocompetent for bowcoli transformation

2 ml overnight culture in 100 ml LB, at 37°C w/ shaking.

When OD reaches 0.6, they were put in ice for half an hour.

Electrocompetent cells were made by Mukit along with DH5a competent cells.

Tuesday, 07/28

Reception of gBlocks Colibow A, B, C

Reconstitution to the concentration of 10 ng/ul (from spec sheet):

Centrifuge @ 11kG

Add 100 ul of RNase-free water
Vortex
Incubate at 50°C for 20 minutes
Vortex/Centrifuge

PCR of Colibow gBlocks

Colibow A

Primers: 82 (56°) + 83 (54°) -> 1172 bp

Colibow B

Primers: 84 (53°) + 85 (54°) -> 909 bp

Colibow C

Primers: 86 (54°) + 87 (57°) -> 992 bp

Reaction in 50 ul:

Compound	Volume (ul)
Water	19
Phusion 2x	25
Primer 1	2.5
Primer 2	2.5
gBlock diluted 10 times	1 ul

Program:

98 (30)

98 (10) 58 (25) 72 (45) x35

72 (600)

12 (hold)

In parallel from running the gel, the PCR products were purified with the QIAGEN kit and eluted in 40 ul of water.

Titration

Fragment A: 90 ng/ul

Fragment B: 88 ng/ul

Fragment C: 85 ng/ul

Gel plan

1% agar, SYBRsafe, 5 ul of PCR product + 1 ul of LD.

The 100 bp+ marker was used.

The apparatus didn’t work. It stopped two times, the gel stayed to diffuse in the tank for 30 minutes. At the end it was imaged even though it was far from finished.

Ladder 100 bp+	Colibow A	Colibow B	Colibow C
Expected size	1172	909	992

Colibow Amp Results.jpg 1438103355.jpg

Conclusion

There are a lot of non-specific binding.

Due to the awful quality of the gel, it’s not possible to determine their size or which bands are the good ones. The top ones seem more consistent regarding their relative sizes.

To do:

Run the whole purified PCR product in a gel and perform a gel extraction. Hopefully the right band can be determined this time.
Try the PCR again with a higher annealing temperature.
Gibson assemble directly the gBlocks fragments.

Wednesday, 07/29

Gel for Colibow A, B, C and extraction

Agar 1%, SYBRsafe, TAE

Ladder 100 bp+	Colibow A	Colibow B	Colibow C
Expected size	1172	909	992

Colibow Amp Extracted.jpg

For each sample, the top band was extracted. The Colibow B sample was extracted twice: Bg (grande, top band) and Bp (petite, bottom band).

The bottom band is the right one.

-> add DMSO 3% next time

Titration (in 30 ul EB)

Name	1	U	A	Bp	Bg	C
C (ng/ul)	13	41	6	29	11	12.1

The concentrations of Colibow A and C are critically low. It is necessary to fix the PCR and reduce the non-specific priming before performing the Gibson.

New attempt at Colibow A and C PCRs

Mix

Phusion 25

Colibow A 1

o15.82 2.5

o15.83 2.5

Water 19

DMSO 1.5 (3%)

= Two tubes of 50 ul each -> 1172 bp

Mix

Phusion 25

Colibow C 1

o15.86 2.5

o15.87 2.5

Water 19

DMSO 1.5 (3%)

= Two tubes of 50 ul each -> 992 bp

This is stored in 4° for now (29/07)

Received Gibson assembly mixes from Ihab

I need better quality products before doing it.

Thursday, 07/30

Gel for A, C and 1

Sophie’s sample

*	A	A	A	C	C	C	100+	1	1	1	1kb
*	1172	1172	1172	992	992	992		3965	3965	3965

50 ul sample + 10 ul LD -> 40 ul in each well (3 wells)

Attention C sample accidentally added to the well containing 100 bp + ladder !!!

Colibow A et C amp 29.07.jpg

Gel extraction

With Qiagen kit, product recovered in 30 ul of water.

Name: “product” X+ 30/07

The C product mixed with ladder was labeled Cl.

Titration

Sample	1	A	C	Cl
c (ng/ul)	5.2	15.4	12.9	4.4

Gibson assemblies of Colibow

General mix:

15 ul of Gibson supermix (MMII)

10-100 ng of backbone for a 6 kb fragment

Equimolar amount of DNA fragments

Total: 20 ul

Colibow PCR products

Using the most concentrated PCR products known to date.

Nom	Taille (bp)	Concentration	Volume (ul)	Quantité (ng)
R6K pcr	2276	80	0.6	50
Colibow A+ e (in water)	1172	15	1.7	25
Colibow Bp (in EB)	909	29	0.9	25
Colibow C+ e (in water)	992	13	1.6	25

Colibow gBlocks

Using directly the gBlocks from IDT dna synthesis

Nom	Taille (bp)	Concentration	Volume (ul)	Quantité (ng)
R6K pcr	2276	80	0.5	30
Colibow A	1172	10	1.5	15
Colibow B	909	10	1.5	15
Colibow C	992	10	1.5	15

Incubation during one hour at 50°C.

3 LB ampicillin plates

“30/07 ANTOINE”

50 ml of hot LB-agar.

Transformation of Colibow in Pir116 by Electroporation

pColibow gBlock

pColibow PCR

Biobrick plasmid with RFP (3 ul of 10 pg tube, not dialysed)

Protocol from OWW:

Thaw cells from -80°C to ice for >20 min
Chill cuvettes
Dialyse 6 ul of Gibson products on dWater during >20 min
Mix 6 ul of dialysed DNA with 50 ul Pir116 electrocompetent cells
Mix with tip
Pulse (1.5 kV, 2 mm cuvette)
Add 1 ml LB (at 18h43)

Incubate for 1 hour at 37°C.

2 Kanamycine 25 plates for each colibow plasmid: 100 ul and 900 ul

1 Chloramphenicol plate for RFP control

Incubation overnight @37.

Transformation of pKT174 in DH5a by Heat shock

Protocol from addgene:

Thaw cells on ice (20 min)
3 ul DNA + 50 ul chemically competent cells, mix gently
20-30 min on ice
45s at 42°C
2 min on ice
Add 1 ml LB (at 18h50)
Incubate 1 hour @ 37°C

2 ampicillin plates: 100 ul and 900 ul.

Incubation overnight @37.

Gel for SOE 29/07

1 kb ladder

SOE

1 kb ladder

*

Expected size: 5600 for all of them.

SOE+29.07.jpg

It didn’t work at all. Try to Gibson-assemble them.

New electroporation of Pir116

Using the old electroporator (with the square cuvette holder).

Dialysis of 6 ul and sampling of 5 ul of Colibow gBlock assembly

Dialysis of 5 ul and sampling of 5 ul of 5 pg/ul

Compound	x1	x8
10x Taq Buffer	2.5	20
10 nM dNTPs	0.5	4
10 uM primer 90	0.5	4
10 uM primer 94	0.5	4
taq polymerase	0.125	1
water	17.875	167

Then 22 ul of mix is added to 3 ul of template (2 ul water + 1 ul sample for positive control). Template is obtained by soaking part of a colony in 20 ul water.

Program (saved as Colony):

95 (6’00)

95 (15) 49 (25) 68 (45) x30

68 (5’00)

Gel:

P900 B1 B2 B3 ColibowB 100bp+

Results:

One band at 508 bp on the positive control.
No band at all on the colonies

-> They are contaminations, the transformation did not work, probably because the Gibson itself did not work due to bad DNA concentration.

Wednesday, 8/5

Pir116 electrocompetent cells

From the overnight culture, 1 ml of cells were diluted in 50 ml of LB and incubated at 37°C (10h30).

Centrifuge steps were done 10 min at 8500 rpm.

50 ml culture -> centrifuge and remove well the supernatant
50 ml glycerol 10% -> centrifuge
50 ml glycerol 10% -> centrifuge

Cells in residual glycerol were aliquoted in eppendorf tubes (6 in the end) and frozen @-80.

Testing of these EC Pir116 cells function

4 ul of pSB1C3 20 pg/ul were dialysed, 3 ul were picked after 20 min and mixed with 100 ul of cells.

Pulse duration: 5.7 ms

After 1 h of preculture @37, it was plated on a chloramphenicol 0.5 plate and grown @37.

New colibow PCR

Performed by Chloé and Émilie.

1438872081.png

Program:

98 (30)

35x 98 (10), Gradient (30), 72 (2’20)

72 (5)

10 (hold)

Gradient:

59, 57.8, 55.3, 53.4

The very long extension time is used to avoid promoting small non-specific fragments.

Gel:

1% agarose, SYBRsafe, 2.5 ul sample + 0.5 ul LD

L

A

L

B

L

C

L

1 kb

1172

1 kb

909

1 kb

992

08.05 Colibow Amp gradient.jpg

Thursday, 8/6

PCR purification of Colibow gBlocks

The homologous tubes were mixed together, except for C2 that didn’t work.

Elution in 50 ul of water.

A second gel was ran in order to know whether the light band at the bottom is still present.

1 kb ladder

A

B

C

Is it. This has to be taken into account when calculating the concentrations for the Gibson assembly.

Titration (in 50 ul of water):

A: 137 ng/ul

B: 167 ng/ul

C: 99 ng/ul

08.06 Colibow gradient after purification.jpg

New R6K PCR

Compound	1x	2x
water	71	142
Phu buffer	20	40
dNTP	2	4
80 primer	1	2
81 primer	1	2
pR6K shortened (template)	1	2
DMSO	3	6
Phusion polymerase	1	2

Program:

98 (30)

98 (10) 52 (30) 72 (1’30) x 35

72 (5’)

Problem: There was only <1 ul of phusion left in the tube. The PCR did not work at all.

New attempt

Mix (made twice)

Phusion master mix 50 ul

80 primer 2 ul

81 primer 2 ul

pR6K 3 ul

DMSO 3 ul

Water 40 ul

Program:

98 (30)

98 (10) 50 (30) 72 (1’30) x 35

72 (5’)

After this PCR, the product was:

ran on a gel: Ladder 1kb, tube 1, tube 2 (3 ul sample, 2 ul water, 1 ul LD)
digested by DPN1:

1 ul of DPN1 added directly to the product, then incubated for 15 minutes at 37° in the thermocycler and inactivated (5 min at 80°).

Gel results: To be uploaded (on my pendrive now).

Monday, 08/10

PCR purification of R6K amp

With QIAGEN kit, performed by Chloé & Émilie. At the end, the product was recovered in 50 ul of water and also 30 ul EB, for 80 ul total.

The titration was done using a 5 ul + 3 ul mix as a blank.

Products summary:

R6K pcr	67.4 ng/ul	2276 bp
Colibow A	137	1172 bp
Colibow B	167	909 bp
Colibow C	99	992 bp

A and C have a small band at ~200 bp, so the actual concentration of the product is half of what indicated by the Nanodrop.

Gibson assembly of Colibow

Assuming half the DNA in A and C is the right one.

Name	Volume (ul)	Final amount (pmol)
A	1.11	0.10
B	0.4	0.11
C	1.30	0.10
R6K	2.19	0.10

Added to a MMII Gibson assembly master mix and incubated during 1h at 50°C.

Gel for Colibow’s Gibson

6 ul SYBRsafe in 20 ml agar 1%, with 1 kb ladder.

The sample consisted in 10 ul of Gibson product and 2 ul of LD.

Unfortunately the comb for making the wells went through the gel, resulting in loss of the sample.

Electroporation of Pir116 E. coli with newly assembly pColibow

Dialyse of the assembly product during 20 min. 5 ul were deposed and 5 ul were taken back.
Mixed with already tested Pir116 Electrocompetent cells
Program Ec2, bacterial, in 2 mm cuvette. Pulse time: 4.7 ms.
Incubation 1h @37
Plating on “pColibow Gibson” plates (K50 but K20 written on the box). 100 ul on the first box, centrifuged 900 ul on the second one.
Incubation overnight @37.

@@ Line 1: / Line 1: @@
-<h1 class="c2"><span>Differentiation on <i>E. coli</i></span></h1><p class="c3"><span>The whole brainbow system will be integrated chromosomally at the GalK site. It will be synthesized as three gBlocks.</span></p><p class="c3"><span>It should allow expression of mCherry first, then upon expression of the CRE recombinase, differentiation in two states (YFP and CFP).</span></p><p class="c3"><span>It also contains a landing pad that allow insertion of a third state, which would subsequently lower the probability of states 1 and 2 so the three outcomes are possible.</span></p><h1 class="c2"><span>Writing the artificial gene</span></h1><p class="c3"><span>Promoter J23199 from the Biobrick collection</span></p><p class="c3"><span>4 LoxP sites used together in mammalian brainbow plasmids</span></p><p class="c3"><span>RBS from Ihab</span></p><p class="c3"><span>ORF for mCerulean and mVenus from Ihab</span></p><p class="c3"><span>ORF for mCherry from Antoine</span></p><p class="c3"><span>rrnBT1 terminator used on the pOSIP plasmids</span></p><p class="c3"><span>Landing Pad (PhiC31 attB TT site)</span></p><p class="c3 c5"><span></span></p><p class="c3"><span>Check for secondary structure in the RBS </span><span class="c15">Done</span></p><p class="c3"><span>Check for RBS in the LoxP array </span><span class="c15">Done</span></p><p class="c3"><span>Split to have two ~1500 bp gblocks </span><span class="c15">Done</span></p><p class="c3"><span>Design overlaps for Gibson in R6K vector </span><span class="c15">Done</span></p><p class="c3"><span>Check for Biobrick restriction sites </span><span class="c15">Done</span></p><p class="c3"><span>Fix gBlocks problems</span></p><ul class="c23 lst-kix_3yfe9n3im8de-0 start"><li class="c3 c13"><span>Palindroms between LoxP sites </span><span class="c15">Done</span></li><li class="c3 c13"><span>Repeats in terminator: replaced with Lambda T0 terminator </span><span class="c15">Done</span></li><li class="c3 c13"><span>Repeat in RBS </span><span class="c15">Done</span></li><li class="c3 c13"><span>More GC in the LoxP array </span><span class="c15">Done</span></li><li class="c3 c13"><span>More GC at the end of fragment 1</span><span class="c15">Done</span></li><li class="c3 c13"><span>Repeat at the end of mVenus and mCerulean </span><span class="c15">Done</span></li><li class="c3 c13"><span>More GC at the beginning of fragment 2 </span><span class="c15">Done</span></li></ul><p class="c3"><span>It is very difficult to solve these -&gt; make 3 fragments </span><span class="c15">Done</span></p><p class="c3"><span>Fragment A: 0 - 1143</span></p><p class="c3"><span>Fragment B: 1105 - 2006</span></p><p class="c3"><span>Fragment C: 1981 - 2946</span></p><p class="c3"><span>Change the RBS for Fragment A -&gt; &ldquo;New RBS&rdquo; </span><span class="c15">Done</span></p><p class="c3"><span>Order gBlocks </span><span class="c15">Done 07/13</span></p><h2 class="c2"><span>Design + order oligos for gBlocks amplification </span><span class="c44">Done</span></h2><p class="c3"><span>Overlaps melting points are 62, 67, 54, 74.</span></p><p class="c3"><span>The overlap between fragments B and C should be increased to &gt;62.</span></p><p class="c3 c5"><span></span></p><p class="c3 c5"><span></span></p><p class="c3 c5"><span></span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c83"><tbody><tr class="c40"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">R6K LinR</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c57">tagcattatacctaggactgagctagctgtcaa</span><span class="c12">ggcaaatttgcggccgcaag</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.80</span></p></td></tr><tr class="c76"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">R6K LinF</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c12">CGGGCGCGTACTCCAgaagggcatcgatggc</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.81</span></p></td></tr><tr class="c54"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow A F</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c12">ttgacagctagctcagtcctag</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.82</span></p></td></tr><tr class="c85"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow A R</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c12">GGCCATTCACATCACCATC</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.83</span></p></td></tr><tr class="c52"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow B F</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c12">GCCGATTCTTGTTGAACTTG</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.84</span></p></td></tr><tr class="c1"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow B R</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c57">CCATGGTA</span><span>CCTCCTCCTTACTTCTATAACTTC</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.85</span></p></td></tr><tr class="c1"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow C F</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c57">GATACTTTATA</span><span>CGAAGTTATAGAAGTAAGGAGGAG</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.86</span></p></td></tr><tr class="c1"><td class="c27" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow C R</span></p></td><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c57">gccatcgatgcccttc</span><span class="c12">TGGAGTACGCGCCCG</span></p></td><td class="c36" colspan="1" rowspan="1"><p class="c11"><span class="c16">o15.87</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c3"><span>Overlap melting points: 62, 67, 62, 72.</span></p><h2 class="c2"><span>Design + order oligos for cassette sequencing </span><span class="c44">Done</span></h2><p class="c3"><span>&gt;50 bp before the interest region</span></p><p class="c3"><span>800 bp max contigs</span></p><p class="c3 c5"><span></span></p><p class="c3"><span>Obtain Pir+ strain </span><span class="c15">Done</span></p><p class="c3"><span>Overnight of Pir+ strain </span><span class="c15">Done</span></p><p class="c3"><span>Glycerol of Pir+ strain </span><span class="c15">Done</span></p><h1 class="c2"><span>Cloning inside the replication vector</span></h1><p class="c3"><span>Order oligos linR and linF </span><span class="c15">Done</span></p><p class="c3"><span>Obtain R6K vector from Ihab </span><span class="c15">Done</span></p><p class="c3"><span>Overnight culture of the R6K vector propagation strain</span></p><p class="c3"><span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span class="c24">Failed </span><span>New attempt with less harsh growth conditions. </span><span class="c15">Done</span></p><ul class="c23 lst-kix_eef93s4fxf31-0 start"><li class="c3 c13"><span>Only 20 ug/ml of Kanamycine</span></li><li class="c3 c13"><span>6 ul of Thyamine in 3 ul of LB</span></li><li class="c3 c13"><span>Culture at 30&deg;C</span></li></ul><p class="c3"><span>Miniprep of the R6K vector </span><span class="c15">Done</span></p><p class="c3"><span>Glycerol of R6K strain </span><span class="c15">Done</span></p><p class="c3"><span>Linearization of the R6K vector by PCR </span><span class="c15">Done</span></p><p class="c3 c5"><span></span></p><p class="c3"><span class="c33">Primer linF:</span></p><p class="c3"><span>CCCTTGGGCTCCCCGGGCGCGTACTCCA</span><span class="c33">gaagggcatcgatggc</span></p><p class="c3"><span>(28 bases: longest possible overlap without having a hairpin at 50&deg;)</span></p><p class="c3"><span>Tm = 55&deg;</span></p><p class="c3 c5"><span></span></p><p class="c3"><span class="c33">Primer linR:</span></p><p class="c3"><span>tagcattatacctaggactgagctagctgtcaa</span><span class="c33">ggcaaatttgcggccgcaag</span></p><p class="c3"><span>(33 bases overlap)</span></p><p class="c3"><span>Tm = 62&deg;</span></p><p class="c3 c5"><span></span></p><p class="c3"><span class="c24">Product length: </span><span>2276 bp</span></p><p class="c3"><span>Synthetize, reconstitute and dilute primers </span><span class="c15">Done</span></p><p class="c3"><span>Run gel for size checking </span><span class="c15">Done</span></p><p class="c3"><span>PCR purification </span><span class="c15">Done</span></p><p class="c3 c5"><span class="c15"></span></p><p class="c3"><span>Obtain gBlocks </span><span class="c15">Done</span></p><p class="c3"><span>PCR of colibow fragments A, B and C </span><span class="c15">Done</span></p><p class="c3"><span>PCR purification of amplicon </span><span class="c15">Done</span></p><p class="c3 c5"><span class="c15"></span></p><p class="c3"><span>Obtain Gibson mix </span><span class="c15">Done</span></p><p class="c3"><span>Make overnight culture of Pir+ strain </span><span class="c15">Done</span></p><p class="c3"><span>Make electrocompetent cells out of the Pir+ strain </span><span class="c15">Done</span></p><p class="c3"><span>Gibson assembly of 3 gblocks with the R6K backbone. </span><span class="c15">Done</span></p><p class="c3"><span>The vector can </span><span class="c24">only</span><span>&nbsp;replicate in Pir+ strain. Transform into Pir+ strain </span><span class="c15">Got colonies</span></p><p class="c3"><span>Check transformant: colony PCR before culture </span><span class="c33 c75">Failed</span></p><p class="c3"><span>Liquid culture + miniprep</span></p><p class="c3"><span>Analytical digestion or sequencing (find enzymes)</span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqF1</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.88</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">cttagtacgttagccatgagg</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqF2</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.89</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">CTAATTTTCCATCTGATGGCC</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqF3</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.90</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">CAAGCTCACGCTCAAATTC</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqF4</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.91</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">ACAACCATTACCTGTCGACG</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqF5</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.92</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">CGACATTAGGGTATGGGCTG</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqR1</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c3 c39"><span class="c16">o15.93</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">TATAAACATTATGGCTATTATAG</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqR2</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.94</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">TTTAGAGAGTTTTGACTGCG</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqR3</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.95</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">TTTGCCAGTCGTACAGATGAA</span></p></td></tr><tr class="c1"><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">SeqR4</span></p></td><td class="c49" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">o15.96</span></p></td><td class="c35" colspan="1" rowspan="1"><p class="c39 c3"><span class="c16">TCTTCTTCTGCATCACCGGGC</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><h1 class="c2"><span>Chromosomal integration with GalK</span></h1><p class="c3"><span>PCR of the purified R6K plasmid. </span><span class="c33 c58">Done</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c24">PCR-linerization of the R6K backbone</span></p><p class="c3 c5"><span class="c24"></span></p><ul class="c23 lst-kix_vs7sbdpbvfmy-0 start"><li class="c0 c13"><span>Miniprep du backbone R6K (20 ng/ul) -&gt; 5 ul in PCR</span></li><li class="c0 c13"><span>Primers: 15.80 (LinR) et 15.81(LinF) &nbsp;-&gt; 1 ul each</span></li><li class="c0 c13"><span>Eau qsp 25 ul</span></li><li class="c0 c13"><span>Master mix 25 ul</span></li></ul><p class="c3 c5"><span></span></p><p class="c3"><span>1&rsquo;30&rsquo;&rsquo; extension, 50&deg;C annealing.</span></p><p class="c3 c5"><span></span></p><p class="c3"><span>Find oligos (already there) </span><span class="c33 c58">Done</span></p><p class="c3 c5"><span></span></p><p class="c3"><span class="c33">IntR:</span></p><p class="c3"><span class="c24">GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAA</span><span class="c33">CCATATGAATATCCTCCTTAGTTCCTATTCCG</span></p><p class="c3 c5"><span class="c33"></span></p><p class="c3"><span class="c33">Alternatively, with only one binding site:</span></p><p class="c3"><span class="c24">GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAA</span><span class="c33">ttagccatggtccatatgaatatcctccttag</span></p><p class="c3 c5"><span class="c33"></span></p><p class="c3"><span class="c33">IntF:</span></p><p class="c3"><span class="c24">TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCG</span><span class="c33">GGTTGAACTGCGGATCTTGCGGC</span></p><p class="c3 c5"><span></span></p><p class="c3"><span class="c24">Italique: </span><span>Homology region with E. coli GalK site.</span></p><p class="c3"><span class="c24">Length: </span><span>4908</span><span>&nbsp;bp</span></p><p class="c3"><span>Attention, autre site potentiel d&rsquo;amor&ccedil;age, produit de 3515 bp</span></p><p class="c3 c5"><span></span></p><p class="c3"><span>Purification</span></p><p class="c3"><span>Overnight culture de E. coli Lambda Red</span></p><p class="c3"><span>Competent cells out of Lambda Red strain</span></p><p class="c3"><span>Transformation of E. coli with pKD46 that carries Lambda Red recombinase</span></p><p class="c3"><span>Transformation of the </span><span class="c24">Colibow </span><span>PCR product</span></p><h1 class="c2"><span>Function testing</span></h1><p class="c3"><span>Tecan + Flux cytometry</span></p><h1 class="c2"><span>CRE recombinase expression</span></h1><p class="c3"><span>pFHC2938 should work.</span></p><p class="c3"><span>It expresses CRE&nbsp;and has a temperature sensitive ORI (30&deg;C)</span></p><p class="c3 c5"><span></span></p><h2 class="c0"><span>Monday 07/06</span></h2><h3 class="c0"><span>Research about the synthetic integron</span></h3><p class="c0"><span>It might make the landing pads better than with brainbow because the recombination site is always the same.</span></p><h3 class="c0"><span>Plate culture of E. coli pIT5-KL and pIT5-KH</span></h3><p class="c0"><span class="c57">Very important: grow @30</span></p><p class="c0"><span>-&gt; Make a liquid culture of each and freeze at -80</span></p><p class="c0"><span>-&gt; Miniprep from pIT5-KL for first construct</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>These two strains produce the vector plasmids for </span><span class="c24">clonetegration</span><span>. They have to be linearized with EcoR1 and Pst1, and then Gibson assembled to get the self-integrating plasmids.</span></p><p class="c0"><span>The integrase they carry is expressed only at 37 degrees.</span></p><p class="c0"><span>They are resistant to Kanamycine.</span></p><p class="c0"><span>KH integrates into the HK022 phage&rsquo;s site, while KL integrates into the Lambda phage site. We will probably only need one of them but I took both just in case. If needed there is a whole collection of such vectors.</span></p><h3 class="c0"><span>Plate culture of E. coli pE-FLP</span></h3><p class="c0"><span class="c57">Grow @ 30</span></p><p class="c0"><span>This strain produces the pE-FLP plasmid, which expresses the flippase. It will be useful to remove the backbone after the clonetegration. It&rsquo;s resistant to ampicillin.</span></p><p class="c0"><span>It has a temperature-sensitive ORI and will disappear if grown at 37.</span></p><h3 class="c0"><span>New primers</span></h3><p class="c0"><span>LC81, LC85, LC82, LC86: used in the PCR to check integration with pIT5 KH.</span></p><p class="c0"><span>LC81, LC87, LC83, LC84: used in the PCR to check integration with pIT5 KL.</span></p><p class="c3 c5"><span></span></p><h1 class="c0"><span>Thursday 07/09</span></h1><ul class="c23 lst-kix_43wiff2r3nv0-0 start"><li class="c0 c13"><span>Prepared 10 tubes of 1 ml Kanamycine, 50 mg/ml</span></li><li class="c0 c13"><span>Inoculated pIT5-KL and pIT5-KH E. coli in 2 ml LB Kan+50</span></li><li class="c0 c13"><span>Inoculated pE-FLP E. coli in 2ml LB Amp+100</span></li><li class="c0 c13"><span>Cultured these three tubes @ 30</span></li></ul><h1 class="c2"><span>Monday 07/20</span></h1><h2 class="c0"><span>Reception of two plates from Ihab</span></h2><ul class="c23 lst-kix_16d8nr7jj9vf-0 start"><li class="c0 c13"><span>Shortened R6K vector -&gt; Kan+ and thyamine auxotrophy. Thyamine 1000x is available in an eppendorf tube.</span></li><li class="c0 c13"><span>Pir 116 strain for propagation of the vector.</span></li></ul><p class="c0"><span>-&gt; Overnight culture for miniprep for PCR and gleezing</span></p><ul class="c23 lst-kix_7l6rkhsnz2kv-0 start"><li class="c0 c13"><span>R6K in LB Kan Thyamine (in antibiotics box)</span></li><li class="c0 c13"><span>Pir116 in LB with a control tube</span></li></ul><h2 class="c0"><span>Started cultures for Colibow</span></h2><p class="c0"><span>pThy 1.0 </span><span class="c24">aka </span><span>pBrainbow 1.0 in 3 ml LB-Amp -&gt; Miniprepcr</span></p><p class="c0"><span>pR6K in LB-Kan-Thyamine -&gt; Miniprepcr and Glycerol freezing</span></p><p class="c0"><span>Pir116 for replication of pR6K-vectors -&gt; LB</span></p><p class="c0"><span>Control without innoculation -&gt; LB</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>All of them, culture @ 37&deg; overnight.</span></p><p class="c3 c5"><span></span></p><p class="c3"><span>No need to culture pKT174 because we already have the purified version. It may be a good idea to transform DH5a with it in case we run out of plasmid.</span></p><h2 class="c0"><span class="c24">Reception of oligos</span><span>&nbsp;</span><span class="c24">o15.76 to o15.96</span></h2><ul class="c23 lst-kix_bf1dbbpw3g6t-0 start"><li class="c0 c13"><span>Yeastbow SOE</span></li><li class="c0 c13"><span>R6K linearization</span></li><li class="c0 c13"><span>Colibow gBlock Amp</span></li><li class="c0 c13"><span>Colibow Sequencing</span></li></ul><p class="c0"><span>The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>-&gt; Oligo reconstitution and dilution</span></p><p class="c0"><span>-&gt; Miniprep of R6K vector</span></p><p class="c0"><span>-&gt; PCR of R6K vector</span></p><p class="c0"><span>-&gt; Miniprep of pBrainbow 1.0</span></p><p class="c0"><span>-&gt; PCR of pBrainbow 1.0</span></p><p class="c0"><span>-&gt; PCR of pThy Ura3</span></p><p class="c3 c5"><span></span></p><p class="c3"><span>Reconstituted all primers to 100 ug/ml.</span></p><h2 class="c0"><span>Miniprep of pR6K and pBrainbow 1.0</span></h2><p class="c0"><span>For PCR, using Promega kit w/ double wash. Elution in 30 ul</span></p><p class="c3"><span>Final concentration: 93 ng/ul</span></p><h2 class="c0"><span>Re-start of the R6K culture</span></h2><p class="c0"><span>The first culture failed: let&rsquo;s try again with less harsh conditions.</span></p><ul class="c23 lst-kix_d39sosk890p4-0 start"><li class="c3 c13 c78"><span>Only 20 ug/ml of Kanamycine</span></li><li class="c3 c13 c78"><span>6 ul of Thyamine in 3 ul of LB</span></li><li class="c3 c13"><span>Culture at 30&deg;C</span></li></ul><h1 class="c2"><span>Wednesday 07/22</span></h1><h2 class="c0"><span>PCR-linerization of the R6K backbone</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><ul class="c23 lst-kix_pwfssjiu0y8y-0 start"><li class="c0 c13"><span>Miniprep du backbone R6K (20 ng/ul) -&gt; 5 ul in PCR</span></li><li class="c0 c13"><span>Primers: 15.80 (LinR) et 15.81(LinF) &nbsp;-&gt; 1 ul each</span></li><li class="c0 c13"><span>Eau qsp 25 ul</span></li><li class="c0 c13"><span>Master mix 25 ul</span></li></ul><p class="c3 c5"><span></span></p><p class="c0"><span>1&rsquo;30&rsquo;&rsquo; extension, 50&deg;C annealing -&gt; 2276 bp</span></p><p class="c3 c5"><span></span></p><h2 class="c0"><span>Bad news from IDT about the gene synthesis</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><p class="c0"><span>&laquo; I would like to notify you about a best effort for gBlock &lsquo;Colibow C&rsquo;. Even after multiple attempts at trying to correct this issue, the Final QC data for the best prep is not meeting our quality standards. The final prep (mfg# 188635671) has desired peak. &nbsp;A secondary peak is also present. The target mass was found in the chromatogram, but not as the most abundant product in any of the chromatographic peaks for mass spectrometry, and the sequence has been verified.</span></p><p class="c3"><span>If you are using this sequence for cloning and/or qPCR you should not have any problems with this sequence. It may require you to screen additional colonies. However, if your intentions with using this gBlock was for other purposes, we might need to cancel the gBlock and redesign. I have provided the trace below. &raquo;</span></p><h1 class="c0"><span>Thursday, 07/23</span></h1><h2 class="c0"><span>Glycerol stock for pR6K</span></h2><p class="c0"><span>1 ml of overnight culture of E. coli pR6K.</span></p><p class="c0"><span>1 ml of glycerol.</span></p><p class="c3"><span>-&gt; -20&deg;C</span></p><h2 class="c0"><span>Gel for linearized R6K pcr</span></h2><p class="c0"><span>1% agar TAE, with 1 kb+ generuler.</span></p><p class="c0"><span>5 ul PCR product + 1 ul LB.</span></p><p class="c0"><span>-&gt; band at the right size (2276 bp) , the PCR worked.</span></p><p class="c3 c5"><span></span></p><h2 class="c0"><span>linearized R6K pcr cleanup</span></h2><p class="c0"><span>Using the Qiagen kit, taken back in 50 ul water</span></p><p class="c3"><span>Titration: about 80 ng/ul, but very bad 260/230 ratio (presence of organic molecules).</span></p><p class="c3 c5"><span></span></p><h2 class="c0"><span>Pir116 electrocompetent for bowcoli transformation</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><p class="c0"><span>2 ml overnight culture in 100 ml LB, at 37&deg;C w/ shaking.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>When OD reaches 0.6, they were put in ice for half an hour.</span></p><p class="c3"><span>Electrocompetent cells were made by Mukit along with DH5a competent cells.</span></p><h1 class="c0"><span>Tuesday, 07/28</span></h1><h2 class="c0"><span>Reception of gBlocks Colibow A, B, C</span></h2><p class="c0"><span>Reconstitution to the concentration of 10 ng/ul (from spec sheet):</span></p><ul class="c23 lst-kix_jna3derhxpxm-0 start"><li class="c0 c13"><span>Centrifuge @ 11kG</span></li></ul><ul class="c23 lst-kix_gsjpi9jp124l-0 start"><li class="c0 c13"><span>Add 100 ul of RNase-free water</span></li><li class="c0 c13"><span>Vortex</span></li><li class="c0 c13"><span>Incubate at 50&deg;C for 20 minutes</span></li><li class="c0 c13"><span>Vortex/Centrifuge</span></li></ul><h2 class="c0"><span>PCR of Colibow gBlocks</span></h2><p class="c3 c5"><span class="c33 c41"></span></p><p class="c0"><span class="c33">Colibow A</span></p><p class="c0"><span>Primers: 82 (56&deg;) + 83 (54&deg;) -&gt; 1172 bp</span></p><p class="c0"><span class="c33">Colibow B</span></p><p class="c0"><span>Primers: 84 (53&deg;) + 85 (54&deg;) -&gt; 909 bp</span></p><p class="c0"><span class="c33">Colibow C</span></p><p class="c0"><span>Primers: 86 (54&deg;) + 87 (57&deg;) -&gt; 992 bp</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>Reaction in 50 ul:</span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c34" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Compound</span></p></td><td class="c72" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Volume (ul)</span></p></td></tr><tr class="c1"><td class="c34" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Water</span></p></td><td class="c72" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">19</span></p></td></tr><tr class="c1"><td class="c34" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Phusion 2x</span></p></td><td class="c72" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">25</span></p></td></tr><tr class="c1"><td class="c34" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Primer 1</span></p></td><td class="c72" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2.5</span></p></td></tr><tr class="c1"><td class="c34" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Primer 2</span></p></td><td class="c72" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2.5</span></p></td></tr><tr class="c1"><td class="c34" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">gBlock diluted 10 times</span></p></td><td class="c72" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1 ul</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span>Program:</span></p><p class="c0"><span>98 (30)</span></p><p class="c0"><span>98 (10) 58 (25) 72 (45) x35</span></p><p class="c0"><span>72 (600)</span></p><p class="c0"><span>12 (hold)</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>In parallel from running the gel, the PCR products were purified with the QIAGEN kit and eluted in 40 ul of water.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Titration</span></p><p class="c0"><span>Fragment A: 90 ng/ul</span></p><p class="c0"><span>Fragment B: 88 ng/ul</span></p><p class="c0"><span>Fragment C: 85 ng/ul</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Gel plan</span></p><p class="c0"><span>1% agar, SYBRsafe, 5 ul of PCR product + 1 ul of LD.</span></p><p class="c0"><span>The 100 bp+ marker was used.</span></p><p class="c0"><span>The apparatus </span><span class="c24">didn&rsquo;t work. </span><span>It stopped two times, the gel stayed to diffuse in the tank for 30 minutes. At the end it was imaged even though it was far from finished.</span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c9" colspan="1" rowspan="1"><p class="c0 c19 c46"><span class="c12">Ladder 100 bp+</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">Colibow A</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">Colibow B</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">Colibow C</span></p></td></tr><tr class="c1"><td class="c9" colspan="1" rowspan="1"><p class="c0 c46 c19"><span class="c12">Expected size</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">1172</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">909</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">992</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 401.33px; height: 296.00px;"><img alt="Colibow Amp Results.jpg" src="images/image04.jpg" style="width: 401.33px; height: 296.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 150.67px; height: 296.00px;"><img alt="1438103355.jpg" src="images/image02.jpg" style="width: 150.67px; height: 296.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Conclusion</span></p><p class="c0"><span>There are a lot of non-specific binding.</span></p><p class="c0"><span>Due to the awful quality of the gel, it&rsquo;s not possible to determine their size or which bands are the good ones. The top ones seem more consistent regarding their relative sizes.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">To do:</span></p><ol class="c23 lst-kix_b4qhzx8td5i4-0 start" start="1"><li class="c0 c13"><span>Run the whole purified PCR product in a gel and perform a gel extraction. Hopefully the right band can be determined this time.</span></li><li class="c0 c13"><span>Try the PCR again with a higher annealing temperature.</span></li><li class="c0 c13"><span>Gibson assemble directly the gBlocks fragments.</span></li></ol><h1 class="c0"><span>Wednesday, 07/29</span></h1><h2 class="c0"><span>Gel for Colibow A, B, C and extraction</span></h2><p class="c0"><span>Agar 1%, SYBRsafe, TAE</span></p><p class="c3 c5"><span></span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c9" colspan="1" rowspan="1"><p class="c0 c46 c19"><span class="c12">Ladder 100 bp+</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">Colibow A</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">Colibow B</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">Colibow C</span></p></td></tr><tr class="c1"><td class="c9" colspan="1" rowspan="1"><p class="c0 c46 c19"><span class="c12">Expected size</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">1172</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">909</span></p></td><td class="c9" colspan="1" rowspan="1"><p class="c8 c3 c19"><span class="c12">992</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 358.67px; height: 296.00px;"><img alt="Colibow Amp Extracted.jpg" src="images/image01.jpg" style="width: 358.67px; height: 296.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c0"><span>For each sample, the top band was extracted. The Colibow B sample was extracted twice: Bg (grande, top band) and Bp (petite, bottom band).</span></p><p class="c0"><span>The </span><span class="c33">bottom band</span><span>&nbsp;is the right one.</span></p><p class="c0"><span class="c68">-</span><span class="c68 c24">&gt; add DMSO 3% next time</span></p><p class="c3 c5"><span class="c24 c68"></span></p><p class="c0"><span class="c24">Titration (in 30 ul EB)</span></p><p class="c3 c5"><span class="c24"></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c31" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Name</span></p></td><td class="c67" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c67" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">U</span></p></td><td class="c42" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">A</span></p></td><td class="c28" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Bp</span></p></td><td class="c6" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Bg</span></p></td><td class="c70" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">C</span></p></td></tr><tr class="c1"><td class="c31" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">C (ng/ul)</span></p></td><td class="c67" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">13</span></p></td><td class="c67" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">41</span></p></td><td class="c42" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">6</span></p></td><td class="c28" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">29</span></p></td><td class="c6" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">11</span></p></td><td class="c70" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">12.1</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span>The concentrations of Colibow A and C are critically low. It is necessary to fix the PCR and reduce the non-specific priming before performing the Gibson.</span></p><h2 class="c0"><span>New attempt at Colibow A and C PCRs</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><p class="c0"><span class="c33">Mix</span></p><p class="c0"><span>Phusion&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25</span></p><p class="c0"><span>Colibow A&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1</span></p><p class="c0"><span>o15.82&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c0"><span>o15.83&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c0"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;19</span></p><p class="c0"><span>DMSO&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.5 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(3%)</span></p><p class="c0"><span>= Two tubes of 50 ul each -&gt; 1172 bp</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Mix</span></p><p class="c0"><span>Phusion&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25</span></p><p class="c0"><span>Colibow C&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1</span></p><p class="c0"><span>o15.86&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c0"><span>o15.87&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c0"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;19</span></p><p class="c0"><span>DMSO&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.5 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(3%)</span></p><p class="c0"><span>= Two tubes of 50 ul each -&gt; 992 bp</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>This is stored in 4&deg; for now (29/07)</span></p><h2 class="c0"><span>Received Gibson assembly mixes from Ihab</span></h2><p class="c0"><span>I need better quality products before doing it.</span></p><p class="c3 c5"><span></span></p><h1 class="c0"><span>Thursday, 07/30</span></h1><p class="c3 c5"><span class="c84"></span></p><h2 class="c0"><span>Gel for A, C and 1</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><p class="c0"><span class="c24">*</span><span>Sophie&rsquo;s sample</span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c59" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">*</span></p></td><td class="c37" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">A</span></p></td><td class="c37" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">A</span></p></td><td class="c37" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">A</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">C</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">C</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">C</span></p></td><td class="c73" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">100+</span></p></td><td class="c64" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c64" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c64" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1kb</span></p></td></tr><tr class="c1"><td class="c59" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">*</span></p></td><td class="c37" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1172</span></p></td><td class="c37" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1172</span></p></td><td class="c37" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1172</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">992</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">992</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">992</span></p></td><td class="c73" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c64" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">3965</span></p></td><td class="c64" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">3965</span></p></td><td class="c64" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">3965</span></p></td><td class="c29" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span>50 ul sample + 10 ul LD -&gt; 40 ul in each well (3 wells)</span></p><p class="c0"><span class="c33">Attention </span><span>C sample accidentally added to the well containing 100 bp + ladder !!!</span></p><p class="c3 c5"><span></span></p><p class="c0"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 602.00px; height: 282.67px;"><img alt="Colibow A et C amp 29.07.jpg" src="images/image00.jpg" style="width: 602.00px; height: 282.67px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c0"><span class="c33">Gel extraction</span></p><p class="c0"><span>With Qiagen kit, product recovered in 30 ul of water.</span></p><p class="c0"><span>Name: &ldquo;product&rdquo; X+ 30/07</span></p><p class="c0"><span>The C product mixed with ladder was labeled Cl.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Titration</span></p><p class="c3 c5"><span class="c33"></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c77" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Sample</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c48" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">A</span></p></td><td class="c48" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">C</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Cl</span></p></td></tr><tr class="c1"><td class="c77" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">c (ng/ul)</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">5.2</span></p></td><td class="c48" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">15.4</span></p></td><td class="c48" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">12.9</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">4.4</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><h2 class="c0"><span>Gibson assemblies of Colibow</span></h2><p class="c0"><span class="c24">General mix:</span></p><p class="c0"><span>15 ul of Gibson supermix (MMII)</span></p><p class="c0"><span>10-100 ng of backbone for a 6 kb fragment</span></p><p class="c0"><span>Equimolar amount of DNA fragments</span></p><p class="c0"><span>Total: 20 ul</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c24">Colibow PCR products</span></p><p class="c0"><span>Using the most concentrated PCR products known to date.</span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c56" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Nom</span></p></td><td class="c31" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Taille (bp)</span></p></td><td class="c60" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Concentration</span></p></td><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Volume (ul)</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Quantit&eacute; (ng)</span></p></td></tr><tr class="c1"><td class="c56" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">R6K pcr</span></p></td><td class="c31" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2276</span></p></td><td class="c60" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">80</span></p></td><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">0.6</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">50</span></p></td></tr><tr class="c1"><td class="c56" colspan="1" rowspan="1"><p class="c8 c3"><span>Colibow A+ e </span><span class="c62 c24">(in water)</span></p></td><td class="c31" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1172</span></p></td><td class="c60" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">15</span></p></td><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1.7</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">25</span></p></td></tr><tr class="c1"><td class="c56" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Colibow Bp</span></p><p class="c8 c3"><span class="c24 c62">(in EB)</span></p></td><td class="c31" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">909</span></p></td><td class="c60" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">29</span></p></td><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">0.9</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">25</span></p></td></tr><tr class="c1"><td class="c56" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Colibow C+ e</span></p><p class="c8 c3"><span class="c62 c24">(in water)</span></p></td><td class="c31" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">992</span></p></td><td class="c60" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">13</span></p></td><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1.6</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">25</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span class="c24">Colibow gBlocks</span></p><p class="c0"><span>Using directly the gBlocks from IDT dna synthesis</span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Nom</span></p></td><td class="c53" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Taille (bp)</span></p></td><td class="c18" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Concentration</span></p></td><td class="c43" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Volume (ul)</span></p></td><td class="c25" colspan="1" rowspan="1"><p class="c8 c3"><span class="c14">Quantit&eacute; (ng)</span></p></td></tr><tr class="c1"><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">R6K pcr</span></p></td><td class="c53" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2276</span></p></td><td class="c18" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">80</span></p></td><td class="c43" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">0.5</span></p></td><td class="c25" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">30</span></p></td></tr><tr class="c1"><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Colibow A</span></p></td><td class="c53" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1172</span></p></td><td class="c18" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">10</span></p></td><td class="c43" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1.5</span></p></td><td class="c25" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">15</span></p></td></tr><tr class="c1"><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Colibow B</span></p></td><td class="c53" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">909</span></p></td><td class="c18" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">10</span></p></td><td class="c43" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1.5</span></p></td><td class="c25" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">15</span></p></td></tr><tr class="c1"><td class="c7" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Colibow C</span></p></td><td class="c53" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">992</span></p></td><td class="c18" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">10</span></p></td><td class="c43" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1.5</span></p></td><td class="c25" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">15</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Incubation</span><span>&nbsp;during one hour at 50&deg;C.</span></p><h2 class="c0"><span>3 LB ampicillin plates</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><p class="c0"><span>&ldquo;30/07 ANTOINE&rdquo;</span></p><p class="c0"><span>50 ml of hot LB-agar.</span></p><h2 class="c0"><span>Transformation of Colibow in Pir116 by Electroporation</span></h2><p class="c0"><span>pColibow gBlock</span></p><p class="c0"><span>pColibow PCR</span></p><p class="c0"><span>Biobrick plasmid with RFP (3 ul of 10 pg tube, not dialysed)</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>Protocol from OWW:</span></p><ul class="c23 lst-kix_nb9qvn8a74ne-0 start"><li class="c0 c13"><span>Thaw cells from -80&deg;C to ice for &gt;20 min</span></li><li class="c0 c13"><span>Chill cuvettes</span></li><li class="c0 c13"><span>Dialyse 6 ul of Gibson products on dWater during &gt;20 min</span></li><li class="c0 c13"><span>Mix 6 ul of dialysed DNA with 50 ul Pir116 electrocompetent cells</span></li><li class="c0 c13"><span>Mix with tip</span></li><li class="c0 c13"><span>Pulse (1.5 kV, 2 mm cuvette)</span></li><li class="c0 c13"><span>Add 1 ml LB (at 18h43)</span></li></ul><p class="c0"><span>Incubate for 1 hour at 37&deg;C.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>2 Kanamycine 25 plates for each colibow plasmid: 100 ul and 900 ul</span></p><p class="c0"><span>1 Chloramphenicol plate for RFP control</span></p><p class="c0"><span>Incubation overnight @37.</span></p><h2 class="c0"><span>Transformation of pKT174 in DH5a by Heat shock</span></h2><p class="c0"><span>Protocol from addgene:</span></p><ul class="c23 lst-kix_xircxuoilnk5-0 start"><li class="c0 c13"><span>Thaw cells on ice (20 min)</span></li><li class="c0 c13"><span>3 ul DNA + 50 ul chemically competent cells, mix gently</span></li><li class="c0 c13"><span>20-30 min on ice</span></li><li class="c0 c13"><span>45s at 42&deg;C</span></li><li class="c0 c13"><span>2 min on ice</span></li><li class="c0 c13"><span>Add 1 ml LB (at 18h50)</span></li><li class="c0 c13"><span>Incubate 1 hour @ 37&deg;C</span></li></ul><p class="c3 c5"><span></span></p><p class="c0"><span>2 ampicillin plates: 100 ul and 900 ul.</span></p><p class="c0"><span>Incubation overnight @37.</span></p><h2 class="c0"><span>Gel for SOE 29/07</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c80" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1 kb ladder</span></p></td><td class="c55" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">SOE</span></p></td><td class="c55" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">SOE</span></p></td><td class="c55" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">SOE</span></p></td><td class="c80" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1 kb ladder</span></p></td><td class="c86" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">*</span></p></td></tr></tbody></table><p class="c0"><span class="c33">Expected size:</span><span>&nbsp;5600 for all of them.</span></p><p class="c0"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 354.67px; height: 338.67px;"><img alt="SOE+29.07.jpg" src="images/image03.jpg" style="width: 354.67px; height: 338.67px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c0"><span>It didn&rsquo;t work at all. Try to Gibson-assemble them.</span></p><h2 class="c0"><span>New electroporation of Pir116</span></h2><p class="c0"><span>Using the old electroporator (with the square cuvette holder).</span></p><ul class="c23 lst-kix_qp9wn4g07u2k-0 start"><li class="c0 c13"><span>Dialysis of 6 ul and sampling of 5 ul of Colibow gBlock assembly</span></li><li class="c0 c13"><span>Dialysis of 5 ul and sampling of 5 ul of 5 pg/ul</span><span><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c61" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Compound</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">x1</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">x8</span></p></td></tr><tr class="c1"><td class="c61" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">10x Taq Buffer</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2.5</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">20</span></p></td></tr><tr class="c1"><td class="c61" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">10 nM dNTPs</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">0.5</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">4</span></p></td></tr><tr class="c1"><td class="c61" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">10 uM primer 90</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">0.5</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">4</span></p></td></tr><tr class="c1"><td class="c61" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">10 uM primer 94</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">0.5</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">4</span></p></td></tr><tr class="c1"><td class="c61" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">taq polymerase</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">0.125</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td></tr><tr class="c1"><td class="c61" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">water</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">17.875</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">167</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span>Then 22 ul of mix is added to 3 ul of template (2 ul water + 1 ul sample for positive control). Template is obtained by soaking part of a colony in 20 ul water.</span></p><h4 class="c0"><span>Program (saved as Colony):</span></h4><p class="c0"><span>95 (6&rsquo;00)</span></p><p class="c0"><span>95 (15) 49 (25) 68 (45) x30</span></p><p class="c0"><span>68 (5&rsquo;00)</span></p><h4 class="c0"><span>Gel:</span></h4><p class="c0"><span>P900&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;B1&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;B2&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;B3&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ColibowB&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;100bp+</span></p><h4 class="c0"><span>Results:</span></h4><ul class="c23 lst-kix_v1bhqpofjuen-0 start"><li class="c0 c13"><span>One band at 508 bp on the positive control.</span></li><li class="c0 c13"><span>No band at all on the colonies</span></li></ul><p class="c0"><span>-&gt; They are contaminations, the transformation did not work, probably because the Gibson itself did not work due to bad DNA concentration.</span></p><h1 class="c0"><span>Wednesday, 8/5</span></h1><h3 class="c0"><span>Pir116 electrocompetent cells</span></h3><p class="c0"><span>From the overnight culture, 1 ml of cells were diluted in 50 ml of LB and incubated at 37&deg;C (10h30).</span></p><p class="c0"><span>Centrifuge steps were done 10 min at 8500 rpm.</span></p><ul class="c23 lst-kix_bv3q166nbeys-0 start"><li class="c0 c13"><span>50 ml culture -&gt; centrifuge and remove well the supernatant</span></li><li class="c0 c13"><span>50 ml glycerol 10% -&gt; centrifuge</span></li><li class="c0 c13"><span>50 ml glycerol 10% -&gt; centrifuge</span></li></ul><p class="c0"><span>Cells in residual glycerol were aliquoted in eppendorf tubes (6 in the end) and frozen @-80.</span></p><h3 class="c0"><span>Testing of these EC Pir116 cells function</span></h3><p class="c0"><span>4 ul of pSB1C3 20 pg/ul were dialysed, 3 ul were picked after 20 min and mixed with 100 ul of cells.</span></p><p class="c0"><span>Pulse duration: 5.7 ms</span></p><p class="c0"><span>After 1 h of preculture @37, it was plated on a chloramphenicol 0.5 plate and grown @37.</span></p><h3 class="c0"><span>New colibow PCR</span></h3><p class="c0"><span>Performed by Chlo&eacute; and &Eacute;milie.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 602.00px; height: 169.33px;"><img alt="1438872081.png" src="images/image06.png" style="width: 602.00px; height: 169.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c0"><span class="c33">Program:</span></p><p class="c0"><span>98 (30)</span></p><p class="c0"><span>35x 98 (10), Gradient (30), 72 (2&rsquo;20)</span></p><p class="c0"><span>72 (5)</span></p><p class="c0"><span>10 (hold)</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Gradient:</span></p><p class="c0"><span>59, 57.8, 55.3, 53.4</span></p><p class="c0"><span>The very long extension time is used to avoid promoting small non-specific fragments.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Gel:</span></p><p class="c0"><span class="c82">1% agarose, SYBRsafe, 2.5 ul sample + 0.5 ul LD</span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c45" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">L</span></p></td><td class="c63" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">A</span></p></td><td class="c65" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">A</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">A</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">A</span></p></td><td class="c45" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">L</span></p></td><td class="c32" colspan="1" rowspan="1"><p class="c3 c8"><span class="c4">B</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">B</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">B</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">B</span></p></td><td class="c45" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">L</span></p></td><td class="c32" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">C</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">C</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">C</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">C</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">L</span></p></td></tr><tr class="c1"><td class="c45" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">1 kb</span></p></td><td class="c63" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">1172</span></p></td><td class="c65" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c45" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">1 kb</span></p></td><td class="c32" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">909</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c45" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">1 kb</span></p></td><td class="c32" colspan="1" rowspan="1"><p class="c8 c3"><span class="c4">992</span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c66" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c39 c3 c5"><span class="c12"></span></p></td></tr></tbody></table><p class="c0"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 454.67px; height: 262.67px;"><img alt="08.05 Colibow Amp gradient.jpg" src="images/image07.jpg" style="width: 454.67px; height: 262.67px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><h2 class="c0"><span>Thursday, 8/6</span></h2><h3 class="c0"><span>PCR purification of Colibow gBlocks</span></h3><p class="c0"><span>The homologous tubes were mixed together, except for C2 that didn&rsquo;t work.</span></p><p class="c0"><span>Elution in 50 ul of water.</span></p><p class="c0"><span>A second gel was ran in order to know whether the light band at the bottom is still present.</span></p><p class="c3 c5"><span></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c74" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1 kb ladder</span></p></td><td class="c71" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">A</span></p></td><td class="c71" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">B</span></p></td><td class="c71" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">C</span></p></td></tr></tbody></table><p class="c3 c5"><span></span></p><p class="c0"><span>Is it. This has to be taken into account when calculating the concentrations for the Gibson assembly.</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Titration (in 50 ul of water):</span></p><p class="c0"><span class="c33">A: </span><span>137 ng/ul</span></p><p class="c0"><span class="c33">B: </span><span>167 ng/ul</span></p><p class="c0"><span class="c33">C: </span><span>99 ng/ul</span></p><p class="c0"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 274.67px; height: 338.67px;"><img alt="08.06 Colibow gradient after purification.jpg" src="images/image05.jpg" style="width: 274.67px; height: 338.67px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><h2 class="c0"><span>New R6K PCR</span></h2><p class="c3 c5"><span class="c41 c33"></span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Compound</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1x</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2x</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">water</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">71</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">142</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Phu buffer</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">20</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">40</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">dNTP</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">4</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">80 primer</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">81 primer</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">pR6K shortened (template)</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">DMSO</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">3</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">6</span></p></td></tr><tr class="c1"><td class="c50" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">Phusion polymerase</span></p></td><td class="c21" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">1</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c8 c3"><span class="c12">2</span></p></td></tr></tbody></table><p class="c0"><span class="c33">Program</span><span>:</span></p><p class="c0"><span>98 (30)</span></p><p class="c0"><span>98 (10) 52 (30) 72 (1&rsquo;30) x 35</span></p><p class="c0"><span>72 (5&rsquo;)</span></p><p class="c0"><span class="c33">Problem: </span><span>There was only &lt;1 ul of phusion left in the tube. The PCR did not work at all.</span></p><h3 class="c0"><span>New attempt</span></h3><p class="c0"><span class="c33">Mix (made twice)</span></p><p class="c0"><span>Phusion master mix&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;50 ul</span></p><p class="c0"><span>80 primer&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2 ul</span></p><p class="c0"><span>81 primer&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2 ul</span></p><p class="c0"><span>pR6K&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3 ul</span></p><p class="c0"><span>DMSO&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3 ul</span></p><p class="c0"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;40 ul</span></p><p class="c3 c5"><span></span></p><p class="c0"><span class="c33">Program</span><span>:</span></p><p class="c0"><span>98 (30)</span></p><p class="c0"><span>98 (10) 50 (30) 72 (1&rsquo;30) x 35</span></p><p class="c0"><span>72 (5&rsquo;)</span></p><p class="c3 c5"><span></span></p><p class="c0"><span>After this PCR, the product was:</span></p><ul class="c23 lst-kix_qttse2bwz5jb-0 start"><li class="c0 c13"><span>ran on a gel: Ladder 1kb, tube 1, tube 2 (3 ul sample, 2 ul water, 1 ul LD)</span></li><li class="c0 c13"><span>digested by DPN1:</span></li></ul><p class="c0"><span>1 ul of DPN1 added directly to the product, then incubated for 15 minutes at 37&deg; in the thermocycler and inactivated (5 min at 80&deg;).</span></p><p class="c3 c5"><span></span></p><p class="c3"><span>Gel results: To be uploaded (on my pendrive now).</span></p><h1 class="c2"><span>Monday, 08/10</span></h1><h2 class="c2"><span>PCR purification of R6K amp</span></h2><p class="c3"><span>With QIAGEN kit, performed by Chlo&eacute; &amp; &Eacute;milie. At the end, the product was recovered in 50 ul of water and </span><span class="c24">also</span><span>&nbsp;30 ul EB, for 80 ul total.</span></p><p class="c3"><span>The titration was done using a 5 ul + 3 ul mix as a blank.</span></p><h3 class="c2"><span>Products summary:</span></h3><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c14">R6K pcr</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c14">67.4 ng/ul</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c14">2276 bp</span></p></td></tr><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow A</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">137</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">1172 bp</span></p></td></tr><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow B</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">167</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">909 bp</span></p></td></tr><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">Colibow C</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">99</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">992 bp</span></p></td></tr></tbody></table><p class="c3"><span class="c33">A and C have a small band at ~200 bp, so the actual concentration of the product is half of what indicated by the Nanodrop.</span></p><h2 class="c2"><span>Gibson assembly of Colibow</span></h2><p class="c3"><span>Assuming half the DNA in A and C is the right one.</span></p><table cellpadding="0" cellspacing="0" class="c17"><tbody><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c14">Name</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c14">Volume (ul)</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c14">Final amount (pmol)</span></p></td></tr><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">A</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">1.11</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">0.10</span></p></td></tr><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">B</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">0.4</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">0.11</span></p></td></tr><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">C</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">1.30</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">0.10</span></p></td></tr><tr class="c1"><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">R6K</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">2.19</span></p></td><td class="c38" colspan="1" rowspan="1"><p class="c11"><span class="c12">0.10</span></p></td></tr></tbody></table><p class="c3"><span>Added to a MMII Gibson assembly master mix and incubated during 1h at 50&deg;C.</span></p><h3 class="c2"><span>Gel for Colibow&rsquo;s Gibson</span></h3><p class="c3"><span>6 ul SYBRsafe in 20 ml agar 1%, with 1 kb ladder.</span></p><p class="c3"><span>The sample consisted in 10 ul of Gibson product and 2 ul of LD.</span></p><p class="c3"><span>Unfortunately the comb for making the wells went through the gel, resulting in loss of the sample.</span></p><h2 class="c2"><span>Electroporation of Pir116 E. coli with newly assembly pColibow</span></h2><ul class="c23 lst-kix_fvtbvecp8is-0 start"><li class="c3 c13"><span>Dialyse of the assembly product during 20 min. 5 ul were deposed and 5 ul were taken back.</span></li><li class="c3 c13"><span>Mixed with already tested Pir116 Electrocompetent cells</span></li><li class="c3 c13"><span>Program Ec2, bacterial, in 2 mm cuvette. Pulse time: 4.7 ms.</span></li><li class="c3 c13"><span>Incubation 1h @37</span></li><li class="c3 c13"><span>Plating on &ldquo;pColibow Gibson&rdquo; plates (K50 but K20 written on the box). 100 ul on the first box, centrifuged 900 ul on the second one.</span></li><li class="c3 c13"><span>Incubation overnight @37.</span></li></ul>
+== Advancement on ''E. coli'' ==
-<span>Advancement on <i>S. cerevisiae</i></span></h1><p class="c19"><span>The goal is to pursue the work of Matt for implementation of brainbow on yeast.</span></p><ul class="c5 lst-kix_o6jjthgo1p1d-0 start"><li class="c19 c28"><span>For us, it means that we demonstrate that the brainbow system can be set up on yeast, therefore the whole system that we construct on E. coli could in principle work on S. cerevisiae too.</span></li><li class="c19 c28"><span>It also has application in microscopy, helping people to better distinguish different cells on microfluidic chips. This is not related to our project but it&rsquo;s a decent bonus.</span></li></ul><p class="c7"><span></span></p><p class="c19"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 602.00px; height: 598.50px;"><img alt="Yeastbow Cloning.png" src="images/image03.png" style="width: 602.00px; height: 598.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c7"><span></span></p><h1 class="c14"><span>Summary of what should work:</span></h1><p class="c19"><span class="c17">Amplify Brainbow 1.0 with </span></p><p class="c19"><span>B1 Brain1 F: </span><span class="c16">CTAGCGAGCTCATAACTTCGTA</span><span>&nbsp;</span><span class="c2">(not F+) </span><span class="c17">o15.76</span></p><p class="c19"><span>B1 Brain1 R+: AATTCGCTTATTTAGAAGTG</span><span class="c16">cttcgcgcgtgatctagag </span><span class="c17">o15.75</span></p><p class="c7"><span class="c16"></span></p><p class="c19"><span class="c17">Amplify Ura vector with</span></p><p class="c19"><span>B1 Ura F+: ctctagatcacgcgcgaag</span><span class="c16">CACTTCTAAATAAGCGAATTTCTTATG </span><span class="c17">o15.74</span></p><p class="c19"><span>B1 Ura R: </span><span class="c16">TGGATGGCGGCGTTAGTATC </span><span class="c17">o15.77</span></p><p class="c7"><span></span></p><p class="c19"><span class="c17">Amplify annealed products with</span></p><p class="c19"><span>Leu2 Brain1 F: AGCAATATATATATATATATTTCAAGGATATACCATTCTA</span><span class="c16">ACTAGCGAGCTCATAACTTCGT </span><span class="c17">o15.78</span></p><p class="c19"><span>Leu2 Brain1 R:</span></p><p class="c19"><span>TAAAGTTTATGTACAAATATCATAAAAAAAGAGAATCTTTC</span><span class="c16">TGGATGGCGGCGTTAGTAT</span></p><p class="c19"><span class="c17">o15.79</span></p><p class="c7"><span class="c16"></span></p><p class="c19"><span class="c2">Works on snapgene, product size = 5692</span><span class="c16">&nbsp;</span><span class="c2">bp</span></p><p class="c7"><span class="c2 c38"></span></p><p class="c19"><span class="c38 c2">Problem: </span><span class="c38">plasmid Ura not available, plasmid pThy not found.</span></p><h1 class="c14"><span>Advancement</span></h1><p class="c19"><span>Design oligos </span><span class="c27 c17">Done</span></p><p class="c19"><span>Oligo checking by Matt </span><span class="c27 c17">Done</span></p><p class="c19"><span>Order oligos &ldquo;+&rdquo; </span><span class="c27 c17">Done</span></p><p class="c19"><span>Obtain previous oligos </span><span class="c27 c17">Ordered</span></p><p class="c19"><span>Obtain S. cerevisiae strain from Zoran </span><span class="c27 c17">Done</span></p><p class="c19"><span>Plate Zoran&rsquo;s strain </span><span class="c27 c17">Done</span></p><p class="c19"><span>Grow </span><span class="c27 c17">Done</span></p><p class="c19"><span>Freeze @ -80 </span></p><p class="c19"><span>Overnight culture of pThy 1.0 strain</span></p><p class="c19"><span>Obtain</span><span>&nbsp;pUra3 plasmid </span><span class="c27 c17">Done</span></p><p class="c19"><span>Miniprep pThy 1.0 plasmid </span><span class="c27 c17">Done</span></p><p class="c7"><span class="c27 c17"></span></p><p class="c19"><span>PCR with SOE tails of pThy1.0 </span><span class="c27 c17">Done</span></p><p class="c19"><span>PCR with SOE tails of pUra3 </span><span class="c27 c17">Done</span></p><p class="c7"><span class="c27 c17"></span></p><p class="c19"><span>PCR cleanup </span><span class="c27 c17">Done</span></p><p class="c19"><span>Splicing by Overlap Extension </span><span class="c27 c17">Failed</span></p><p class="c19"><span>Gel for size checking</span></p><p class="c19"><span>Gel extraction</span></p><p class="c19"><span>Receive primers 78 and 79 </span><span class="c17 c27">Done</span></p><p class="c19"><span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span class="c2">They are supposed to be delivered but can&rsquo;t be found anywhere</span></p><p class="c19"><span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span class="c2">Couldn&rsquo;t contact IDT by phone</span></p><p class="c19"><span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span class="c2">Contacted IDT by e-mail, waiting for an answer</span></p><p class="c19"><span>PCR with flanking homology regions</span></p><p class="c7"><span></span></p><p class="c19"><span>Overnight culture of CRE yeast + WT yeast </span></p><p class="c19"><span>Competent cells out of the three yeasts </span><span class="c27 c17">Not necessary</span></p><p class="c7"><span></span></p><p class="c19"><span>Transformation of yPH150, yPH151 and wild-type S. cer. for safe replication of the cassette.</span></p><p class="c7"><span></span></p><h1 class="c8"><span>Wednesday 07/15</span></h1><p class="c8"><span>Started to work on the packaging experiments for yeast.</span></p><p class="c8"><span>Innoculation of S. cerevisiae BY4743 mCherry</span></p><p class="c8"><span>Medium: 100 ml YPD with 400 ul Gentamycine (four 25 ml tubes)</span></p><p class="c19"><span>Culture @ 30&deg;C + Shaking</span></p><h1 class="c8"><span>Friday 07/17</span></h1><p class="c8"><span>Checked the yeast megaculture: growth is okay, but let&rsquo;s wait for a third day to have more biomass.</span></p><p class="c7"><span></span></p><p class="c19"><span>Designed and ordered a lot of oligos for Yeastbow and Colibow projects.</span></p><h1 class="c8"><span>Saturday 07/18</span></h1><h2 class="c8"><span>Manufacturing experiment, part 1.</span></h2><p class="c8"><span>A strain of Yeast expressing mCherry was grown during three days at 30&deg;C in 100 ml YPD.</span></p><p class="c8"><span>In order to remove as much medium as possible, it was centrifuged at 4000 G during 5 min, twice, while discarding the supernatant each time.</span></p><p class="c7"><span></span></p><p class="c8"><span>Different conditions of drying were attempted:</span></p><ul class="c5 lst-kix_2iogormodcyh-0 start"><li class="c1"><span>In the tube, at the sun during 30 min (Tube1). This one was not completely dry when packaged.</span></li><li class="c1"><span>Spread on tinfoil (Gratt&eacute;e)</span></li><li class="c1"><span>Put on tinfoil without spreading (Air libre)</span></li><li class="c1"><span>Put on tinfoil and covered with a plastic plate (Bo&icirc;te)</span></li><li class="c1"><span>Leftover in the tube (Tube2)</span></li></ul><p class="c8"><span>After drying these samples were packaged in paper bags and preserved in the fridge.</span></p><h1 class="c8"><span>Monday 07/20</span></h1><p class="c8"><span>Received oligos o15.74 and o15.75. They&rsquo;re meant to amplify the Yeastbow source plasmids.</span></p><p class="c7"><span></span></p><p class="c19"><span>Prepared 9 YPD agar plates.</span></p><h2 class="c8"><span>Manufacturing experiment, part 2.</span></h2><p class="c8"><span>For each drying protocol, one sample was taken out of the fridge.</span></p><p class="c8"><span>They were weighted, transferred in eppendorf tubes and ~1ml of LB was added (YPD not available at that time).</span></p><p class="c8"><span>The &laquo; tube 1 &raquo; sample was not dry enough so a lot of it sticked to the package.</span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c23" colspan="1" rowspan="1"><p class="c18"><span class="c4">ID</span></p></td><td class="c46" colspan="1" rowspan="1"><p class="c18"><span class="c4">Bo&icirc;te 2</span></p></td><td class="c23" colspan="1" rowspan="1"><p class="c18"><span class="c4">Tube 1</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c18"><span class="c4">Air libre 1</span></p></td><td class="c56" colspan="1" rowspan="1"><p class="c18"><span class="c4">Gratt&eacute;e 1</span></p></td></tr><tr class="c12"><td class="c23" colspan="1" rowspan="1"><p class="c18"><span class="c4">Weight</span></p></td><td class="c46" colspan="1" rowspan="1"><p class="c18"><span class="c4">12 mg</span></p></td><td class="c23" colspan="1" rowspan="1"><p class="c18"><span class="c4">4.5 mg</span></p></td><td class="c51" colspan="1" rowspan="1"><p class="c18"><span class="c4">9.2 mg</span></p></td><td class="c56" colspan="1" rowspan="1"><p class="c18"><span class="c4">1.3 mg</span></p></td></tr></tbody></table><p class="c7"><span></span></p><p class="c8"><span>This was then moved to YPD-agar plates and spread with sterile beads.</span></p><p class="c8"><span>The plates were cultured at 30&deg;C overnight for colony counting.</span></p><h1 class="c8"><span>Thursday 07/16</span></h1><p class="c8"><span>Ordered two new oligos for Yeastbow cloning: o15.74 and o15.75</span></p><p class="c7"><span></span></p><p class="c8"><span>Yeast megaculture for wednesday: A little cell pellet is visible at the bottom.</span></p><p class="c8"><span>-&gt; Titled the flasks so they&rsquo;re shaked better.</span></p><p class="c7"><span></span></p><p class="c8"><span>Obtained two yeast strains that express CRE recombinase from Zoran, overnight at 30.</span></p><p class="c7"><span></span></p><p class="c8"><span>Designed and ordered new primers for yeastbow PCRs, based on Matt&rsquo;s advice.</span></p><p class="c8"><span>It was very difficult to find a good priming region since this seems to be in a terminator.</span></p><h1 class="c14 c48"><span>Monday 07/20</span></h1><h2 class="c8"><span>Reception of pBrainbow 1.0 and 3.0 propogators as glycerol stocks</span></h2><p class="c8"><span>Templates for PCR assembly of Yeastbow. Still need primers.</span></p><p class="c8"><span>-&gt; Overnight culture for miniprep for PCR</span></p><ul class="c5 lst-kix_2whtaerqckh9-0 start"><li class="c19 c28"><span>pThy Brainbow 1.0</span></li></ul><h2 class="c8"><span>Reception of oligos o15.74 and o 15.75</span></h2><p class="c8"><span>For yeastbow first round of PCRs.</span></p><p class="c19"><span>Reconstitution in dH2O, in the bottom drawer of the -20.</span></p><h2 class="c8"><span>Reception of pBrainbow URA3 for Yeastbow</span></h2><p class="c8"><span>From Zack at Hersen lab.</span></p><p class="c8"><span>It carries an AmpR.</span></p><p class="c8"><span>Use 1 ul as a template for the PCR, and if it doesn&rsquo;t work transform the rest into E. coli for propagation.</span></p><p class="c19"><span>Stored in Barth&rsquo;s styrofoam box.</span></p><h1 class="c8"><span>Tuesday 07/21</span></h1><p class="c7"><span class="c49"></span></p><h2 class="c8"><span>Results for the preliminary manufacturing experiment</span></h2><p class="c8"><span>We get a lot of background. It&rsquo;s almost sure that it is yeast, but no mCherry could be detected. The plasmid was likely lost due to the absence of antibiotics in the plating media.</span></p><p class="c6"><span>It&rsquo;s important to dilute before plating to know the number of colonies per mg.</span></p><p class="c8"><span>All the plates are covered in yeast, even the less successful ones.</span></p><h2 class="c8"><span class="c2">Reception of oligos</span><span>&nbsp;</span><span class="c2">o15.76 to o15.96</span></h2><ul class="c5 lst-kix_qhyej9eimh32-0 start"><li class="c1"><span>Yeastbow SOE</span></li><li class="c1"><span>R6K linearization</span></li><li class="c1"><span>Colibow gBlock Amp</span></li><li class="c1"><span>Colibow Sequencing</span></li></ul><p class="c8"><span>The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.</span></p><p class="c7"><span></span></p><p class="c8"><span>-&gt; Oligo reconstitution and dilution</span></p><p class="c8"><span>-&gt; Miniprep of R6K vector</span></p><p class="c8"><span>-&gt; PCR of R6K vector</span></p><p class="c8"><span>-&gt; Miniprep of pBrainbow 1.0</span></p><p class="c8"><span>-&gt; PCR of pBrainbow 1.0</span></p><p class="c8"><span>-&gt; PCR of pThy Ura3</span></p><p class="c7"><span></span></p><p class="c19"><span>Reconstituted all primers to 100 ug/ml.</span></p><h2 class="c8"><span>Miniprep of pR6K and pBrainbow 1.0</span></h2><p class="c8"><span>For PCR, using Promega kit w/ double wash. Elution in 30 ul</span></p><p class="c19"><span>Final concentration: 93 ng/ul</span></p><h1 class="c14"><span>PCR pURA3</span></h1><ul class="c5 lst-kix_4e6kcnpx3uyh-0 start"><li class="c6 c28"><span>1 ul template</span></li><li class="c6 c28"><span>1 ul of each primer</span></li><li class="c6 c28"><span>25 ul of Phusion master mix</span></li><li class="c19 c28"><span>22 ul of dH2O</span></li></ul><p class="c19"><span class="c2">Template: </span><span>pKT174 plasmid (AmpR).</span></p><p class="c19"><span>We have ~5 ul * 2, for a total amount of 1 ug.</span></p><p class="c19"><span>Use 1 ul for 1 PCR, then if needed transform the rest in E. coli for propagation.</span></p><p class="c7"><span></span></p><p class="c19"><span class="c2">Primers:</span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c41" colspan="1" rowspan="1"><p class="c9"><span class="c4">URA F+</span></p></td><td class="c41" colspan="1" rowspan="1"><p class="c9"><span class="c4">o15.74</span></p></td><td class="c41" colspan="1" rowspan="1"><p class="c9"><span class="c4">56&deg;</span></p></td></tr><tr class="c12"><td class="c41" colspan="1" rowspan="1"><p class="c9"><span class="c4">URA R</span></p></td><td class="c41" colspan="1" rowspan="1"><p class="c9"><span class="c4">o15.77</span></p></td><td class="c41" colspan="1" rowspan="1"><p class="c9"><span class="c4">58&deg;</span></p></td></tr></tbody></table><p class="c7"><span></span></p><p class="c7"><span></span></p><p class="c19"><span class="c2">Polymerase: </span><span>Phusion in the form of 2x mix.</span></p><p class="c7"><span></span></p><p class="c19"><span class="c2">Program: (saved as &ldquo;Phusion&rdquo;)</span></p><p class="c19"><span>98 (30s)</span></p><p class="c19"><span>98 (10s) 50 (25s) 72 (1 min) x 25</span></p><p class="c19"><span>72 (8 min)</span></p><p class="c19"><span>4&deg; hold</span></p><p class="c7"><span></span></p><p class="c19"><span>Lasts 1h30, product size = 1684 bp</span></p><p class="c7"><span></span></p><h1 class="c14"><span>Miniprep of the pThy1.0 plasmid</span></h1><p class="c19"><span>With promega kit.</span></p><p class="c19"><span>Recovery in 30 ul.</span></p><p class="c7"><span></span></p><h1 class="c14"><span>Preparation of Agarose 1% TAE</span></h1><p class="c19"><span>Kept at 55&deg;C in the broken incubator.</span></p><h1 class="c14"><span>PCR of pThy1.0 cassette</span></h1><ul class="c5 lst-kix_cgxexnhdo0b7-0 start"><li class="c6 c28"><span>1 ul template</span></li><li class="c6 c28"><span>1 ul of each primer</span></li><li class="c6 c28"><span>25 ul of Phusion master mix</span></li><li class="c6 c28"><span>22 ul of dH2O</span></li></ul><p class="c7"><span></span></p><p class="c6"><span class="c17">Template: </span><span>pThy1.0 (1 ul = 93 ng)</span></p><p class="c7"><span></span></p><p class="c6"><span class="c17">Primers:</span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c58"><td class="c50" colspan="1" rowspan="1"><p class="c32 c19"><span class="c4">B1 Brain1 F</span></p></td><td class="c52" colspan="1" rowspan="1"><p class="c32 c19"><span class="c4">o15.76</span></p></td><td class="c34" colspan="1" rowspan="1"><p class="c32 c19"><span class="c4">55&deg;</span></p></td></tr><tr class="c57"><td class="c50" colspan="1" rowspan="1"><p class="c19 c32"><span class="c4">B1 Brain1 R+</span></p></td><td class="c52" colspan="1" rowspan="1"><p class="c32 c19"><span class="c4">o15.75</span></p></td><td class="c34" colspan="1" rowspan="1"><p class="c32 c19"><span class="c4">58&deg;</span></p></td></tr></tbody></table><p class="c7"><span></span></p><p class="c8"><span class="c17">Program: </span><span>(modified from Phusion)</span></p><p class="c6"><span>98 (30s)</span></p><p class="c6"><span>98 (10s) 50 (25s) 72 (2&rsquo;45&rsquo;&rsquo;) x 25</span></p><p class="c6"><span>72 (8 min)</span></p><p class="c6"><span>4&deg; hold</span></p><p class="c7"><span></span></p><p class="c19"><span class="c17">Expected size: </span><span>3965 bp</span></p><h1 class="c14"><span>Wednesday 07/22</span></h1><p class="c19"><span class="c2">Gel for product size checking, in that order:</span></p><ul class="c5 lst-kix_3x5ze4mkk4cr-0 start"><li class="c19 c28"><span>Generuler 1 kb+</span></li><li class="c19 c28"><span>PCR Thy1.0 -&gt; 3965 bp</span></li><li class="c19 c28"><span>PCR Ura3 -&gt; 1684 bp</span></li></ul><p class="c7"><span></span></p><p class="c19"><span>Results:</span></p><ul class="c5 lst-kix_dg3f74s1jgb1-0 start"><li class="c19 c28"><span>PCR Thy1.0 is ~ 4000</span></li><li class="c19 c28"><span>PCR Ura3 is ~ 1700</span></li></ul><p class="c19"><span class="c17">It worked!</span></p><p class="c7"><span></span></p><p class="c19"><span class="c2">PCR purification</span></p><p class="c19"><span>Using the kit.</span></p><p class="c19"><span>Titration: </span></p><p class="c6"><span class="c17">PCR Thy1.0:</span><span>&nbsp;32 ng/ul</span></p><p class="c19"><span class="c17">PCR Ura3:</span><span>&nbsp;47 ng/ul</span></p><p class="c7"><span></span></p><p class="c19"><span class="c2">Overlap PCR</span></p><ol class="c5 lst-kix_mrsclx12ut61-0 start" start="1"><li class="c6 c28"><span>Equimolar amounts of purified fragments</span></li></ol><p class="c6 c29"><span>Required volumic ratio Thy/Ura = (47 / 1684) / (32 / 3965) = 3.46</span></p><p class="c7 c29"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c21" colspan="1" rowspan="1"><p class="c18"><span class="c4">PCR Thy1.0</span></p></td><td class="c3" colspan="1" rowspan="1"><p class="c18"><span class="c4">17 ul</span></p></td></tr><tr class="c12"><td class="c21" colspan="1" rowspan="1"><p class="c18"><span class="c4">PCR Ura3</span></p></td><td class="c3" colspan="1" rowspan="1"><p class="c18"><span class="c4">5 ul</span></p></td></tr><tr class="c12"><td class="c21" colspan="1" rowspan="1"><p class="c18"><span class="c4">Water</span></p></td><td class="c3" colspan="1" rowspan="1"><p class="c18"><span class="c4">3 ul</span></p></td></tr><tr class="c12"><td class="c21" colspan="1" rowspan="1"><p class="c18"><span class="c4">Phusion master mix</span></p></td><td class="c3" colspan="1" rowspan="1"><p class="c18"><span class="c4">25 ul</span></p></td></tr></tbody></table><p class="c7 c29"><span></span></p><ol class="c5 lst-kix_oe8j437qbrn7-0 start" start="1"><li class="c6 c28"><span>Do not add any primers; the templates will prime each-other.</span></li><li class="c6 c28"><span>Run 5 PCR cycles without primers. Predicted annealing temperature ~ 61&deg;C. Use 57&deg; as an annealing temperature and 2&rsquo;45&rsquo;&rsquo; of elongation time.</span></li><li class="c6 c28"><span>Add primers directly to the mix.</span></li></ol><p class="c6 c29"><span class="c17">B1 Brain1 F </span><span>(o15.76) 55&deg;C</span></p><p class="c6 c29"><span class="c17">Ura R </span><span>(o15.77) 58&deg;C</span></p><p class="c6 c29"><span>1 ul each, directly into the PCR product.</span></p><p class="c7 c29"><span></span></p><p class="c6 c29"><span>Expected product size: 5610 bp</span></p><h1 class="c14"><span>Wednesday 07/23</span></h1><h2 class="c8"><span>Gel for SOE yeastbow assembly</span></h2><p class="c8"><span>1% agar TAE, with 1 kb+ generuler.</span></p><p class="c8"><span>30 ul of product + 6 ul loading dye were loaded for gel extraction.</span></p><ul class="c5 lst-kix_qo8tv2hi5v59-0 start"><li class="c1"><span>Smear at very large sizes</span></li><li class="c1"><span>Band at ~1600, probably from Ura3 PCR</span></li><li class="c1"><span>No visible band at ~6000 bp</span></li></ul><p class="c19"><span>The SOE didn&rsquo;t work, so nothing was extracted.</span></p><h2 class="c8"><span>New attempt for SOE yeastbow assembly</span></h2><p class="c8"><span>The concentration of template was way too high.</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">PCR Thy1.0 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>6 ul</span></p><p class="c8"><span class="c17">PCR Ura3 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>2 ul</span></p><p class="c8"><span class="c17">Water</span><span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;14 ul</span></p><p class="c8"><span class="c17">Phusion mix&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>25 ul</span></p><p class="c8"><span class="c17">o15.76&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>2 ul</span></p><p class="c8"><span class="c17">o15.77&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>2 ul</span></p><p class="c7"><span></span></p><p class="c8"><span>&laquo; S+ &raquo; tube: Primers added from the beginning,</span></p><p class="c8"><span>&laquo; S &raquo; tube: Primers added only after 6 cycles.</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">Program</span></p><p class="c8"><span>98&deg; 30s</span></p><p class="c8"><span>98&deg; 15s, 50&deg; 25s, 72&deg; 4&rsquo;20&rsquo;&rsquo; [35 times] </span><span class="c36">-&gt; Shorter elongation time</span></p><p class="c8"><span>72&deg; 8 min</span></p><p class="c8"><span>4&deg; hold </span><span class="c36">-&gt; 12 next time</span></p><p class="c7"><span class="c36"></span></p><p class="c8"><span>Lid at 103&deg;. It takes about four hours to complete.</span></p><h1 class="c8"><span>Friday, 07/24</span></h1><h2 class="c8"><span>Reception of oligos o15.78 and o15.79</span></h2><p class="c8"><span>For flanking yeastbow with homology regions</span></p><p class="c8"><span>Reconstitution:</span></p><p class="c8"><span>4 nmol oligos + 40 ul eau = 0.1 nmol/ul = 100 mM</span></p><p class="c7"><span></span></p><h2 class="c8"><span>Gel for previous SOE (2nd attempt)</span></h2><p class="c7"><span class="c25 c17"></span></p><p class="c19"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 234.67px; height: 284.00px;"><img alt="Yeastbow SOE gel extraction Enhanced.jpg" src="images/image02.jpg" style="width: 234.67px; height: 284.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c8"><span>SOE&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SOE&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SOE+&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SOE+&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1kb+ marker</span></p><p class="c7"><span></span></p><p class="c8"><span>2 barely visible bands around 5600 bp in SOE+.</span></p><p class="c8"><span>It is not possible to know which one is the right one.</span></p><p class="c7"><span></span></p><h2 class="c8"><span>Gel extraction of 2 SOE+ bands</span></h2><p class="c8"><span>&ldquo;Grande&rdquo;</span></p><p class="c8"><span>&ldquo;Petite&rdquo;</span></p><p class="c7"><span></span></p><p class="c8"><span>Recovery in 30 ul EB</span></p><p class="c8"><span>Grande : 22.5 ng/ul</span></p><p class="c8"><span>Petite: 6.2 ng/ul</span></p><p class="c7"><span></span></p><h2 class="c8"><span>PCR of extracted product</span></h2><p class="c8"><span class="c17">Aim: </span><span>recover the tiny amount of DNA in the gel.</span></p><p class="c7"><span></span></p><p class="c8"><span>Template: SOE G or P after purification (29 ul)</span></p><p class="c8"><span>Primers: 76 and 77 (2 ul each)</span></p><p class="c8"><span>Phusion: 50 ul</span></p><p class="c8"><span>Water: 17 ul</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">Program:</span></p><p class="c8"><span>98 (30)</span></p><p class="c8"><span>98 (10), 54 (25), 72 (3&rsquo;20&rsquo;&rsquo;) -&gt; 36x</span></p><p class="c8"><span>72 (8&rsquo;00)</span></p><p class="c8"><span>12 (hold)</span></p><p class="c7"><span></span></p><p class="c8"><span>The increased annealing temperature (54 instead of 50) should lower the non-specific hybridation.</span></p><p class="c8"><span>This PCR takes ~ 3h30.</span></p><h1 class="c8"><span>Monday, 07/27</span></h1><h2 class="c8"><span>Gel for rescue PCR of extracted product</span></h2><p class="c8"><span>Agar 1% + TAE + SYBRsafe</span></p><p class="c8"><span>Laid 5 ul + 1 ul loading dye</span></p><p class="c8"><span class="c2">Order</span><span>: &laquo; Petite &raquo; - Marker 1kb+ - &laquo; Grande &raquo;</span></p><p class="c7"><span></span></p><p class="c8"><span class="c2">Results</span></p><p class="c8"><span>Did. Not. Work.</span></p><p class="c7"><span></span></p><h2 class="c8"><span>Thirld attempt at SOEing</span></h2><ul class="c5 lst-kix_1b2aayezpot4-0 start"><li class="c1"><span>Redo the PCRs with gel extraction this time -&gt; No smear in pThy1.0 product</span></li><li class="c1"><span>Try to Gibson assemble the two parts</span></li><li class="c1"><span>Try again the SOE with a higher annealing temperature</span></li></ul><p class="c7"><span></span></p><p class="c8"><span>New SOE:</span></p><p class="c8"><span class="c17">PCR Thy1.0 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>3 ul</span></p><p class="c8"><span class="c17">PCR Ura3 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>1 ul</span></p><p class="c8"><span class="c17">Water</span><span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;7 ul</span></p><p class="c8"><span class="c17">Phusion mix&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>12.5 ul</span></p><p class="c8"><span class="c17">o15.76&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>1 ul</span></p><p class="c8"><span class="c17">o15.77&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span>1 ul</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">Program</span></p><p class="c8"><span>98&deg; 30s</span></p><p class="c8"><span>98&deg; 20s, gradient 30s, 72&deg; 3&rsquo;10&rsquo;&rsquo; [35 times] (NEB calculator recommends 60&deg;C&hellip;)</span></p><p class="c8"><span>72&deg; 8 min</span></p><p class="c8"><span>12&deg; hold</span></p><p class="c7"><span></span></p><p class="c8"><span>Gradient: 56 to 62&deg;C (bottom to top).</span></p><p class="c7"><span></span></p><h2 class="c8"><span>New PCRs</span></h2><p class="c8"><span>Objective: Better quality of the SOE reagents, gel-extracted to get rid of the smear.</span></p><p class="c8"><span>Larger number of cycles.</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">Ura3 PCR</span></p><p class="c8"><span>pKT174&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1ul</span></p><p class="c8"><span>o15.74&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1ul</span></p><p class="c8"><span>o15.77&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1ul</span></p><p class="c8"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;22ul</span></p><p class="c8"><span>Phusion mix&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25ul</span></p><p class="c7"><span></span></p><p class="c8"><span>Program:</span></p><p class="c8"><span>98 (30)</span></p><p class="c8"><span>98 (10), 56 (25), 72 (1&rsquo;00) x35</span></p><p class="c8"><span>72 (8)</span></p><p class="c8"><span>12 (hold) -&gt; 1684 bp</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">Thy PCR</span></p><p class="c8"><span>pThy1.0&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1ul</span></p><p class="c8"><span>o15.75&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1ul</span></p><p class="c8"><span>o15.76&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1ul</span></p><p class="c8"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;22ul</span></p><p class="c8"><span>Phusion mix&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25ul</span></p><p class="c7"><span></span></p><p class="c8"><span>Program:</span></p><p class="c8"><span>98 (30)</span></p><p class="c8"><span>98 (10), 56 (25), 72 (1&rsquo;00) x35</span></p><p class="c8"><span>72 (8)</span></p><p class="c8"><span>12 (hold) -&gt; 3965 bp</span></p><h1 class="c14"><span>Tuesday 07/28</span></h1><h2 class="c8"><span>Gel extraction for PCR Ura, PCR Thy and SOE gradient PCR</span></h2><p class="c7"><span class="c25 c17"></span></p><p class="c8"><span>Agar 1%, SYBRsafe, TAE</span></p><p class="c7"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c15" colspan="1" rowspan="1"><p class="c18"><span class="c4">1</span></p></td><td class="c15" colspan="1" rowspan="1"><p class="c18"><span class="c4">1</span></p></td><td class="c44" colspan="1" rowspan="1"><p class="c18"><span class="c4">U</span></p></td><td class="c44" colspan="1" rowspan="1"><p class="c18"><span class="c4">U</span></p></td><td class="c53" colspan="1" rowspan="1"><p class="c18"><span class="c4">M</span></p></td><td class="c44" colspan="1" rowspan="1"><p class="c18"><span class="c4">A</span></p></td><td class="c44" colspan="1" rowspan="1"><p class="c18"><span class="c4">B</span></p></td><td class="c44" colspan="1" rowspan="1"><p class="c18"><span class="c4">C</span></p></td><td class="c44" colspan="1" rowspan="1"><p class="c18"><span class="c4">D</span></p></td><td class="c53" colspan="1" rowspan="1"><p class="c18"><span class="c4">M</span></p></td></tr></tbody></table><p class="c7"><span></span></p><p class="c8"><span>1: pThy pcr</span></p><p class="c8"><span>U: pUra3 pcr</span></p><p class="c8"><span>M: 1kb dna ladder</span></p><p class="c8"><span>A, B, C, D: gradient PCR for SOE</span></p><p class="c8"><span>It was at first run at 75 kV and then at 100 kV during 25 in total. The buffer in the tank was TBE, and as a result the gel was completely awful, with no possibility to read the size of the bands.</span></p><p class="c8"><span>The products were also lost.</span></p><p class="c7"><span></span></p><h2 class="c8"><span>New PCRs for Yeastbow</span></h2><p class="c7"><span class="c17 c25"></span></p><p class="c8"><span class="c17">PCR Thy1.0</span></p><p class="c8"><span>pThy1.0&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1 ul</span></p><p class="c8"><span>75&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5 ul</span></p><p class="c8"><span>76&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5 ul</span></p><p class="c8"><span>Phusion mix&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25 ul</span></p><p class="c8"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;19 ul</span></p><p class="c7"><span></span></p><p class="c8"><span>Program:</span></p><p class="c8"><span>98 (60)</span></p><p class="c8"><span>98 (10) 56 (30) 72 (120) x35</span></p><p class="c8"><span>72 (600)</span></p><p class="c8"><span>4 (hold)</span></p><p class="c7"><span></span></p><p class="c8"><span>Expected size: 3965. Should be over at about 18h30.</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">PCR Ura3</span></p><p class="c8"><span>pKT174&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1 ul</span></p><p class="c8"><span>74&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5 ul</span></p><p class="c8"><span>77&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5 ul</span></p><p class="c8"><span>Phusion&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25 ul</span></p><p class="c8"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;19 ul</span></p><p class="c7"><span></span></p><p class="c8"><span>Program:</span></p><p class="c8"><span>98 (60)</span></p><p class="c8"><span>98 (10) 56 (30) 72 (60) x35</span></p><p class="c8"><span>72 (600)</span></p><p class="c8"><span>12 (hold)</span></p><p class="c7"><span></span></p><p class="c8"><span>Expected size: 1684 bp.</span></p><h1 class="c14"><span>Wednesday 07/29</span></h1><h2 class="c8"><span>Gel for Yeastbow 1 and U and extraction</span></h2><p class="c8"><span>Agar 1%, SYBRsafe, TAE</span></p><p class="c7"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c31" colspan="1" rowspan="1"><p class="c18"><span class="c4">1kb ladder</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">1</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">1</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">U</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">U</span></p></td><td class="c31" colspan="1" rowspan="1"><p class="c18"><span class="c4">1kb ladder</span></p></td></tr><tr class="c12"><td class="c31" colspan="1" rowspan="1"><p class="c7 c40"><span class="c4"></span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">3965</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">3965</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">1684</span></p></td><td class="c10" colspan="1" rowspan="1"><p class="c18"><span class="c4">1684</span></p></td><td class="c31" colspan="1" rowspan="1"><p class="c7 c40"><span class="c4"></span></p></td></tr></tbody></table><p class="c7"><span></span></p><p class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 384.00px; height: 346.67px;"><img alt="PCR 1 and U extracted.jpg" src="images/image06.jpg" style="width: 384.00px; height: 346.67px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 193.33px; height: 348.00px;"><img alt="" src="images/image00.jpg" style="width: 193.33px; height: 348.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c8"><span>The PCR for U worked really well, but the PCR for 1 yielded an extremely low amount of DNA and a smear.</span></p><p class="c8"><span class="c27">-&gt; Decrease annealing temp</span></p><p class="c8"><span class="c27">-&gt; Increase extension time</span></p><p class="c7"><span class="c27"></span></p><p class="c8"><span class="c17">pcr Ura3: </span><span>41 ng/ul * 30 ul of EB</span></p><p class="c8"><span class="c17">pcr Thy1: </span><span>13 ng/ul * 30 ul of EB</span></p><p class="c7"><span></span></p><h2 class="c8"><span>New attempt at PCR Thy1, 29 july</span></h2><p class="c7"><span class="c25 c17"></span></p><p class="c8"><span class="c17">Mix</span></p><p class="c8"><span>Phusion&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25</span></p><p class="c8"><span>Thy&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1</span></p><p class="c8"><span>o15.75&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c8"><span>o15.76&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c8"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;19</span></p><p class="c8"><span>= Two tubes of 50 ul each -&gt; 3965 bp</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">Program</span></p><p class="c8"><span>98 (30)</span></p><p class="c8"><span>98 (20), 60 (20), 72 (3&rsquo;00&rsquo;)</span></p><p class="c8"><span>72 (5&rsquo;00)</span></p><p class="c8"><span>12 (hold)</span></p><p class="c7"><span></span></p><h2 class="c8"><span>New attempt at SOE, 29 july, with PCR products from 28 july</span></h2><p class="c8"><span class="c17">Mix</span></p><p class="c8"><span>Phusion&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;25</span></p><p class="c8"><span>PCR 1&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1</span></p><p class="c8"><span>PCR U&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1</span></p><p class="c8"><span>o15.76&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c8"><span>o15.77&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5</span></p><p class="c8"><span>Water&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;11</span></p><p class="c8"><span>= Two tubes of 50 ul each -&gt; 5610 bp</span></p><p class="c7"><span></span></p><p class="c8"><span class="c17">Program</span></p><p class="c8"><span>98 (30)</span></p><p class="c8"><span>98 (20), 60 (20), 72 (3&rsquo;00&rsquo;)</span></p><p class="c8"><span>72 (5&rsquo;00)</span></p><p class="c8"><span>12 (hold)</span></p><p class="c8"><span>(Along with PCR 1)</span></p><h1 class="c14"><span>Thursday, 07/30</span></h1><h2 class="c8"><span>Gel for SOE 29/07</span></h2><p class="c7"><span class="c25 c17"></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c26" colspan="1" rowspan="1"><p class="c18"><span class="c4">1 kb ladder</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c18"><span class="c4">SOE</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c18"><span class="c4">SOE</span></p></td><td class="c47" colspan="1" rowspan="1"><p class="c18"><span class="c4">SOE</span></p></td><td class="c26" colspan="1" rowspan="1"><p class="c18"><span class="c4">1 kb ladder</span></p></td><td class="c42" colspan="1" rowspan="1"><p class="c18"><span class="c4">*</span></p></td></tr></tbody></table><p class="c8"><span class="c17">Expected size:</span><span>&nbsp;5600 for all of them.</span></p><p class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 354.67px; height: 338.67px;"><img alt="SOE+29.07.jpg" src="images/image01.jpg" style="width: 354.67px; height: 338.67px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c8"><span>It didn&rsquo;t work at all. Try to Gibson-assemble them.</span></p><h1 class="c14"><span>Friday 07/31</span></h1><h2 class="c8"><span>Culture of pKT174 for freezing + miniprep</span></h2><p class="c8"><span>In 4 ml LB + 4 ul ampicilline, @37.</span></p><h1 class="c8"><span>Saturday, 8/1</span></h1><h2 class="c8"><span>The culture of pKT174 grew:</span></h2><ul class="c5 lst-kix_c57vljl8ne4p-0 start"><li class="c1"><span>Miniprep (not titrated for now)</span></li><li class="c1"><span>Glycerol stock @ -20</span></li></ul><h2 class="c14"><span>New strategy based on Gibson assembly</span></h2><p class="c19"><span>With minimal PCR steps. Low success rate, low mutation rate.</span></p><p class="c19"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 602.00px; height: 485.33px;"><img alt="yeastbow next assembly.png" src="images/image04.png" style="width: 602.00px; height: 485.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p><p class="c7"><span></span></p><ul class="c5 lst-kix_gv1b60b25w21-0 start"><li class="c19 c28"><span>Amplify pThy1.0 with o15.75 (58) and o15.78 (58) -&gt; 4006 bp</span></li><li class="c19 c28"><span>Amplify pUra3 with o15.74 (56) and o15.79 (56) -&gt; 1725 bp</span></li><li class="c19 c28"><span>Cleanup or extract (or try both)</span></li><li class="c19 c28"><span>Gibson assembly (39 bp overlap, Tm = 66&deg;C) -&gt; 5692 bp. Works on Snapgene (see Yeastbow Vector.dna)</span></li><li class="c19 c28"><span>Ready to go</span></li></ul><p class="c7"><span></span></p><p class="c19"><span class="c2">Method for PCR</span><span>: Jake&rsquo;s magic recipe.</span></p><p class="c7"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c37 c17">Reagent</span></p></td><td class="c45" colspan="2" rowspan="1"><p class="c11"><span class="c37 c17">Volume</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">&nbsp;</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c17 c37">1x</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c37 c17">10x</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">Nuclease-free water</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">71 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">710 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">5x Phusion HF Buffer</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">20 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">&nbsp;200 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">10 mM dNTPs</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">2 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">20 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">Forward Primer (10 uM)</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">1 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">10 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">Reverse Primer (10 uM)</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">1 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">10 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">Template</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">1 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">10 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">DMSO</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">3 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">30 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c24">Phusion DNA Polymerase</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">1 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">&nbsp;10 ul</span></p></td></tr><tr class="c12"><td class="c30" colspan="1" rowspan="1"><p class="c11"><span class="c37 c17">Total Volume</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">100 ul</span></p></td><td class="c13" colspan="1" rowspan="1"><p class="c11"><span class="c24">1000 ul</span></p></td></tr></tbody></table><p class="c7"><span></span></p><p class="c19"><span class="c17">Thermocycler Protocol: NEB Phusion</span><span>&nbsp;</span></p><p class="c19"><span>98 (30)</span></p><p class="c19"><span>98 (10) 52 (30) 72 (30/kb) *35</span></p><p class="c19"><span>72 (5&rsquo;)</span></p><p class="c19"><span>10 (forever)</span></p><p class="c7"><span></span></p><h3 class="c8"><span>Gel</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 189.33px; height: 412.00px;"><img alt="08.01 Yeastbow New Method PCRs.png" src="images/image05.png" style="width: 189.33px; height: 412.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></h3><p class="c8"><span>L&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;M&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;L&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;R&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;M&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;R</span></p><p class="c8"><span>2.5 ul sample + 0.5 LD</span></p><p class="c8"><span>Marker: 1 kb</span></p><p class="c7"><span></span></p><p class="c8"><span>Both of the PCR worked quite well, the products are of the right size and there is no significant alien band.</span></p><p class="c7"><span></span></p><p class="c8"><span>-&gt; PCR purification with the QIAGEN kit</span></p><p class="c8"><span>Recovery in 40 ul of water.</span></p><p class="c7"><span></span></p><h3 class="c8"><span>Titration</span></h3><p class="c8"><span>Yeastbow R: 300 ng/ul (1725 bp)</span></p><p class="c8"><span>Yeastbow L: 155 ng/ul (4006 bp)</span></p><h1 class="c14 c48"><span>Monday 08/03</span></h1><h2 class="c8"><span>Gibson assembly of yeastbow</span></h2><p class="c8"><span>On ice: 15 ul master mix + 5 ul DNA, incubate at 50&deg; for 1 hour.</span></p><p class="c8"><span>Number of ng = pmols * bp * 0.65</span></p><p class="c7"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c43" colspan="1" rowspan="1"><p class="c18"><span class="c4">Fragment</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c18"><span class="c4">ul</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c18"><span class="c4">pmol</span></p></td></tr><tr class="c12"><td class="c43" colspan="1" rowspan="1"><p class="c18"><span class="c4">Yeastbow R</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c18"><span class="c4">0.9</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c18"><span class="c4">0.24</span></p></td></tr><tr class="c12"><td class="c43" colspan="1" rowspan="1"><p class="c18"><span class="c4">Yeastbow R</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c18"><span class="c4">4.1</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c18"><span class="c4">0.24</span></p></td></tr><tr class="c12"><td class="c43" colspan="1" rowspan="1"><p class="c18"><span class="c4">Gibson master mix</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c18"><span class="c4">15 ul</span></p></td><td class="c22" colspan="1" rowspan="1"><p class="c7 c40"><span class="c4"></span></p></td></tr></tbody></table><p class="c7"><span></span></p><h1 class="c8"><span>Tuesday 8/4</span></h1><h3 class="c8"><span>Transformation of yeastbow in the CRE strains</span></h3><p class="c8"><span>Culture in 50 ml 2x YPD.</span></p><p class="c8"><span class="c17">Problem: According to Matt these strains already have Ura3. It is not possible to transform yeastbow in them.</span></p><p class="c8"><span class="c17">-&gt; </span><span>Transform the yeastbow in Ura- S. cerevisiae strains and add the CRE later (maybe by taking it from the yPH150/151)</span></p><p class="c7"><span></span></p><p class="c8"><span>Thanks to the fluorescence of the transformant, we attempted to transform the yeastbow cassette and select cells with mere fluorescence.</span></p><p class="c8"><span>However, while in the process of doing the transformation, the centrifuge got stuck with my samples inside. I gave up at that point.</span></p><h3 class="c8"><span>Freezer stocks of yPH150 and yPH151</span></h3><p class="c8"><span>500 ul glycerol 50% and 500 ul overnight culture.</span></p><p class="c8"><span>Numbers 15.54 and 15.55 resp.</span></p><h3 class="c8"><span>Yeastbow strikes back</span></h3><p class="c8"><span>CRE yeast strains we have:</span></p><ul class="c5 lst-kix_6tlnrvgatmei-0 start"><li class="c1"><span>yPH150: CRE under the Ura3 promoter (const)</span></li><li class="c1"><span>yPH151: CRE under the Stl1 promoter (inducible)</span></li></ul><p class="c8"><span>These strains are based on BY4743. Both of them are auxotrophic for His, Leu and Lys, but no longer for Ura (as it was used for CRE transformation!)</span></p><p class="c8"><span>All the work previously done on yeastbow is therefore useless, and it&rsquo;s necessary to start over with His3 as a selection marker.</span></p><p class="c7"><span></span></p><p class="c8"><span>The Leu2 integration tails are correct, even if the Leu2 ORF has been destroyed.</span></p><p class="c7"><span></span></p><p class="c8"><span>Available plasmids with resistance:</span></p><p class="c8"><span>pYMC32, pFA6, pPH75 from euroscarf toolbox. The names might not be correct.</span></p><p class="c7"><span></span></p><p class="c8"><span>For new primers were designed and ordered:</span></p><p class="c7"><span></span></p><p class="c6"><span class="c17">Amplify pThy1.0 with these primers:</span></p><p class="c6"><span class="c17">o15.160 </span><span class="c39">GCAATATATATATATATATTTCAAGGATATACCATTCTA</span><span class="c39 c16">ACTAGCGAGCTCATAACTTCG (Tm=58, specific)</span></p><p class="c6"><span class="c17">o15.161 </span><span class="c39">GCTTATTTAGAAGTGGCGCG</span><span class="c39 c16">gacctctgcagaggaaggac (Tm=58, may hairpin but not likely, may dimerize, specific)</span></p><p class="c6"><span>Product size: 4066 bp</span></p><p class="c7"><span></span></p><p class="c6"><span class="c17">Amplify pFA6-His3 with these primers:</span></p><p class="c6"><span class="c17">o15.162 </span><span class="c39">gtccttcctctgcagaggtc</span><span class="c16 c39">CGCGCCACTTCTAAATAAGC (may hairpin, may dimerize, specific) (Tm=56)</span></p><p class="c6"><span class="c17">o15.163 </span><span class="c39">AAGTTTATGTACAAATATCATAAAAAAAGAGAATCTTTC</span><span class="c39 c16">CTGGATGGCGGCGTTAGTATC (Tm=59, specific)</span></p><p class="c6"><span>Product size: 1614 bp</span></p><p class="c6"><span class="c17">Gibson assembly</span></p><p class="c6"><span>Overlap: 40 bp, Tm = 70&deg;C</span></p><p class="c6"><span>Product size: 5640 bp</span></p><h1 class="c14"><span>Monday, 08/10</span></h1><h2 class="c14"><span>Received plasmids and primers for Yeastbow</span></h2><h3 class="c14"><span>Plan with SOE:</span></h3><p class="c7"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Forward</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Reverse</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Template</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">PCR type</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Tm</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Extension Time</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Product size</span></p></td></tr><tr class="c12"><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">BB1F</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">BB1R</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">pThy1-Brainbow1.0</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Phusion</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">60</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">2&rsquo;</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">3965</span></p></td></tr><tr class="c12"><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">His3F</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">His3R</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">pPH21 or PH75</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Phusion</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">60</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">1&rsquo;</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">1532</span></p></td></tr><tr class="c12"><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Pho85F</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">Pho85R</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">PCR1 and 2</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">SOE</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">60</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">3&rsquo;</span></p></td><td class="c0" colspan="1" rowspan="1"><p class="c9"><span class="c4">5457</span></p></td></tr></tbody></table><h3 class="c14"><span>Alternative setup</span></h3><p class="c19"><span>What do we have?</span></p><ul class="c5 lst-kix_4nbym8mjobrw-0 start"><li class="c19 c28"><span>One brainbow plasmid: pThy1.0</span></li><li class="c19 c28"><span>One His3 resistance plasmid: pPH21</span></li><li class="c19 c28"><span>Two border primers without tails (not used here)</span></li><li class="c19 c28"><span>Two sets of central Gibson assembly primers: 161+162 or BB1R+His3F</span></li><li class="c19 c28"><span>Two sets of integration tails: Pho85F+Pho85R or 160+163</span></li></ul><p class="c19"><span>Every four combinations of central primers and integration tails were used separately.</span></p><h3 class="c14"><span>Master mix for both PCRs</span></h3><p class="c7"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">Name</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">1x</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">5x</span></p></td></tr><tr class="c12"><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">Water</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">40</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">200</span></p></td></tr><tr class="c12"><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">Phusion Master Mix</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">50</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">250</span></p></td></tr><tr class="c12"><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">DMSO</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">3</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">15</span></p></td></tr><tr class="c12"><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">Template</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">1</span></p></td><td class="c33" colspan="1" rowspan="1"><p class="c9"><span class="c4">5</span></p></td></tr></tbody></table><p class="c7"><span></span></p><h3 class="c14"><span>1.0 PCR</span></h3><p class="c19"><span>Mix:</span></p><p class="c19"><span>2 ul of each primers. In that order:</span></p><p class="c19"><span class="c17">PB: </span><span>PhoF + BB1 R</span></p><p class="c19"><span class="c17">1B: </span><span>160 + BB1 R</span></p><p class="c19"><span class="c17">P1: </span><span>PhoF + 161</span></p><p class="c19"><span class="c17">11: </span><span>160 + 161</span></p><p class="c7"><span></span></p><p class="c19"><span>Expected result:</span></p><p class="c19"><span>~4066 bp</span></p><p class="c7"><span></span></p><p class="c19"><span>Program (as seen in previous working Yeastbow assembly):</span></p><p class="c19"><span>98 (30)</span></p><p class="c19"><span>98 (10) 52 (30) 72 (3&rsquo;00) x35</span></p><p class="c19"><span>75 (5)</span></p><h3 class="c14"><span>pPH21 PCR</span></h3><p class="c19"><span>Mix:</span></p><p class="c19"><span>2 ul of each primers. In that order:</span></p><p class="c19"><span class="c17">HP: </span><span>His3F + PhoR</span></p><p class="c19"><span class="c17">1P: </span><span>162 + PhoR</span></p><p class="c19"><span class="c17">H1: </span><span>His3F + 163</span></p><p class="c19"><span class="c17">11: </span><span>162 + 163</span></p><p class="c7"><span></span></p><p class="c19"><span>Expected result:</span></p><p class="c19"><span>~1614 bp</span></p><p class="c7"><span></span></p><p class="c19"><span>Program (as seen in previous working Yeastbow assembly):</span></p><p class="c19"><span>98 (30)</span></p><p class="c19"><span>98 (10) 52 (30) 72 (2&rsquo;00) x35</span></p><p class="c19"><span>75 (5)</span></p><p class="c7"><span></span></p><p class="c19"><span>The tubes for this one are marked with a blue spot on the hinge of the PCR tube.</span></p><h3 class="c14"><span>Gel for both of these PCR</span></h3><p class="c7"><span></span></p><table cellpadding="0" cellspacing="0" class="c35"><tbody><tr class="c12"><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">1kb</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">PB</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">1B</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">P1</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">11</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">1kb</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">HP</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">1P</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">H1</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">11</span></p></td><td class="c20" colspan="1" rowspan="1"><p class="c9"><span class="c4">1kb</span></p></td></tr></tbody></table><p class="c7"><span></span></p>
+The whole brainbow system will be integrated chromosomally at the GalK site. It will be synthesized as three gBlocks.
+It should allow expression of mCherry first, then upon expression of the CRE recombinase, differentiation in two states (YFP and CFP).
+It also contains a landing pad that allow insertion of a third state, which would subsequently lower the probability of states 1 and 2 so the three outcomes are possible.
+=== Writing the artificial gene ===
+Promoter J23199 from the Biobrick collection
+LoxP sites used together in mammalian brainbow plasmids
+RBS from Ihab
+ORF for mCerulean and mVenus from Ihab
+ORF for mCherry from Antoine
+rrnBT1 terminator used on the pOSIP plasmids
+Landing Pad (PhiC31 attB TT site)
+Check for secondary structure in the RBS Done
+Check for RBS in the LoxP array Done
+Split to have two ~1500 bp gblocks Done
+Design overlaps for Gibson in R6K vector Done
+Check for Biobrick restriction sites Done
+Fix gBlocks problems
+* Palindroms between LoxP sites Done
+* Repeats in terminator: replaced with Lambda T0 terminator Done
+* Repeat in RBS Done
+* More GC in the LoxP array Done
+* More GC at the end of fragment 1Done
+* Repeat at the end of mVenus and mCerulean Done
+* More GC at the beginning of fragment 2 Done
+It is very difficult to solve these -&gt; make 3 fragments Done
+Fragment A: 0 - 1143
+Fragment B: 1105 - 2006
+Fragment C: 1981 - 2946
+Change the RBS for Fragment A -&gt; “New RBS” Done
+Order gBlocks Done 07/13
+=== Design + order oligos for gBlocks amplification Done ===
+Overlaps melting points are 62, 67, 54, 74.
+The overlap between fragments B and C should be increased to &gt;62.
+{|
+|width="33%"|R6K LinR
+|width="33%"|tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag
+|width="33%"|o15.80
+|-
+|R6K LinF
+|CGGGCGCGTACTCCAgaagggcatcgatggc
+|o15.81
+|-
+|Colibow A F
+|ttgacagctagctcagtcctag
+|o15.82
+|-
+|Colibow A R
+|GGCCATTCACATCACCATC
+|o15.83
+|-
+|Colibow B F
+|GCCGATTCTTGTTGAACTTG
+|o15.84
+|-
+|Colibow B R
+|CCATGGTACCTCCTCCTTACTTCTATAACTTC
+|o15.85
+|-
+|Colibow C F
+|GATACTTTATACGAAGTTATAGAAGTAAGGAGGAG
+|o15.86
+|-
+|Colibow C R
+|gccatcgatgcccttcTGGAGTACGCGCCCG
+|o15.87
+|}
+Overlap melting points: 62, 67, 62, 72.
+=== Design + order oligos for cassette sequencing Done ===
+&gt;50 bp before the interest region
+bp max contigs
+Obtain Pir+ strain Done
+Overnight of Pir+ strain Done
+Glycerol of Pir+ strain Done
+== Cloning inside the replication vector ==
+Order oligos linR and linF Done
+Obtain R6K vector from Ihab Done
+Overnight culture of the R6K vector propagation strain
+        Failed New attempt with less harsh growth conditions. Done
+* Only 20 ug/ml of Kanamycine
+* 6 ul of Thyamine in 3 ul of LB
+* Culture at 30°C
+Miniprep of the R6K vector Done
+Glycerol of R6K strain Done
+Linearization of the R6K vector by PCR Done
+Primer linF:
+CCCTTGGGCTCCCCGGGCGCGTACTCCAgaagggcatcgatggc
+(28 bases: longest possible overlap without having a hairpin at 50°)
+Tm = 55°
+Primer linR:
+tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag
+(33 bases overlap)
+Tm = 62°
+Product length: 2276 bp
+Synthetize, reconstitute and dilute primers Done
+Run gel for size checking Done
+PCR purification Done
+Obtain gBlocks Done
+PCR of colibow fragments A, B and C Done
+PCR purification of amplicon Done
+Obtain Gibson mix Done
+Make overnight culture of Pir+ strain Done
+Make electrocompetent cells out of the Pir+ strain Done
+Gibson assembly of 3 gblocks with the R6K backbone. Done
+The vector can only replicate in Pir+ strain. Transform into Pir+ strain Got colonies
+Check transformant: colony PCR before culture Failed
+Liquid culture + miniprep
+Analytical digestion or sequencing (find enzymes)
+{|
+|width="33%"|SeqF1
+|width="33%"|o15.88
+|width="33%"|cttagtacgttagccatgagg
+|-
+|SeqF2
+|o15.89
+|CTAATTTTCCATCTGATGGCC
+|-
+|SeqF3
+|o15.90
+|CAAGCTCACGCTCAAATTC
+|-
+|SeqF4
+|o15.91
+|ACAACCATTACCTGTCGACG
+|-
+|SeqF5
+|o15.92
+|CGACATTAGGGTATGGGCTG
+|-
+|SeqR1
+|o15.93
+|TATAAACATTATGGCTATTATAG
+|-
+|SeqR2
+|o15.94
+|TTTAGAGAGTTTTGACTGCG
+|-
+|SeqR3
+|o15.95
+|TTTGCCAGTCGTACAGATGAA
+|-
+|SeqR4
+|o15.96
+|TCTTCTTCTGCATCACCGGGC
+|}
+== Chromosomal integration with GalK ==
+PCR of the purified R6K plasmid. Done
+PCR-linerization of the R6K backbone
+* Miniprep du backbone R6K (20 ng/ul) -&gt; 5 ul in PCR
+* Primers: 15.80 (LinR) et 15.81(LinF)  -&gt; 1 ul each
+* Eau qsp 25 ul
+* Master mix 25 ul
+’30’’ extension, 50°C annealing.
+Find oligos (already there) Done
+IntR:
+GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAACCATATGAATATCCTCCTTAGTTCCTATTCCG
+Alternatively, with only one binding site:
+GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAAttagccatggtccatatgaatatcctccttag
+IntF:
+TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCGGGTTGAACTGCGGATCTTGCGGC
+Italique: Homology region with E. coli GalK site.
+Length: 4908 bp
+Attention, autre site potentiel d’amorçage, produit de 3515 bp
+Purification
+Overnight culture de E. coli Lambda Red
+Competent cells out of Lambda Red strain
+Transformation of E. coli with pKD46 that carries Lambda Red recombinase
+Transformation of the Colibow PCR product
+== Function testing ==
+Tecan + Flux cytometry
+== CRE recombinase expression ==
+pFHC2938 should work.
+It expresses CRE and has a temperature sensitive ORI (30°C)
+=== Monday 07/06 ===
+==== Research about the synthetic integron ====
+It might make the landing pads better than with brainbow because the recombination site is always the same.
+==== Plate culture of E. coli pIT5-KL and pIT5-KH ====
+Very important: grow @30
+-&gt; Make a liquid culture of each and freeze at -80
+-&gt; Miniprep from pIT5-KL for first construct
+These two strains produce the vector plasmids for clonetegration. They have to be linearized with EcoR1 and Pst1, and then Gibson assembled to get the self-integrating plasmids.
+The integrase they carry is expressed only at 37 degrees.
+They are resistant to Kanamycine.
+KH integrates into the HK022 phage’s site, while KL integrates into the Lambda phage site. We will probably only need one of them but I took both just in case. If needed there is a whole collection of such vectors.
+==== Plate culture of E. coli pE-FLP ====
+Grow @ 30
+This strain produces the pE-FLP plasmid, which expresses the flippase. It will be useful to remove the backbone after the clonetegration. It’s resistant to ampicillin.
+It has a temperature-sensitive ORI and will disappear if grown at 37.
+==== New primers ====
+LC81, LC85, LC82, LC86: used in the PCR to check integration with pIT5 KH.
+LC81, LC87, LC83, LC84: used in the PCR to check integration with pIT5 KL.
+== Thursday 07/09 ==
+* Prepared 10 tubes of 1 ml Kanamycine, 50 mg/ml
+* Inoculated pIT5-KL and pIT5-KH E. coli in 2 ml LB Kan+50
+* Inoculated pE-FLP E. coli in 2ml LB Amp+100
+* Cultured these three tubes @ 30
+== Monday 07/20 ==
+=== Reception of two plates from Ihab ===
+* Shortened R6K vector -&gt; Kan+ and thyamine auxotrophy. Thyamine 1000x is available in an eppendorf tube.
+* Pir 116 strain for propagation of the vector.
+-&gt; Overnight culture for miniprep for PCR and gleezing
+* R6K in LB Kan Thyamine (in antibiotics box)
+* Pir116 in LB with a control tube
+=== Started cultures for Colibow ===
+pThy 1.0 aka pBrainbow 1.0 in 3 ml LB-Amp -&gt; Miniprepcr
+pR6K in LB-Kan-Thyamine -&gt; Miniprepcr and Glycerol freezing
+Pir116 for replication of pR6K-vectors -&gt; LB
+Control without innoculation -&gt; LB
+All of them, culture @ 37° overnight.
+No need to culture pKT174 because we already have the purified version. It may be a good idea to transform DH5a with it in case we run out of plasmid.
+=== Reception of oligos o15.76 to o15.96 ===
+* Yeastbow SOE
+* R6K linearization
+* Colibow gBlock Amp
+* Colibow Sequencing
+The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.
+-&gt; Oligo reconstitution and dilution
+-&gt; Miniprep of R6K vector
+-&gt; PCR of R6K vector
+-&gt; Miniprep of pBrainbow 1.0
+-&gt; PCR of pBrainbow 1.0
+-&gt; PCR of pThy Ura3
+Reconstituted all primers to 100 ug/ml.
+=== Miniprep of pR6K and pBrainbow 1.0 ===
+For PCR, using Promega kit w/ double wash. Elution in 30 ul
+Final concentration: 93 ng/ul
+=== Re-start of the R6K culture ===
+The first culture failed: let’s try again with less harsh conditions.
+* Only 20 ug/ml of Kanamycine
+* 6 ul of Thyamine in 3 ul of LB
+* Culture at 30°C
+== Wednesday 07/22 ==
+=== PCR-linerization of the R6K backbone ===
+* Miniprep du backbone R6K (20 ng/ul) -&gt; 5 ul in PCR
+* Primers: 15.80 (LinR) et 15.81(LinF)  -&gt; 1 ul each
+* Eau qsp 25 ul
+* Master mix 25 ul
+’30’’ extension, 50°C annealing -&gt; 2276 bp
+=== Bad news from IDT about the gene synthesis ===
+« I would like to notify you about a best effort for gBlock ‘Colibow C’. Even after multiple attempts at trying to correct this issue, the Final QC data for the best prep is not meeting our quality standards. The final prep (mfg# 188635671) has desired peak.  A secondary peak is also present. The target mass was found in the chromatogram, but not as the most abundant product in any of the chromatographic peaks for mass spectrometry, and the sequence has been verified.
+If you are using this sequence for cloning and/or qPCR you should not have any problems with this sequence. It may require you to screen additional colonies. However, if your intentions with using this gBlock was for other purposes, we might need to cancel the gBlock and redesign. I have provided the trace below. »
+== Thursday, 07/23 ==
+=== Glycerol stock for pR6K ===
+ml of overnight culture of E. coli pR6K.
+ml of glycerol.
+-&gt; -20°C
+=== Gel for linearized R6K pcr ===
+% agar TAE, with 1 kb+ generuler.
+ul PCR product + 1 ul LB.
+-&gt; band at the right size (2276 bp) , the PCR worked.
+=== linearized R6K pcr cleanup ===
+Using the Qiagen kit, taken back in 50 ul water
+Titration: about 80 ng/ul, but very bad 260/230 ratio (presence of organic molecules).
+=== Pir116 electrocompetent for bowcoli transformation ===
+ml overnight culture in 100 ml LB, at 37°C w/ shaking.
+When OD reaches 0.6, they were put in ice for half an hour.
+Electrocompetent cells were made by Mukit along with DH5a competent cells.
+== Tuesday, 07/28 ==
+=== Reception of gBlocks Colibow A, B, C ===
+Reconstitution to the concentration of 10 ng/ul (from spec sheet):
+* Centrifuge @ 11kG
+* Add 100 ul of RNase-free water
+* Vortex
+* Incubate at 50°C for 20 minutes
+* Vortex/Centrifuge
+=== PCR of Colibow gBlocks ===
+Colibow A
+Primers: 82 (56°) + 83 (54°) -&gt; 1172 bp
+Colibow B
+Primers: 84 (53°) + 85 (54°) -&gt; 909 bp
+Colibow C
+Primers: 86 (54°) + 87 (57°) -&gt; 992 bp
+Reaction in 50 ul:
+{|
+|width="50%"|Compound
+|width="50%"|Volume (ul)
+|-
+|Water
+|19
+|-
+|Phusion 2x
+|25
+|-
+|Primer 1
+|2.5
+|-
+|Primer 2
+|2.5
+|-
+|gBlock diluted 10 times
+|1 ul
+|}
+Program:
+(30)
+(10) 58 (25) 72 (45) x35
+(600)
+(hold)
+In parallel from running the gel, the PCR products were purified with the QIAGEN kit and eluted in 40 ul of water.
+Titration
+Fragment A: 90 ng/ul
+Fragment B: 88 ng/ul
+Fragment C: 85 ng/ul
+Gel plan
+% agar, SYBRsafe, 5 ul of PCR product + 1 ul of LD.
+The 100 bp+ marker was used.
+The apparatus didn’t work. It stopped two times, the gel stayed to diffuse in the tank for 30 minutes. At the end it was imaged even though it was far from finished.
+{|
+|width="25%"|Ladder 100 bp+
+|width="25%"|Colibow A
+|width="25%"|Colibow B
+|width="25%"|Colibow C
+|-
+|Expected size
+|1172
+|909
+|992
+|}
+[[File:images/image04.jpg|Colibow Amp Results.jpg]][[File:images/image02.jpg|1438103355.jpg]]
+Conclusion
+There are a lot of non-specific binding.
+Due to the awful quality of the gel, it’s not possible to determine their size or which bands are the good ones. The top ones seem more consistent regarding their relative sizes.
+To do:
+# Run the whole purified PCR product in a gel and perform a gel extraction. Hopefully the right band can be determined this time.
+# Try the PCR again with a higher annealing temperature.
+# Gibson assemble directly the gBlocks fragments.
+== Wednesday, 07/29 ==
+=== Gel for Colibow A, B, C and extraction ===
+Agar 1%, SYBRsafe, TAE
+{|
+|width="25%"|Ladder 100 bp+
+|width="25%"|Colibow A
+|width="25%"|Colibow B
+|width="25%"|Colibow C
+|-
+|Expected size
+|1172
+|909
+|992
+|}
+[[File:images/image01.jpg|Colibow Amp Extracted.jpg]]
+For each sample, the top band was extracted. The Colibow B sample was extracted twice: Bg (grande, top band) and Bp (petite, bottom band).
+The bottom band is the right one.
+-&gt; add DMSO 3% next time
+Titration (in 30 ul EB)
+{|
+|width="14%"|Name
+|width="14%"|1
+|width="14%"|U
+|width="14%"|A
+|width="14%"|Bp
+|width="14%"|Bg
+|width="14%"|C
+|-
+|C (ng/ul)
+|13
+|41
+|6
+|29
+|11
+|12.1
+|}
+The concentrations of Colibow A and C are critically low. It is necessary to fix the PCR and reduce the non-specific priming before performing the Gibson.
+=== New attempt at Colibow A and C PCRs ===
+Mix
+Phusion        25
+Colibow A        1
+o15.82                2.5
+o15.83                2.5
+Water                19
+DMSO                1.5         (3%)
+= Two tubes of 50 ul each -&gt; 1172 bp
+Mix
+Phusion        25
+Colibow C        1
+o15.86                2.5
+o15.87                2.5
+Water                19
+DMSO                1.5         (3%)
+= Two tubes of 50 ul each -&gt; 992 bp
+This is stored in 4° for now (29/07)
+=== Received Gibson assembly mixes from Ihab ===
+I need better quality products before doing it.
+== Thursday, 07/30 ==
+=== Gel for A, C and 1 ===
+*Sophie’s sample
+{|
+|width="8%"|*
+|width="8%"|A
+|width="8%"|A
+|width="8%"|A
+|width="8%"|C
+|width="8%"|C
+|width="8%"|C
+|width="8%"|100+
+|width="8%"|1
+|width="8%"|1
+|width="8%"|1
+|width="8%"|1kb
+|-
+|*
+|1172
+|1172
+|1172
+|992
+|992
+|992
+|
+|3965
+|3965
+|3965
+|
+|}
+ul sample + 10 ul LD -&gt; 40 ul in each well (3 wells)
+Attention C sample accidentally added to the well containing 100 bp + ladder !!!
+[[File:images/image00.jpg|Colibow A et C amp 29.07.jpg]]
+Gel extraction
+With Qiagen kit, product recovered in 30 ul of water.
+Name: “product” X+ 30/07
+The C product mixed with ladder was labeled Cl.
+Titration
+{|
+|width="20%"|Sample
+|width="20%"|1
+|width="20%"|A
+|width="20%"|C
+|width="20%"|Cl
+|-
+|c (ng/ul)
+|5.2
+|15.4
+|12.9
+|4.4
+|}
+=== Gibson assemblies of Colibow ===
+General mix:
+ul of Gibson supermix (MMII)
+-100 ng of backbone for a 6 kb fragment
+Equimolar amount of DNA fragments
+Total: 20 ul
+Colibow PCR products
+Using the most concentrated PCR products known to date.
+{|
+|width="20%"|Nom
+|width="20%"|Taille (bp)
+|width="20%"|Concentration
+|width="20%"|Volume (ul)
+|width="20%"|Quantité (ng)
+|-
+|R6K pcr
+|2276
+|80
+|0.6
+|50
+|-
+|Colibow A+ e (in water)
+|1172
+|15
+|1.7
+|25
+|-
+|Colibow Bp
+(in EB)
+|909
+|29
+|0.9
+|25
+|-
+|Colibow C+ e
+(in water)
+|992
+|13
+|1.6
+|25
+|}
+Colibow gBlocks
+Using directly the gBlocks from IDT dna synthesis
+{|
+|width="20%"|Nom
+|width="20%"|Taille (bp)
+|width="20%"|Concentration
+|width="20%"|Volume (ul)
+|width="20%"|Quantité (ng)
+|-
+|R6K pcr
+|2276
+|80
+|0.5
+|30
+|-
+|Colibow A
+|1172
+|10
+|1.5
+|15
+|-
+|Colibow B
+|909
+|10
+|1.5
+|15
+|-
+|Colibow C
+|992
+|10
+|1.5
+|15
+|}
+Incubation during one hour at 50°C.
+=== 3 LB ampicillin plates ===
+“30/07 ANTOINE”
+ml of hot LB-agar.
+=== Transformation of Colibow in Pir116 by Electroporation ===
+pColibow gBlock
+pColibow PCR
+Biobrick plasmid with RFP (3 ul of 10 pg tube, not dialysed)
+Protocol from OWW:
+* Thaw cells from -80°C to ice for &gt;20 min
+* Chill cuvettes
+* Dialyse 6 ul of Gibson products on dWater during &gt;20 min
+* Mix 6 ul of dialysed DNA with 50 ul Pir116 electrocompetent cells
+* Mix with tip
+* Pulse (1.5 kV, 2 mm cuvette)
+* Add 1 ml LB (at 18h43)
+Incubate for 1 hour at 37°C.
+Kanamycine 25 plates for each colibow plasmid: 100 ul and 900 ul
+Chloramphenicol plate for RFP control
+Incubation overnight @37.
+=== Transformation of pKT174 in DH5a by Heat shock ===
+Protocol from addgene:
+* Thaw cells on ice (20 min)
+* 3 ul DNA + 50 ul chemically competent cells, mix gently
+* 20-30 min on ice
+* 45s at 42°C
+* 2 min on ice
+* Add 1 ml LB (at 18h50)
+* Incubate 1 hour @ 37°C
+ampicillin plates: 100 ul and 900 ul.
+Incubation overnight @37.
+=== Gel for SOE 29/07 ===
+{|
+|width="16%"|1 kb ladder
+|width="16%"|SOE
+|width="16%"|SOE
+|width="16%"|SOE
+|width="16%"|1 kb ladder
+|width="16%"|*
+|}
+Expected size: 5600 for all of them.
+[[File:images/image03.jpg|SOE+29.07.jpg]]
+It didn’t work at all. Try to Gibson-assemble them.
+=== New electroporation of Pir116 ===
+Using the old electroporator (with the square cuvette holder).
+Dialysis of 6 ul and sampling of 5 ul of Colibow gBlock assembly
+Dialysis of 5 ul and sampling of 5 ul of 5 pg/ul
+{|
+|width="33%"|Compound
+|width="33%"|x1
+|width="33%"|x8
+|-
+|10x Taq Buffer
+|2.5
+|20
+|-
+|10 nM dNTPs
+|0.5
+|4
+|-
+|10 uM primer 90
+|0.5
+|4
+|-
+|10 uM primer 94
+|0.5
+|4
+|-
+|taq polymerase
+|0.125
+|1
+|-
+|water
+|17.875
+|167
+|}
+Then 22 ul of mix is added to 3 ul of template (2 ul water + 1 ul sample for positive control). Template is obtained by soaking part of a colony in 20 ul water.
+==== Program (saved as Colony): ====
+(6’00)
+(15) 49 (25) 68 (45) x30
+(5’00)
+==== Gel: ====
+P900        B1        B2        B3        ColibowB        100bp+
+==== Results: ====
+* One band at 508 bp on the positive control.
+* No band at all on the colonies
+-&gt; They are contaminations, the transformation did not work, probably because the Gibson itself did not work due to bad DNA concentration.
+== Wednesday, 8/5 ==
+==== Pir116 electrocompetent cells ====
+From the overnight culture, 1 ml of cells were diluted in 50 ml of LB and incubated at 37°C (10h30).
+Centrifuge steps were done 10 min at 8500 rpm.
+* 50 ml culture -&gt; centrifuge and remove well the supernatant
+* 50 ml glycerol 10% -&gt; centrifuge
+* 50 ml glycerol 10% -&gt; centrifuge
+Cells in residual glycerol were aliquoted in eppendorf tubes (6 in the end) and frozen @-80.
+==== Testing of these EC Pir116 cells function ====
+ul of pSB1C3 20 pg/ul were dialysed, 3 ul were picked after 20 min and mixed with 100 ul of cells.
+Pulse duration: 5.7 ms
+After 1 h of preculture @37, it was plated on a chloramphenicol 0.5 plate and grown @37.
+==== New colibow PCR ====
+Performed by Chloé and Émilie.
+[[File:images/image06.png|1438872081.png]]
+Program:
+(30)
+x 98 (10), Gradient (30), 72 (2’20)
+(5)
+(hold)
+Gradient:
+, 57.8, 55.3, 53.4
+The very long extension time is used to avoid promoting small non-specific fragments.
+Gel:
+% agarose, SYBRsafe, 2.5 ul sample + 0.5 ul LD
+{|
+|width="6%"|L
+|width="6%"|A
+|width="6%"|A
+|width="6%"|A
+|width="6%"|A
+|width="6%"|L
+|width="6%"|B
+|width="6%"|B
+|width="6%"|B
+|width="6%"|B
+|width="6%"|L
+|width="6%"|C
+|width="6%"|C
+|width="6%"|C
+|width="6%"|C
+|width="6%"|L
+|-
+|1 kb
+|1172
+|
+|
+|
+|1 kb
+|909
+|
+|
+|
+|1 kb
+|992
+|
+|
+|
+|
+|}
+[[File:images/image07.jpg|08.05 Colibow Amp gradient.jpg]]
+=== Thursday, 8/6 ===
+==== PCR purification of Colibow gBlocks ====
+The homologous tubes were mixed together, except for C2 that didn’t work.
+Elution in 50 ul of water.
+A second gel was ran in order to know whether the light band at the bottom is still present.
+{|
+|width="25%"|1 kb ladder
+|width="25%"|A
+|width="25%"|B
+|width="25%"|C
+|}
+Is it. This has to be taken into account when calculating the concentrations for the Gibson assembly.
+Titration (in 50 ul of water):
+A: 137 ng/ul
+B: 167 ng/ul
+C: 99 ng/ul
+[[File:images/image05.jpg|08.06 Colibow gradient after purification.jpg]]
+=== New R6K PCR ===
+{|
+|width="33%"|Compound
+|width="33%"|1x
+|width="33%"|2x
+|-
+|water
+|71
+|142
+|-
+|Phu buffer
+|20
+|40
+|-
+|dNTP
+|2
+|4
+|-
+|80 primer
+|1
+|2
+|-
+|81 primer
+|1
+|2
+|-
+|pR6K shortened (template)
+|1
+|2
+|-
+|DMSO
+|3
+|6
+|-
+|Phusion polymerase
+|1
+|2
+|}
+Program:
+(30)
+(10) 52 (30) 72 (1’30) x 35
+(5’)
+Problem: There was only &lt;1 ul of phusion left in the tube. The PCR did not work at all.
+==== New attempt ====
+Mix (made twice)
+Phusion master mix        50 ul
+primer                2 ul
+primer                2 ul
+pR6K                        3 ul
+DMSO                        3 ul
+Water                        40 ul
+Program:
+(30)
+(10) 50 (30) 72 (1’30) x 35
+(5’)
+After this PCR, the product was:
+* ran on a gel: Ladder 1kb, tube 1, tube 2 (3 ul sample, 2 ul water, 1 ul LD)
+* digested by DPN1:
+ul of DPN1 added directly to the product, then incubated for 15 minutes at 37° in the thermocycler and inactivated (5 min at 80°).
+Gel results: To be uploaded (on my pendrive now).
+== Monday, 08/10 ==
+=== PCR purification of R6K amp ===
+With QIAGEN kit, performed by Chloé &amp; Émilie. At the end, the product was recovered in 50 ul of water and also 30 ul EB, for 80 ul total.
+The titration was done using a 5 ul + 3 ul mix as a blank.
+==== Products summary: ====
+{|
+|width="33%"|R6K pcr
+|width="33%"|67.4 ng/ul
+|width="33%"|2276 bp
+|-
+|Colibow A
+|137
+|1172 bp
+|-
+|Colibow B
+|167
+|909 bp
+|-
+|Colibow C
+|99
+|992 bp
+|}
+A and C have a small band at ~200 bp, so the actual concentration of the product is half of what indicated by the Nanodrop.
+=== Gibson assembly of Colibow ===
+Assuming half the DNA in A and C is the right one.
+{|
+|width="33%"|Name
+|width="33%"|Volume (ul)
+|width="33%"|Final amount (pmol)
+|-
+|A
+|1.11
+|0.10
+|-
+|B
+|0.4
+|0.11
+|-
+|C
+|1.30
+|0.10
+|-
+|R6K
+|2.19
+|0.10
+|}
+Added to a MMII Gibson assembly master mix and incubated during 1h at 50°C.
+==== Gel for Colibow’s Gibson ====
+ul SYBRsafe in 20 ml agar 1%, with 1 kb ladder.
+The sample consisted in 10 ul of Gibson product and 2 ul of LD.
+Unfortunately the comb for making the wells went through the gel, resulting in loss of the sample.
+=== Electroporation of Pir116 E. coli with newly assembly pColibow ===
+* Dialyse of the assembly product during 20 min. 5 ul were deposed and 5 ul were taken back.
+* Mixed with already tested Pir116 Electrocompetent cells
+* Program Ec2, bacterial, in 2 mm cuvette. Pulse time: 4.7 ms.
+* Incubation 1h @37
+* Plating on “pColibow Gibson” plates (K50 but K20 written on the box). 100 ul on the first box, centrifuged 900 ul on the second one.
+* Incubation overnight @37.

Difference between revisions of "Team:Paris Bettencourt/Differentiation"

Revision as of 10:30, 11 August 2015

Contents

Advancement on E. coli

Writing the artificial gene

Design + order oligos for gBlocks amplification Done

Design + order oligos for cassette sequencing Done

Cloning inside the replication vector

Chromosomal integration with GalK

Function testing

CRE recombinase expression

Monday 07/06

Research about the synthetic integron

Plate culture of E. coli pIT5-KL and pIT5-KH

Plate culture of E. coli pE-FLP

New primers

Thursday 07/09

Monday 07/20

Reception of two plates from Ihab

Started cultures for Colibow

Reception of oligos o15.76 to o15.96

Miniprep of pR6K and pBrainbow 1.0

Re-start of the R6K culture

Wednesday 07/22

PCR-linerization of the R6K backbone

Bad news from IDT about the gene synthesis

Thursday, 07/23

Glycerol stock for pR6K

Gel for linearized R6K pcr

linearized R6K pcr cleanup

Pir116 electrocompetent for bowcoli transformation

Tuesday, 07/28

Reception of gBlocks Colibow A, B, C

PCR of Colibow gBlocks

Wednesday, 07/29

Gel for Colibow A, B, C and extraction

New attempt at Colibow A and C PCRs

Received Gibson assembly mixes from Ihab

Thursday, 07/30

Gel for A, C and 1

Gibson assemblies of Colibow

3 LB ampicillin plates

Transformation of Colibow in Pir116 by Electroporation

Transformation of pKT174 in DH5a by Heat shock

Gel for SOE 29/07

New electroporation of Pir116

Program (saved as Colony):

Gel:

Results:

Wednesday, 8/5

Pir116 electrocompetent cells

Testing of these EC Pir116 cells function

New colibow PCR

Thursday, 8/6

PCR purification of Colibow gBlocks

New R6K PCR

New attempt

Monday, 08/10

PCR purification of R6K amp

Products summary:

Gibson assembly of Colibow

Gel for Colibow’s Gibson

Electroporation of Pir116 E. coli with newly assembly pColibow