Team:TU Dresden/Project/Results/amplification

• 
• Home
• Project
  • Overview
  • Description
  • Background
  • Methods
  • Results
  • Parts
  • Modeling
  • Conclusions
• Team
  • About Us
  • Attributions
  • Gallery
  • Official Team Site
  • Contact Us!
  • Sponsors
• Video
• Notebook
  • Protocols
  • Lab Journal
  • Plasmid Design
• Human Practices
  • Sustainability
  • Social Outreach (LNdW)
  • Education
  • Team Collaborations
  • Meetings
• Safety
• 

Amplification of HER2 fragment

The amplification of the HER2 framgnet from the Biobrick plasmid pIDTSMART-KAN was performed using the following primers:

subcl_fwd

ATATATGCTAGCGCCGGCAACCAGGAGGTGA

subcl_rev

ATATATCTGCAGCGGCCGCTAGTATTA

More information about these primers can be found in the following document:

To the top!