Difference between revisions of "Team:Tianjin/BFP"

Revision as of 15:34, 13 September 2015

内页

HOME
PROJECT
- DESCRIPTION
- RESULTS
- DESIGN
- PROTOCOLS
PARTS
MODELING
- OVERVIEW
- 1
- 2
- 3
COLLABORATIONS
SAFETY
HUMAN PRACTICE
- 1
- 2
- 3
NOTEBOOK
TEAM

1.Get the gene of BFP

1.1 In order to get the fusion protein, we use overlap PCR to construct the fragment(BFP- sJanus & BFP-sJanus-m).We get the gene of BFP by the standard plasmid from iGEM. Then we use PCR to amplify it. The primer we design is as follow:

F:5’- GAATTCGCGGCCGCTTCTAGATGAGCGAACTGATCAAAGAG-3’

(EcoRI and XbaI site are contained).

R:5’- GTGGTGGTGGTCTTGGTGGTGGTGGATTCAGTTTATGACCCAGCTT -3’

(linker-GGGGSGGGGS is contained)

We get the target sequence by PCR at the temperature of 55 ,60 and 65 centigrade.

1.2 detail of the experiment

PCR system：（50μl）

Buffer	5μl
dNTPS	5μl
BFP_F primer	2μl
BFP_R primer	2μl
BFP PSB1C3	1μl
Pfu enzyme	0.5μl
ddH2O	34.5μl

95℃	5min
95℃	30s
1：55℃ 2：60℃ 3：65℃	30s
72℃	2min
72℃	10min
4℃	Forever

2.Get the gene of BFP- sJanus & BFP-sJanus-m

2.1We get the gene of BFP- sJanus & BFP-sJanus-m by the plasmid pET28a(+) extracting from DH5α. And then we amplify it by PCR. The primer we design is as follow:

F:5’-ACCACCAAGACCACCACCACCAAGAAGCAACGGCAACGGCAAT-3’

(linker-GGGGSGGGGS is contained)

R:5’-CTGCAGGCGGCCGCTACTAGTATCAAGCACCGACGGCGG-3’

( SpeI, NotI, and PstI site are contained)

We get the target sequence by PCR at the temperature of 55, 60 and 65 centigrade.

2.2 Details of experiment

PCR system：（50μl）

Buffer	5μl
dNTPS	5μl
P_F	2μl
P_R	2μl
sJanus PET28a	2μl
Pfu enzyme	0.5μl
ddH2O	33.5μl

95℃	5min
95℃	30s
1：55℃ 2：60℃ 3：65℃	30s
72℃	2min
72℃	10min
4℃	Forever

2.3 Results

Figure 1 The maximum of marker is 2000bp, and the centigrade of 60 is not suitable for the system because there is a track behind it. Our target is about 250bp approximately

We get the target fragment in the end. All temperature were suitable for the PCR cycle.

3.Overlap PCR

3.1 We use the technique of overlap PCR to get our target sequence. In this experiment, we add BFP and sJanus & sJanus-m which we get in two steps and the BFP’s primer we design and sJanus & sJanus-m’s reverse in the system of PCR. We get the target sequence at the temperature of 55, 60 and 65 centigrade.

3.2 Detail of the experiment

PCR system（100μl）

Buffer	10μl
dNTPS	10μl
BFP fragment	5μl
sJanus fragment	5μl
Pfu enzyme	1μl
ddH2O	69μl

Add two kinds of primer (1μl) after 5 cycle.

95℃	5min
95℃	30s
1：50℃ 2：56℃ 3：65℃	30s
72℃	2min
72℃	10min
95℃	5min
95℃	30s
1：50℃ 2：56℃ 3：65℃	30s
72℃	2min
72℃	10min
4℃	Forever

3.3 Results

Figure 2

Figure 3. The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately. We failed at first attempt. But as we change the temperature we use in PCR cycle. We finally get the target fragment.

As we can see from the picture, there are two bands in every channel. One is about 1000bp and another is about 300bp. We do not know the reason of this. But after doing the confirmatory experiment, we are sure the 1000bp band is the target band we want (BFP- sJanus & BFP-sJanus M). We did not get the fragment at first attempt. We change the temperature in PCR cycle.

4. Construct the plasmid

4.1 We design another kind of primer and reverse which contain EcoRI and Hind III site. The condition to amplify it by PCR is same as above all. We choose pET28a(+) as our expression vector. And then, we use enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We use T4 DNA ligase to connect them at the temperature of 22 centigrade. We insert the plasmid into competent DH5α. It has been confirmed that these sequences we get are right when detecting them in company.

4.2 detail of the experiment

Digest (60μl) 1h

ddH2O	31μl
buffer	6μl
Fd1	1.5μl
Fd2	1.5μl
DNA	20μl

T4 DNA ligase to connect（20μl） 1h

Buffer	2μl
T4 DNA ligase	0.5μl
plasmid	X
fragment	5X

2

3

4

5

@@ Line 272: / Line 272: @@
      <div class="content" id="content1">
 	    <div id="content-in">
-  <p style="text-align: left; line-height: 1.5em;">
+  <p style="text-align:left">
-     <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">1.Get the gene of BFP</span></strong></span>
+     <strong><span style="font-size:19px">1.Get the gene of BFP</span></strong>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.1 In order to get the fusion protein, we use overlap PCR to construct the fragment(BFP- sJanus &amp; BFP-sJanus-m).We get the gene of BFP by the standard plasmid from iGEM. Then we use PCR to amplify it. The primer we design is as follow:</span>
+     <span style="font-size:19px">1.1 In order to get the fusion protein, we use overlap PCR to construct the fragment(BFP- sJanus &amp; BFP-sJanus-m).We get the gene of BFP by the standard plasmid from iGEM. Then we use PCR to amplify it. The primer we design is as follow:</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">F:5’- GAATTCGCGGCCGCTTCTAGATGAGCGAACTGATCAAAGAG-3’</span>
+     <span style="font-size:19px">F:5’- GAATTCGCGGCCGCTTCTAGATGAGCGAACTGATCAAAGAG-3’</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(EcoRI and XbaI site are contained). </span>
+     <span style="font-size:19px">(EcoRI and XbaI site are contained). </span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">R:5’- GTGGTGGTGGTCTTGGTGGTGGTGGATTCAGTTTATGACCCAGCTT-3’</span>
+     <span style="font-size:19px">R:5’- GTGGTGGTGGTCTTGGTGGTGGTGGATTCAGTTTATGACCCAGCTT<a name="OLE_LINK2"></a><a name="OLE_LINK1"></a>-3’</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(linker-GGGGSGGGGS is contained)</span>
+     <span style="font-size:19px">(linker-GGGGSGGGGS is contained)</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We get the target sequence by PCR at the temperature of 55 ,60 and 65 centigrade.</span>
+     <span style="font-size:19px">We get the target sequence by PCR at the temperature of 55 ,60 and 65 centigrade.</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.2 detail of the experiment</span>
+     <span style="font-size:19px">1.2 detail of the experiment</span>
 </p>
-<p style="text-align: center; line-height: 1.5em;">
+<p style="text-align:center">
-     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: 宋体;">：（</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50μl</span><span style="font-size: 19px; font-family: 宋体;">）</span></span>
+     <span style="font-size:19px">PCR system</span><span style="font-size:19px;font-family:宋体">：（</span><span style="font-size:19px">50μl</span><span style="font-size:19px;font-family:宋体">）</span>
 </p>
 <table align="center" cellpadding="0" cellspacing="0">
@@ Line 303: / Line 303: @@
          <tr class="firstRow">
              <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
+                     <span style="font-size:19px">Buffer</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
+                     <span style="font-size:19px">5μl</span>
                  </p>
              </td>
@@ Line 315: / Line 315: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
+                     <span style="font-size:19px">dNTPS</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
+                     <span style="font-size:19px">5μl</span>
                  </p>
              </td>
@@ Line 327: / Line 327: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP_F primer</span>
+                     <span style="font-size:19px">BFP_F primer</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
+                     <span style="font-size:19px">2μl</span>
                  </p>
              </td>
@@ Line 339: / Line 339: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP_R primer</span>
+                     <span style="font-size:19px">BFP_R primer</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
+                     <span style="font-size:19px">2μl</span>
                  </p>
              </td>
@@ Line 351: / Line 351: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP PSB1C3</span>
+                     <span style="font-size:19px">BFP PSB1C3</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
+                     <span style="font-size:19px">1μl</span>
                  </p>
              </td>
@@ Line 363: / Line 363: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
+                     <span style="font-size:19px">Pfu enzyme</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px; word-break: break-all;" valign="top" width="132">
+             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
+                     <span style="font-size:19px">0.5μl</span>
                  </p>
              </td>
@@ Line 375: / Line 375: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
+                     <span style="font-size:19px">ddH2O</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
+                     <span style="font-size:19px">34.5μl</span>
                  </p>
              </td>
@@ Line 387: / Line 387: @@
      </tbody>
 </table>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
 <table align="center" cellpadding="0" cellspacing="0">
@@ Line 397: / Line 397: @@
          <tr class="firstRow">
              <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
+                     <span style="font-size:19px">5min</span>
                  </p>
              </td>
@@ Line 409: / Line 409: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 421: / Line 421: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">55</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">1</span><span style="font-size:19px;font-family:宋体">：</span><span style="font-size:19px">55</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">60</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">2</span><span style="font-size:19px;font-family:宋体">：</span><span style="font-size:19px">60</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">3</span><span style="font-size:19px;font-family:宋体">：</span><span style="font-size:19px">65</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+                     <span style="font-size:19px">&nbsp;</span>
                  </p>
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 442: / Line 442: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
+                     <span style="font-size:19px">2min</span>
                  </p>
              </td>
@@ Line 454: / Line 454: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
+                     <span style="font-size:19px">10min</span>
                  </p>
              </td>
@@ Line 466: / Line 466: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: &quot;微软雅黑&quot;,sans-serif;">℃</span></span>
+                     <span style="font-size:19px">4</span><span style="font-size:19px;font-family:&#39;微软雅黑&#39;,sans-serif">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
+                     <span style="font-size:19px">Forever</span>
                  </p>
              </td>
@@ Line 478: / Line 478: @@
      </tbody>
 </table>
-<p style="text-align: center; line-height: 1.5em;">
+<p style="text-align:center">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2.Get the gene of BFP- sJanus &amp; BFP-sJanus-m</span></strong></span>
+     <strong><span style="font-size:19px">2.Get the gene of BFP- sJanus &amp; BFP-sJanus-m</span></strong>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2.1We get the gene of BFP- sJanus &amp; BFP-sJanus-m by the plasmid pET28a(+) extracting from DH5α. And then we amplify it by PCR. The primer we design is as follow:</span>
+     <span style="font-size:19px">2.1We get the gene of BFP- sJanus &amp; BFP-sJanus-m by the plasmid pET28a(+) extracting from DH5α. And then we amplify it by PCR. The primer we design is as follow:</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">F:5’-ACCACCAAGACCACCACCACCAAGAAGCAACGGCAACGGCAAT-3’</span>
+     <span style="font-size:19px">F:5’-ACCACCAAGACCACCACCACCAAGAAGCAACGGCAACGGCAAT-3’</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(linker-GGGGSGGGGS is contained)</span>
+     <span style="font-size:19px">(linker-GGGGSGGGGS is contained)</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">R:5’-CTGCAGGCGGCCGCTACTAGTATCAAGCACCGACGGCGG-3’</span>
+     <span style="font-size:19px">R:5’-CTGCAGGCGGCCGCTACTAGTATCAAGCACCGACGGCGG-3’</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">( SpeI, NotI, and PstI site are contained)</span>
+     <span style="font-size:19px">( SpeI, NotI, and PstI site are contained)</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We get the target sequence by PCR at the temperature of 55, 60 and 65 centigrade.</span>
+     <span style="font-size:19px">We get the target sequence by PCR at the temperature of 55, 60 and 65 centigrade.</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2.2 Details of experiment</span>
+     <span style="font-size:19px">2.2 Details of experiment</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: center; line-height: 1.5em;">
+<p style="text-align:center">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: center; line-height: 1.5em;">
+<p style="text-align:center">
-     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: 宋体;">：（</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50μl</span><span style="font-size: 19px; font-family: 宋体;">）</span></span>
+     <span style="font-size:19px">PCR system</span><span style="font-size:19px;font-family:宋体">：（</span><span style="font-size:19px">50μl</span><span style="font-size:19px;font-family:宋体">）</span>
 </p>
 <table align="center" cellpadding="0" cellspacing="0">
@@ Line 518: / Line 518: @@
          <tr class="firstRow">
              <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
+                     <span style="font-size:19px">Buffer</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
+                     <span style="font-size:19px">5μl</span>
                  </p>
              </td>
@@ Line 530: / Line 530: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
+                     <span style="font-size:19px">dNTPS</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
+                     <span style="font-size:19px">5μl</span>
                  </p>
              </td>
@@ Line 542: / Line 542: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">P_F</span>
+                     <span style="font-size:19px">P_F</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
+                     <span style="font-size:19px">2μl</span>
                  </p>
              </td>
@@ Line 554: / Line 554: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">P_R</span>
+                     <span style="font-size:19px">P_R</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
+                     <span style="font-size:19px">2μl</span>
                  </p>
              </td>
@@ Line 566: / Line 566: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus PET28a</span>
+                     <span style="font-size:19px">sJanus PET28a</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
+                     <span style="font-size:19px">2μl</span>
                  </p>
              </td>
@@ Line 578: / Line 578: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
+                     <span style="font-size:19px">Pfu enzyme</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
+                     <span style="font-size:19px">0.5μl</span>
                  </p>
              </td>
@@ Line 590: / Line 590: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
+                     <span style="font-size:19px">ddH2O</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">33.5μl</span>
+                     <span style="font-size:19px">33.5μl</span>
                  </p>
              </td>
@@ Line 602: / Line 602: @@
      </tbody>
 </table>
-<p>
+<p style="text-align:left">
-     <br/>
+     <span style="font-size:19px">&nbsp;</span>
-</p>
-<p>
-    <br/>
 </p>
 <table align="center" cellpadding="0" cellspacing="0">
      <tbody>
          <tr class="firstRow">
-             <td style="border: 1px solid windowtext; padding: 0px 7px; word-break: break-all;" valign="top" width="136">
+             <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
                  <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
+                     <span style="font-size:19px">5min</span>
                  </p>
              </td>
@@ Line 625: / Line 622: @@
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
                  <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 637: / Line 634: @@
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">55</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">1</span><span style="font-size:19px;font-family:宋体">：</span><span style="font-size:19px">55</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">60</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">2</span><span style="font-size:19px;font-family:宋体">：</span><span style="font-size:19px">60</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">3</span><span style="font-size:19px;font-family:宋体">：</span><span style="font-size:19px">65</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px; word-break: break-all;" valign="top" width="132">
+             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
                  <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+                     <span style="font-size:19px">&nbsp;</span>
                  </p>
                  <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 658: / Line 655: @@
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
                  <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
+                     <span style="font-size:19px">2min</span>
                  </p>
              </td>
@@ Line 670: / Line 667: @@
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
                  <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
+                     <span style="font-size:19px">10min</span>
                  </p>
              </td>
@@ Line 682: / Line 679: @@
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
                  <p style="text-align:center">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">4</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
                  <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
+                     <span style="font-size:19px">Forever</span>
                  </p>
              </td>
          </tr>
      </tbody>
-</table><br/>
+</table>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2.3 Results</span>
+     <span style="font-size:19px">&nbsp;</span>
+</p><span style="font-size:19px">2.3 Results</span>
+<p style="text-align: center;">
+    <span style="font-size:19px"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/d/d8/Tianjin_BFP_1.png" title=""/></span>
 </p>
-<p style="position: absolute; z-index: 251683840; margin-left: 136px; margin-top: 37px; width: 35px; height: 12px; line-height: 1.5em;">
+<p style="margin-left:14px;text-align:left">
-    <br/>
+    <strong><span style="font-size:19px">Figure 1 </span></strong><span style="font-size:19px">The maximum of marker is 2000bp, and the centigrade of 60 is not suitable for the system because there is a track behind it. Our target is about 250bp approximately</span>
 </p>
-<p style="position: absolute; z-index: 251682816; margin-left: 43px; margin-top: 35px; width: 34px; height: 12px; line-height: 1.5em;">
+<p style="text-align:left">
-    <br/>
+    <span style="font-size:19px">We get the target fragment in the end. All temperature were suitable for the PCR cycle.</span>
 </p>
-<p style="position: absolute; z-index: 251681792; margin-left: 432px; margin-top: 36px; width: 31px; height: 13px; line-height: 1.5em;">
+<p style="text-align:left">
-     <br/>
+     <strong><span style="font-size:19px">3.Overlap PCR</span></strong>
-</p>
-<p style="position: absolute; z-index: 251680768; margin-left: 339px; margin-top: 36px; width: 30px; height: 13px; line-height: 1.5em;">
-    <br/>
-</p>
-<p style="text-align:center">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/d/d8/Tianjin_BFP_1.png" title=""/></span>
 </p>
-<p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 1 </span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">The maximum of marker is 2000bp, and the centigrade of 60 is not suitable for the system because there is a track behind it. Our target is about 250bp approximately</span></span>
+     <span style="font-size:19px">3.1 We use the technique of overlap PCR to get our target sequence. In this experiment, we add BFP and sJanus &amp; sJanus-m which we get in two steps and the BFP’s primer we design and sJanus &amp; sJanus-m’s reverse in the system of PCR. We get the target sequence at the temperature of 55, 60 and 65 centigrade.</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">3.2 Detail of the experiment</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p class="MsoListParagraph" style="margin-left:24px;text-align:left;text-indent:0">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We get the target fragment in the end. All temperature were suitable for the PCR cycle.</span>
+     <span style="font-size: 19px">&nbsp;</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p class="MsoListParagraph" style="margin-left:24px;text-align: center;text-indent:0">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">PCR system</span><span style="font-size:19px;font-family:宋体">（</span><span style="font-size:19px">100μl</span><span style="font-size:19px;font-family:宋体">）</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<table align="center" cellpadding="0" cellspacing="0">
-    <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3.Overlap PCR</span></strong></span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3.1 We use the technique of overlap PCR to get our target sequence. In this experiment, we add BFP and sJanus &amp; sJanus-m which we get in two steps and the BFP’s primer we design and sJanus &amp; sJanus-m’s reverse in the system of PCR. We get the target sequence at the temperature of 55, 60 and 65 centigrade.</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3.2 Detail of the experiment</span>
-</p>
-<p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
-</p>
-<p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
-    <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: 宋体;">（</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: 宋体;">）</span></span>
-</p>
-<table align="center" height="189" cellpadding="0" cellspacing="0" width="326">
      <tbody>
          <tr class="firstRow">
              <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="146">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
+                     <span style="font-size:19px">Buffer</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
+                     <span style="font-size:19px">10μl</span>
                  </p>
              </td>
@@ Line 760: / Line 733: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
+                     <span style="font-size:19px">dNTPS</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
+                     <span style="font-size:19px">10μl</span>
                  </p>
              </td>
@@ Line 772: / Line 745: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP&nbsp; &nbsp; fragment</span>
+                     <span style="font-size:19px">BFP&nbsp; &nbsp; fragment</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
+                     <span style="font-size:19px">5μl</span>
                  </p>
              </td>
@@ Line 784: / Line 757: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus fragment</span>
+                     <span style="font-size:19px">sJanus fragment</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
+                     <span style="font-size:19px">5μl</span>
                  </p>
              </td>
@@ Line 796: / Line 769: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
+                     <span style="font-size:19px">Pfu enzyme</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
+                     <span style="font-size:19px">1μl</span>
                  </p>
              </td>
@@ Line 808: / Line 781: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
+                     <span style="font-size:19px">ddH2O</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">69μl</span>
+                     <span style="font-size:19px">69μl</span>
                  </p>
              </td>
@@ Line 820: / Line 793: @@
      </tbody>
 </table>
-<p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
+<p class="MsoListParagraph" style="margin-left:24px;text-align:left;text-indent:0">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp; <br/></span>
+     <span style="font-size: 19px">&nbsp; <br/></span>
 </p>
-<p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
+<p class="MsoListParagraph" style="margin-left:24px;text-align:left;text-indent:0">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size: 19px">Add two kinds of primer (1μl) after 5 cycle.</span>
 </p>
-<p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
+<p style="text-align:center">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
-</p>
-<p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Add two kinds of primer (1μl) after 5 cycle.</span>
-</p>
-<p style="text-align: center; line-height: 1.5em;">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
 </p>
 <table align="center" cellpadding="0" cellspacing="0">
@@ Line 839: / Line 806: @@
          <tr class="firstRow">
              <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
+                     <span style="font-size:19px">5min</span>
                  </p>
              </td>
@@ Line 851: / Line 818: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 863: / Line 830: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">1</span><span style="font-size:19px;font-family:   宋体">：</span><span style="font-size:19px">50</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">2</span><span style="font-size:19px;font-family:   宋体">：</span><span style="font-size:19px">56</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">3</span><span style="font-size:19px;font-family:   宋体">：</span><span style="font-size:19px">65</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+                     <span style="font-size:19px">&nbsp;</span>
                  </p>
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 884: / Line 851: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
+                     <span style="font-size:19px">2min</span>
                  </p>
              </td>
@@ Line 896: / Line 863: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
+                     <span style="font-size:19px">10min</span>
                  </p>
              </td>
@@ Line 908: / Line 875: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
+                     <span style="font-size:19px">5min</span>
                  </p>
              </td>
@@ Line 920: / Line 887: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">95</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 932: / Line 899: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">1</span><span style="font-size:19px;font-family:   宋体">：</span><span style="font-size:19px">50</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">2</span><span style="font-size:19px;font-family:   宋体">：</span><span style="font-size:19px">56</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">：</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">3</span><span style="font-size:19px;font-family:   宋体">：</span><span style="font-size:19px">65</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+                     <span style="font-size:19px">&nbsp;</span>
                  </p>
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
+                     <span style="font-size:19px">30s</span>
                  </p>
              </td>
@@ Line 953: / Line 920: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
+                     <span style="font-size:19px">2min</span>
                  </p>
              </td>
@@ Line 965: / Line 932: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">72</span><span style="font-size:19px;font-family:宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
+                     <span style="font-size:19px">10min</span>
                  </p>
              </td>
@@ Line 977: / Line 944: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
+                     <span style="font-size:19px">4</span><span style="font-size:19px;font-family:   宋体">℃</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
-                 <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
+                 <p class="MsoListParagraph" style="text-align:center;text-indent:   0">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
+                     <span style="font-size:19px">Forever</span>
                  </p>
              </td>
@@ Line 989: / Line 956: @@
      </tbody>
 </table>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">3.3 Results</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align: center;">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/af/Tianjin_BFP_2.png" title=""/></span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style=";position: absolute;z-index:251692032;margin-left:196px;margin-top:41px;width:35px;height:11px"><br/></span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3.3 Results</span>
-</p>
-<p style="position: absolute; z-index: 251692032; margin-left: 196px; margin-top: 41px; width: 35px; height: 11px; line-height: 1.5em;">
-    <br/>
-</p>
-<p style="position: absolute; z-index: 251685888; margin-left: 429px; margin-top: 40px; width: 31px; height: 13px; line-height: 1.5em;">
-    <br/>
-</p>
-<p style="position: absolute; z-index: 251684864; margin-left: 320px; margin-top: 40px; width: 31px; height: 13px; line-height: 1.5em;">
-    <br/>
 </p>
 <p style="text-align:center">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/af/Tianjin_BFP_2.png" title=""/></span>
+     <span style="font-size:19px">Figure 2</span>
 </p>
-<p style="text-align: center; line-height: 1.5em;">
+<p style="text-align: center;">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Figure 2</span>
+     <span style="font-size:19px"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/e9/Tianjin_BFP_3.png" title=""/></span>
 </p>
-<p style="text-align:center">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/e9/Tianjin_BFP_3.png" title=""/></span>
+     <span style="font-size: 19px">Figure 3. The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately. We failed at first attempt. But as we change the temperature we use in PCR cycle. We finally get the target fragment. </span>
 </p>
-<p style="position: absolute; z-index: 251688960; margin-left: 322px; margin-top: 28px; width: 35px; height: 13px; line-height: 1.5em;">
+<p style="text-align:left">
-    <br/>
+    <span style="font-size:19px">As we can see from the picture, there are two bands in every channel. One is about 1000bp and another is about 300bp. We do not know the reason of this. But after doing the confirmatory experiment, we are sure the 1000bp band is the target band we want (BFP- sJanus &amp; BFP-sJanus M). We did not get the fragment at first attempt. We change the temperature in PCR cycle. </span>
 </p>
-<p style="position: absolute; z-index: 251687936; margin-left: 205px; margin-top: 30px; width: 31px; height: 13px; line-height: 1.5em;">
+<p style="text-align:left">
-     <br/>
+     <strong><span style="font-size:19px">4. Construct the plasmid</span></strong>
 </p>
-<p style="position: absolute; z-index: 251686912; margin-left: 91px; margin-top: 31px; width: 31px; height: 13px; line-height: 1.5em;">
+<p style="text-align:left">
-     <br/>
+     <span style="font-size:19px">4.1 We design another kind of primer and reverse which contain EcoRI and Hind III site. The condition to amplify it by PCR is same as above all. We choose pET28a(+) as our expression vector. And then, we use enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We use T4 DNA ligase to connect them at the temperature of 22 centigrade. We insert the plasmid into competent DH5α. It has been confirmed that these sequences we get are right when detecting them in company. </span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Figure 3. The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately. We failed at first attempt. But as we change the temperature we use in PCR cycle. We finally get the target fragment. </span>
+     <span style="font-size:19px">4.2 detail of the experiment</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:center">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">As we can see from the picture, there are two bands in every channel. One is about 1000bp and another is about 300bp. We do not know the reason of this. But after doing the confirmatory experiment, we are sure the 1000bp band is the target band we want (BFP- sJanus &amp; BFP-sJanus M). We did not get the fragment at first attempt. We change the temperature in PCR cycle. </span>
+     <span style="font-size:19px">Digest (60μl)&nbsp;&nbsp;&nbsp; 1h</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4. Construct the plasmid</span></strong></span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">4.1 We design another kind of primer and reverse which contain EcoRI and Hind III site. The condition to amplify it by PCR is same as above all. We choose pET28a(+) as our expression vector. And then, we use enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We use T4 DNA ligase to connect them at the temperature of 22 centigrade. We insert the plasmid into competent DH5α. It has been confirmed that these sequences we get are right when detecting them in company. </span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">4.2 detail of the experiment</span>
-</p>
-<p style="text-align: left; line-height: 1.5em;">
-    <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
-</p>
-<p style="text-align: center; line-height: 1.5em;">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Digest (60μl)&nbsp;&nbsp;&nbsp; 1h</span>
 </p>
 <table align="center" cellpadding="0" cellspacing="0">
      <tbody>
          <tr class="firstRow" style=";height:19px">
-             <td style="border: 1px solid windowtext; padding: 0px 7px;" height="19" valign="top" width="60">
+             <td style="border: 1px solid windowtext; padding: 0px 7px;" height="19" valign="top" width="141">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
+                     <span style="font-size:19px">ddH2O</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="137">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">31μl</span>
+                     <span style="font-size:19px">31μl</span>
                  </p>
              </td>
          </tr>
          <tr style=";height:19px">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="60">
+             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">buffer</span>
+                     <span style="font-size:19px">buffer</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">6μl</span>
+                     <span style="font-size:19px">6μl</span>
                  </p>
              </td>
          </tr>
          <tr style=";height:19px">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="60">
+             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fd1</span>
+                     <span style="font-size:19px">Fd1</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.5μl</span>
+                     <span style="font-size:19px">1.5μl</span>
                  </p>
              </td>
          </tr>
          <tr style=";height:19px">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="60">
+             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fd2</span>
+                     <span style="font-size:19px">Fd2</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.5μl</span>
+                     <span style="font-size:19px">1.5μl</span>
                  </p>
              </td>
          </tr>
          <tr style=";height:19px">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="60">
+             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">DNA</span>
+                     <span style="font-size:19px">DNA</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">20μl</span>
+                     <span style="font-size:19px">20μl</span>
                  </p>
              </td>
@@ Line 1,131: / Line 1,062: @@
      </tbody>
 </table>
-<p style="text-align: center; line-height: 1.5em;">
+<p style="text-align:center">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
-<p style="text-align: center; line-height: 1.5em;">
+<p style="text-align:center">
-     <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">T4 DNA ligase to connect</span><span style="font-size: 19px; font-family: 宋体;">（</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">20μl</span><span style="font-size: 19px; font-family: 宋体;">）</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">&nbsp; 1h</span></span>
+     <span style="font-size:19px">T4 DNA ligase to connect</span><span style="font-size:19px;font-family:宋体">（</span><span style="font-size:19px">20μl</span><span style="font-size:19px;font-family:宋体">）</span><span style="font-size:19px">&nbsp; 1h</span>
 </p>
-<table align="center" height="135" cellpadding="0" cellspacing="0" width="273">
+<table align="center" cellpadding="0" cellspacing="0">
      <tbody>
          <tr class="firstRow">
              <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
+                     <span style="font-size:19px">Buffer</span>
                  </p>
              </td>
              <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="100">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
+                     <span style="font-size:19px">2μl</span>
                  </p>
              </td>
@@ Line 1,156: / Line 1,087: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">T4 DNA ligase</span>
+                     <span style="font-size:19px">T4 DNA ligase</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="100">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
+                     <span style="font-size:19px">0.5μl</span>
                  </p>
              </td>
@@ Line 1,168: / Line 1,099: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">plasmid</span>
+                     <span style="font-size:19px">plasmid</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="100">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">X</span>
+                     <span style="font-size:19px">X</span>
                  </p>
              </td>
@@ Line 1,180: / Line 1,111: @@
          <tr>
              <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">fragment</span>
+                     <span style="font-size:19px">fragment</span>
                  </p>
              </td>
              <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="100">
-                 <p style="text-align: center; line-height: 1.5em;">
+                 <p style="text-align:center">
-                     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5X</span>
+                     <span style="font-size:19px">5X</span>
                  </p>
              </td>
@@ Line 1,192: / Line 1,123: @@
      </tbody>
 </table>
-<p style="text-align: left; line-height: 1.5em;">
+<p style="text-align:left">
-     <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">&nbsp;</span>
+     <span style="font-size:19px">&nbsp;</span>
 </p>
 <p>
      <br/>
-</p>
+</p></div>
-</div>
 	    <div>2</div>
 	    <div>3</div>