Difference between revisions of "Team:Toronto/Parts"

Line 74: Line 74:
 
<p>Pseudomonas putida F1 species degrades toluene with the help of the tod operon. Toluene dioxygenase and toluene cis-dihydrodiol dehydroxygenase transcribed from todC1C2BA and todD genes, respectively, facilitate the breakdown of toluene to 3-methylcatechol. Gerben J. Zylstra et al. successfully constructed the plasmid pTDG602 containing todC1C2BAD genes. To achieve complete degradation of toluene down to carbon dioxide and water, we focused on designing a plasmid containing todE and todF genes. After cotransformation of DH10B cells with pTDG602 and our plasmid, E.Coli  should theoretically contain all the genes required to achieve complete degradation.</p>
 
<p>Pseudomonas putida F1 species degrades toluene with the help of the tod operon. Toluene dioxygenase and toluene cis-dihydrodiol dehydroxygenase transcribed from todC1C2BA and todD genes, respectively, facilitate the breakdown of toluene to 3-methylcatechol. Gerben J. Zylstra et al. successfully constructed the plasmid pTDG602 containing todC1C2BAD genes. To achieve complete degradation of toluene down to carbon dioxide and water, we focused on designing a plasmid containing todE and todF genes. After cotransformation of DH10B cells with pTDG602 and our plasmid, E.Coli  should theoretically contain all the genes required to achieve complete degradation.</p>
 
<p class="image-wrapper">
 
<p class="image-wrapper">
</html> [[undefined:Toronto_2015_Pathway.png]] <html>
+
</html> [[File:Toronto_2015_Pathway.png]] <html>
 
</p>
 
</p>
  
Line 81: Line 81:
 
<p>This part is ordered in gene blocks and ligated by using Gibson Assembly by using . The design have been performed by Anthony Zhao, Seray Cicek, Umar Owadally, Katariina Jaenes, Matt D&#39;lorio, ChungMin Lee, Drupad Rajyaguru who are wet lab team members of the iGEM Toronto 2015 team. See our part in the the registry: <a href="http://parts.igem.org/Part:BBa_K1760001">http://parts.igem.org/Part:BBa_K1760001</a></p>
 
<p>This part is ordered in gene blocks and ligated by using Gibson Assembly by using . The design have been performed by Anthony Zhao, Seray Cicek, Umar Owadally, Katariina Jaenes, Matt D&#39;lorio, ChungMin Lee, Drupad Rajyaguru who are wet lab team members of the iGEM Toronto 2015 team. See our part in the the registry: <a href="http://parts.igem.org/Part:BBa_K1760001">http://parts.igem.org/Part:BBa_K1760001</a></p>
 
<p class="image-wrapper">
 
<p class="image-wrapper">
</html> [[undefined:Toronto_2015_TodE-plasmid_new.jpg]] <html>
+
</html> [[File:Toronto_2015_TodE-plasmid_new.jpg]] <html>
 
</p>
 
</p>
  
Line 87: Line 87:
 
<p>In order to achieve complete degradation of toluene, we also constructed a codon optimized todF sequence. We tried to create a ligated plasmid containing  todE, todF, optimized Salis RBS calculator and a tunable promoter to determine optimum transcription for DH10B cells. We used Ligase Cycling Reaction(LCR) in this process. Unique Nucleotide Sequences are added to ligating blocks to facilitate assembly of the plasmid without a secondary structure interference.</p>
 
<p>In order to achieve complete degradation of toluene, we also constructed a codon optimized todF sequence. We tried to create a ligated plasmid containing  todE, todF, optimized Salis RBS calculator and a tunable promoter to determine optimum transcription for DH10B cells. We used Ligase Cycling Reaction(LCR) in this process. Unique Nucleotide Sequences are added to ligating blocks to facilitate assembly of the plasmid without a secondary structure interference.</p>
 
<p class="image-wrapper">
 
<p class="image-wrapper">
</html> [[undefined:Toronto_2015_biobrick plasmid.png]] <html>
+
</html> [[File:Toronto_2015_biobrick plasmid.png]] <html>
 
</p>
 
</p>
  
 
<p>We also used BioBricks from the registry to design plasmids with different efficiencies by using RDP kit as shown below. In this process, we used promoter BBa_J23102 and RBS BBa_B0030.</p>
 
<p>We also used BioBricks from the registry to design plasmids with different efficiencies by using RDP kit as shown below. In this process, we used promoter BBa_J23102 and RBS BBa_B0030.</p>
 
<p class="image-wrapper">
 
<p class="image-wrapper">
</html> [[undefined:Toronto_2015_TodEplasmid.png]] <html>
+
</html> [[File:Toronto_2015_TodEplasmid.png]] <html>
 
</p>
 
</p>
  
 
<p class="image-wrapper">
 
<p class="image-wrapper">
</html> [[undefined:Toronto_2015_TodFplasmid.png]] <html>
+
</html> [[File:Toronto_2015_TodFplasmid.png]] <html>
 
</p>
 
</p>
  

Revision as of 07:17, 24 October 2015

Toluene Degradation and Our Project

Pseudomonas putida F1 species degrades toluene with the help of the tod operon. Toluene dioxygenase and toluene cis-dihydrodiol dehydroxygenase transcribed from todC1C2BA and todD genes, respectively, facilitate the breakdown of toluene to 3-methylcatechol. Gerben J. Zylstra et al. successfully constructed the plasmid pTDG602 containing todC1C2BAD genes. To achieve complete degradation of toluene down to carbon dioxide and water, we focused on designing a plasmid containing todE and todF genes. After cotransformation of DH10B cells with pTDG602 and our plasmid, E.Coli should theoretically contain all the genes required to achieve complete degradation.

Toronto 2015 Pathway.png

Submitted Part: TodE BioBrick (BBa_K1760001)

Final submitted biobrick is a coding sequence that contains a TetO promoter, RBS optimized by using Salis RBS caluclator and codon optimized todE gene for E.Coli. It plays a major role in degradation of toluene. Specifically, todE degrades 3-methylcatechol, a highly toxic intermediate into HOD. In pseudomonas putida species, HOD is aerobically metabolized through TCA cycle. Theoretically, a E.Coli MG1655 type bacteria containing todC1C2BADEF genes can degrade toluene through TCA cycle by using its own native enzymes.

This part is ordered in gene blocks and ligated by using Gibson Assembly by using . The design have been performed by Anthony Zhao, Seray Cicek, Umar Owadally, Katariina Jaenes, Matt D'lorio, ChungMin Lee, Drupad Rajyaguru who are wet lab team members of the iGEM Toronto 2015 team. See our part in the the registry: http://parts.igem.org/Part:BBa_K1760001

Toronto 2015 TodE-plasmid new.jpg

Additional Designs in Progress

In order to achieve complete degradation of toluene, we also constructed a codon optimized todF sequence. We tried to create a ligated plasmid containing todE, todF, optimized Salis RBS calculator and a tunable promoter to determine optimum transcription for DH10B cells. We used Ligase Cycling Reaction(LCR) in this process. Unique Nucleotide Sequences are added to ligating blocks to facilitate assembly of the plasmid without a secondary structure interference.

Toronto 2015 biobrick plasmid.png

We also used BioBricks from the registry to design plasmids with different efficiencies by using RDP kit as shown below. In this process, we used promoter BBa_J23102 and RBS BBa_B0030.

Toronto 2015 TodEplasmid.png

Toronto 2015 TodFplasmid.png

Note: Links to iGem registry BBa_J23102: http://parts.igem.org/Part:BBa_J23102 BBa_0030: http://parts.igem.org/Part:BBa_B0030

  • Sequence for BBa_K1760001 :
  • tactagtagcggccgctgcagtccggcaaaaaagggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgttatgcaggct tcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggata acgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacga gcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcct gttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgt aggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctca gtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatc taaagtatatatgagtaaacttggtctgacagctcgaggcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagat ggagttctgaggtcattactggatctatcaacaggagtccaagcgagctcgatatcaaattacgccccgccctgccactcatcgcagtactgttgtaatt cattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcc catggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattc tcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcac tccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacg aaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaata tccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatc cagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagtt ggaacctcttacgtgcccgatcaactcgagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggca gaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcgggctgggagttcgtagacggaaacaaacgcatccctatcagtg atagagattgacatccctatcagtgatagagatactgagcacacggataaggaggtaagttatgcatcaccaccatcaccatggcagtggcagcattcag aggctaggctatctaggattcgaagtcgccgatgtgcgctcctggaggaccttcgcgaccacccgcctaggcatgatggaagccagcgcaagcgaaaccg aagcgacctttcgcattgatagccgcgcttggcgcctcagcgtcagccgcggcccggctgatgattatctgttcgcgggttttgaagtggatagcgaaca aggccttcaggaagtgaaagaaagcctccaggcgcatggcgtcaccgtgaaagtggaaggcggcgaactgattgctaaacgcggcgtgctgggtctgatc agctgcaccgatccgtttggcaaccgcgtggaaatttattacggtgcgaccgaactgtttgaacgcccgttcgcgagcccgacaggcgtgagtggttttc agaccggcgatcagggactgggccattatgtgctaagcgtggcagatgtggatgcggcgctggcgttttataccaaagcgctgggctttcagctggcgga tgtgattgattggaccattggcgatggcctgagcgtgaccctgtattttctgtattgcaacgggcgccatcatagcttcgcgtttgcgaaactgccgggc agcaaacgcctgcatcattttatgctccaggcgaacggcatggatgatgtgggcctggcgtatgataagtttgatgcggaacgcgcggtggtgatgagcc tgggccgccataccaacgatcatatgattagcttttatggcgcgaccccgagcggctttgcggtggaatatggctggggcgcgcgcgaagtgacccgcca ttggagcgtggtgcgctatgatcgcattagcatttggggccataaatttcaggcgccggcgtaataataacattactcgcatccattctcaggctgtctc g