Template:Team:Groningen/CONTENT/EXPERIMENTS/Colony PCR thrC locus 2 (th18)

00:00, 4 September 2015 - 00:00, 4 September 2015

Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.

Primer

Sequence

IGEM thrC forward

AATTCATGTAAAAGATGAGGTTGGTTCATT

iGEM erm-thrC rev 2

AGGAAGTTAAAGGAGCTCGAATTAATTCC

Used primers.

The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.

Marieke Mulder