PCR was performed with the forward and the new reverse primer for Psalt (figure 1) and a annealing temperature of 55°C and extention time of 60 seconds. PCR product was checked and purified on 1% agarose gel with 1:50000 SERVA DNA Stain G. Gel results show a band at approximately 600bp.
Template:Team:Groningen/CONTENT/LOGBOOK/Psalt PCR zp29
Psalt PCR (zp29)
A PCR is done to get the DNA of the salt inducible promotor out of the genomen of B. subtilis 168. A new reverse primer was designed because the old one had the suffix the wrong way around.
To create a salt inducible promotor.
PCR was successful.
<a class="postscriptum protocol" href="https://2015.igem.org/Team:Groningen/Protocols_and_Protocols/PCR">PCR</a>
00:00, 16 August 2015 - 00:00, 16 August 2015
Primer
Sequence
salt primer 2 for
CCAGTGAATTCGCGGCCGCTTCTAGAGGTCTGAATTTAAAGAGATTGGTTTTAAACC
salt primer 2 rev
GGGATCCTGCAGCGGCCGCTACTAGTAGATCCTGCTCCTATAAAGGCTACTTTCTTT
Primer sequences