View source for Team:Czech Republic/Project/Synthetic haploids

{{:Team:Czech_Republic/Template:Top|Signal transduction}}
__TOC__

<html>
<div class="left">
</html>

= Overview =

<html>
</div>
<div class="right">
</html>

= Key Achievements =

Key Achievement #1
Key Achievement #2

<html>
</div>
</html>

== Introduction: Yeast pheromone pathway==
[[File:Czech Republic Hapdip.png|600px|thumb|right|text]]
Yeast Saccharomyces cerevisiae exists either in haploid or diploid state. The two mating types are called MATa and MATα and differ only within approx. 2 kbp long region on chromosome III called MAT locus. MATa locus expresses 
transcription factors a1 and a2, whereas MATα locus expresses transcription factors α1 and α2. Both types express three groups
of genes, which are:

*haploid-specific genes (h-sg)
*a-specific genes (a-sg)
*α-specific genes (α-sg)
 
As their names indicate, these genes are only active in haploids, MATa cells, or MATα cells, respectively. 

Both mating types constantly produce small amounts of mating type-specific pheromone and when the two cells of opposite types are in close proximity they identify each other by sensing each other’s pheromone. The response to detected pheromone is facilitated by so called pheromone pathway, which is a cascade of chemical reactions that results in the preparation for mating. Since only haploids mate, the yeast pheromone pathway is only functional in haploid cells.

==Design: Reconstruction of yeast pheromone pathway in diploid cell ==
[[File:Czech Republic MAPK1.png|200px|thumb|right|text]]
The schematic shows that h-sg genes are switched-off in diploid cell and since all genes included in yeast pheromone pathway signal transduction (except from the pheromone receptor)are h-sg, the pathway can be reconstructed by switching them on. It can be managed by interrupting one of the h-sg regulators - a1 or α2. While a1 has no function in haploid, its deletion has no effect in haploid cell, but in diploid it interrupts the repression of h-sg.
[[File:Czech Republic DiploidSynt.png|200px|thumb|left|Hello wiki people]]
Naturally in haploids, after exposure to mating pheromone yeast pheromone pathway results in induction of expression of mating genes that initiate the mating process. Since it is not desired for the synthetic diploid to mate, the initiation of mating process needs to be disrupted. It can be achieved by repressing Ste12 transcription in the diploid. While Ste12 is fundamental in both haploid types in the process of mating, the designed mechanism must preserve transcription in haploid cells and repress it in diploid.


For this purpose, mechanism of tetracycline-controlled transcriptional activation was used: a1 gene in MATa was replaced by TetR and STE12 was put under the control of synthetic a-specific promoter that is repressed in the same way as a-sg. In MATα, α1 repression was preserved by placing it under the control of pTet and STE12 was also put under the control of pTet. As a result, transcription of Ste12 is preserved in both haploids and repressed in diploid - pTet-STE12 thanks to TetR repressor that is expressed from MATa chromosome, and a-specific STE12 thanks to α2. Also h-sgare expressed because of disruptedrepression by deleting a1 preserving transcription of all the genes forming yeast pheromone pathway.

See following pages for detailed information about constructing the synthetic haploids:
*[[Team:Czech_Republic/Project/Signal_transduction/Matalpha | MATα]]
*[[Team:Czech_Republic/Project/Signal_transduction/Mata | MATa]]



== Concept ==

== DNA ==

= Materials and methods =

== Used strains ==

==Used material==

# LB-M agar plates with chloramphenicol
# LB-M agar plates with ampicillin
# 1.5 ml eppendorf tubes
# 0.5 ml PCR tubes
# 50 ml centrifuge conical base and rim tubes
# NucleoSpin Plasmid DNA, RNA, and protein purification Kit
# NucleoSpin Gel and PCR Clean-up Kit
# LB-M medium with chloramphenicol
# NaOH agarose gel and buffer
# Sphero Rainbow Calibration Particles, 8 Peaks, 3.0-3.4

== Used methods ==

# Transformation
# Miniprep
# Restriction digest
# Ligation
# NucleoSpin Gel Clean-up
# NucleoSpin Plasmid DNA purification
# Flow cytometry


All used protocols can be found here:
[[ Team:Czech_Republic/Protocols | Protocols  ]]

==Used software==

# CFlow Plus
# Microsoft Excel
# Sphero PMT QC Template

== Construction ==

=== Construction of reporter plasmids ===

The pADH1, pSTE2, pSTE5, and pFUS1 promoters were obtained by PCR from yeast genome (isolated according to standard protocol from 7283 MATx strain). The asCYC1 and pTv3 promoters were obtained by PCR from g-blocks. The primers used for this are as follows:


''INSERT TABLE OF PRIMERS''


All promoters were amplified in a single PCR run, with the following conditions:

{| class="wikitable"
|-
! scope="col"| Property
! scope="col"| Value 
|-
! scope="row"| Polymerase
| Q5
|-
! scope="row"| Extension Time
| 90s
|}


PCR products were then gel verified


''INSERT PHOTO_1''



and were then purified (insert purification kit name) and restricted by corresponding restriction enzymes, which are listed in the following table


''INSERT TABLE OF RESTRICTION ENZYMES''


The corresponding vector for reporter plasmids was prepared by restriction and ligation of yeGFP and CYC1 terminator into a pRS416 CEN plasmid.

=== Construction of INSERT MATa and INSERT MATx ===

The backbone pRSII406 was obtained from Addgene. MATa was ordered in the form of gblock yG_MATa with sequence

'''yG_MATa :'''

<pre>AATTCATCTAGAGAAGAAAGCAAAGCCTTAATTCCAAGGAAAAAGAAGAAGTTGCAAAGAAATGTGGCATTACTCCACTTCAAGTAAGAGTTTGGGTATGTAATATGAGAATCAAACTTAAATATATCCTATACGTAGTATGGCGGAAAACATAAACAGAACTCTGTTTAACATTCTAGGTACTGAGcaaattaaagccttcgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactataaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtggggggagggcgtgaatgtaagcgtgacataactaatCTAAAATTCCCGGGATCCGCTGTACGCGGACCCACTTTCACATTTAAGTTGTTTTTCTAATCCGCATATGATCAATTCAAGGCCGAATAAGAAGGCTGGCTCTGCACCTTGGTGATCAAATAATTCGATAGCTTGTCGTAATAATGGCGGCATACTATCAGTAGTAGGTGTTTCCCTTTCTTCTTTAGCGACTTGATGCTCTTGATCTTCCAATACGCAACCTAAAGTAAAATGCCCCACAGCGCTGAGTGCATATAATGCATTCTCTAGTGAAAAACCTTGTTGGCATAAAAAGGCTAATTGATTTTCGAGAGTTTCATACTGTTTTTCTGTAGGCCGTGTACCTAAATGTACTTTTGCTCCATCGCGATGACTTAGTAAAGCACATCTAAAACTTTTAGCGTTATTGCGTAAAAAATCTTGCCAGCTTTCCCCTTCTAAAGGGCAAAAGTGAGTATGGTGCCTATCTAACATTTTAATAAGTTGATTGTATGCTTGGTATAGCTTGAAATATTGTGCAGAAAAAGAAACAAGGAAGAAAGGGAACGAGAACAATGACGAGGAAACAAAAGATTAATAATTGCAGGTCTATTTATACTTGATAGCAAGACAGCAAACTTTTTTTTATTTCAAATTCAAGTAACTGGAAGGAAGGCCGTATACCGTTGCTCATTAGAGAGTAGTGTGCGTGAATGAAGGAAGGAAAAAGTTTCGTGTGCTTCGAGATACCCCTCATCAGCTCTGGAACAACGACATCTGTTGGTGCTGTCTTTGTCGTTAATTTTTTCCTTTAGTGTCTTCCATCATTTTTTTGTCATTGCGGATATGGTGAGACAACAACGGGGGAGAGAGAAAAGAAAAAAAAAGAAAAGAAGTTGtaaacccacaccgggtgtcataatcaaccaatcgtaacttcatctcttccacccatgtctctttgagcaataaagccgataacaaaatctttgtcgctcttcgcaatgtcaacagtacccttagtatattctccagtagatagggagcccttgcatgacaattctgctaacatcaaaaggcctctaggttcctttgttacttcttctgccgcctgcttcaaaccgctaacaatacctggTccACTAGTCCCGGGAGCAAGATCAAGATGTTTTCACCGATCTTTCCGGTCTCTTTGGCCGGGGTTTACGGACGATGGCAGAAGACCAAAGCGCCAGTTCATTTGGCGAGCGTTGGTTGGTGGATCAAGCCCACGCGTAGGCAATCCTCGCAGATCTCGAACCATGTAATTTCCGAATACGGTAATTACACGCATCGAGCAGATCCGCCAGGCGTGTATATATAGCGTGGATGGCCAGGCAACTTTAGTGCTGACACATACAGGCATATATATATGTGTGCGACGACACATGATCATATGGCATGCATGTGCTCTGTATGTATATAAAACTCTTGTTTTCTTCTTTTCTCTAAATATTCTTTCCTTATACATTAGGACCTTTGCAGCATAAATTACTATACTTCTATAGACACACAAACACAAATACACACACTAAAaagctt</pre>

MATx was ordered in the form of two g-blocks, yG_MATx1 and yG_MATx2 with the following sequences

'''yG_MATx1 :'''

<pre>AAGCTTGGATTCTCACAATCCTGTCGGTCACTTCTCGGCTGTTCGCGTATATTTTTTGTTGATACTTTTACCGGTATTTTGTCTGTAATTTATTCTCTATCACTGATAGGGACTTCTCTATCACTGATAGGGAACCCAGCCTGATTTATACTATTAGGGATCGCAGGAAGGCGGTGGGAAGTCCGGGAGTCGCTGAGGGGAAGTGTCAGTGGTTTTGGGTATAAATGGCTGGTTGTTCCCTATCAGTAATAGAGAATTCCCTATCAGTGATAGAGACTGCGGATTTAGAAACTACCTGATAAAAGTATCAACAAAAATTGCGCATGCCGGCCTGGATTTTGCGCAAATTTACCTTAACGTCCCACAATATGTTTACTTCGAAGCCTGCTTTCAAAATTAAGAACAAAGCATCCAAATCATACAGAAACACAGCGGTTTCAAAAAAGCTGAAAGAAAAACGTCTAGCTGAGCATGTGAGGCCAAGCTGCTTCAATATTATTCGACCACTCAAGAAAGATATCCAGATTCCTGTTCCTTCCTCTCGATTTTTAAATAAAATCCAAATTCACAGGATAGCGTCTGGAAGTCAAAATACTCAGTTTCGACAGTTCAATAAGACATCTATAAAATCTTCAAAGAAATATTTAAACTCATTTATGGCTTTTAGAGCATATTACTCACAGTTTGGCTCCGGTGTAAAACAAAATGTCTTGTCTTCTCTGCTCGCTGAAGAATGGCACGCGGACAAAATGCAGCACGGAATATGGGACTACTTCGCGCAACAGTATAATTTTATAAACCCTGGTTTTGGTTTTGTAGAGTGGTTGACGAATAATTATGCTGAAGTACGTGGTGACGGATATTGGGAAGATGTGTTTGTACATTTGGCCTTATAGAGTGTGGTCGTGGCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTATCCTATTTGAAACTCCCCATCGTCTTGCTGCAG</pre>

'''yG_MATx2 :'''

<pre>CTGCAGAGTAGTGTCTGAGGTACAAACATCTTAGTAGTGTCGAGAGGGTTGATTGTTTATGTATTTTTGCGAAATATATATATATATATTCTACACAGATATATACATATTTGTTTTTCGGGCTCATTCTTTCTTCTTTGCCAGAGGCTCACCGCTCAAGAGGTCCGCTAATTCTGGAGCGATTGTTATTGTTTTTTCTTTTCTTCTTCTATTCGAAACCCAGTTTTTGATTTGAATGCGAGATAAACTGGTATTCTTCATTAGATTCTCTAGGCCCTTGGTATCTAGATATGGGTTCTCGATGTTCTTTGCAAACCAACTTTCTAGTATTCGGACATTTTCTTTTGTAAACCGGTGTCCTCTGTAAGGTTTAGTACTTTTGTTTATCATATCTTGAGTTACCACATTAAATACCAACCCATCCGCCGATTTATTTTTCTGTGTAAGTTGATAATTACTTCTATCGTTTTCTATGCTGCGCATTTCTTTGAGTAATACAGTAATGGTAGTAGTGAGTTGAGATGTTGTTTGCAACAACTTCTTCTCCTCATCACTAATCTTACGGTTTTTGTTGGCCCTAGATAAGAATCCTAATATATCCCTTAATTCAACTTCTTCTTCTGTTGTTACACTCTCTGGTAACTTAGGTAAATTACAGCAAATAGAAAAGAGCTTTTTATTTATGTCTAGTATGCTGGATTTAAACTCATCTGTGATTTGTGGATTTAAAAGGTCTTTAATGGGTATTTTATTCATTTTTTCTTAGTGTGTGTATTTGTATTTGCGTGTCTATAGAAGTATAGTAATTTATGCTGCAAAGGTCCTAATGTATAAGGAAAAAAAATTTAGAGAAAAAAAGAAAAAAAGAGTTTTATATACATACAGAGCACATACATGCCATATAATCATGTATATACGCGCACATATATATATGCCTGTATGTGTCAGCACTAAATTTACCTGAACATACGCGCTATATATACGCGCCTCGCGTATATGCTCGAGGATTCCCTACGCGTGGGCTTTTTTTACTAACCAACGCGCGCGAAATActagt</pre>

The g-blocks were restricted by the following enzymes, along with the vector


''insert table 1''

Restriction were purified (insert purification kit name) and ligated together using the standard ligation protocol.


STE12 was PCR amplified from yeast genome (isolated from 7283 MATx strain) using the following primers :

Forward : CTTGTAAAGCTTCCAAGGATGAAAGTCCAAATAACCAATAGTAGAACA
Reverse : ACTGCACTCGAGAGATTTGTTACATTTATTACCTTTTTTTCTTGCTTT

The conditions for the PCR were the following

= Results =

== Final constructs ==

Herein we should describe the final constructs we have obtained, and add verification gels etc.


== Test of mating types ==

= Appendix =

== Personnel ==

Tereza Puchrová - The leading scientist

Hynek Kasl - The helping hand

Anna Sosnová - The actual worker

Václav Pelíšek - The parafilmer of plates

== Useful Links ==
Protocols page:

[[Team:Czech_Republic/Protocols | Protocols]]

== References ==

<ol>
<li>{{:Team:Czech_Republic/Template:Reference|Lin2011|Lin, C.-H., Choi, a., & Bennett, R. J. (2011). Defining pheromone-receptor signaling in Candida albicans and related asexual Candida species. Molecular Biology of the Cell, 22(24), 4918–4930. doi:10.1091/mbc.E11-09-0749}}</li>
</ol>


{{:Team:Czech_Republic/Template:Bottom}}