Difference between revisions of "Team:SPSingapore/home"

Line 1,120: Line 1,120:
 
             </table>
 
             </table>
 
             <div id = "calendarStorage">
 
             <div id = "calendarStorage">
 +
     
 
       <!-- 25_05 -->
 
       <!-- 25_05 -->
 
                     <div id = "25_05">
 
                     <div id = "25_05">
Line 1,149: Line 1,150:
 
                           <p>Inoculate single colony of invasin plasmid carrying bacteria in 3mL LB+amp                          </p>
 
                           <p>Inoculate single colony of invasin plasmid carrying bacteria in 3mL LB+amp                          </p>
 
                       <p>Transformation of 13L repeated with 1ul of DNA. </p>
 
                       <p>Transformation of 13L repeated with 1ul of DNA. </p>
−
                    </div>
+
              </div>
 
                     <!-- 29_05 -->
 
                     <!-- 29_05 -->
 
               <div id = "29_05">
 
               <div id = "29_05">
Line 1,156: Line 1,157:
 
                 <p>No colonies grew for 13L on all plates ->adjust incubator, make new media
 
                 <p>No colonies grew for 13L on all plates ->adjust incubator, make new media
 
                 </p>
 
                 </p>
−
                       <p>Miniprep of inoculated bacteria for invasin plasmid                      </p>
+
                       <p>Miniprep of inoculated bacteria for invasin plasmid, incubate sample in 37degC for 1h 20min                     </p>
−
                <p>RE of invasin plasmid:
+
                      <table width="100%" border="2" cellpadding="2">
−
                         RsaI 1ul,
+
                        <tr>
−
                         EcoRI 1ul,
+
                          <th scope="col">RE of invasin plasmid</th>
−
                         INv plasmid 7.5ul,
+
                          <th scope="col">RE control</th>
−
                        H20 35.5ul,
+
                         </tr>
−
                         NEB buffer 4 5ul,
+
                        <tr>
−
                         37degC for 1h 20min                        </p>
+
                          <td>Rsal 1ul</td>
−
                <p>RE control:
+
                          <td>Rsal 0 ul</td>
−
                         RsaI 0ul,
+
                         </tr>
−
                         EcoRI 0ul,
+
                        <tr>
−
                        Inv plasmid 7.5ul,
+
                          <td>EcoRI 1 ul</td>
−
                        H2O 37.5ul,
+
                          <td>EcoRI 0 ul</td>
−
                BUffer 4 5ul </p>
+
                         </tr>
 +
                        <tr>
 +
                          <td>INv plasmid 7.5ul</td>
 +
                          <td>Inv plasmid 7.5 ul</td>
 +
                         </tr>
 +
                         <tr>
 +
                          <td>H2O 35.5 ul</td>
 +
                          <td>H2O 37.5 ul</td>
 +
                         </tr>
 +
                         <tr>
 +
                          <td>NEB buffer 4.5 ul</td>
 +
                          <td>Buffer 4.5 ul</td>
 +
                        </tr>
 +
                      </table>
 +
                      <p>&nbsp;</p>
 
                       <p><img src="notebookPicture/29_05.png" width="466" height="322" alt="29_05_gelRun"></p>
 
                       <p><img src="notebookPicture/29_05.png" width="466" height="322" alt="29_05_gelRun"></p>
 
                       Repeat transformation of 13L with 1ul
 
                       Repeat transformation of 13L with 1ul
  
 +
              </div>
 +
              <!-- 30_05 -->
 +
                    <div id = "30_05">
 +
                        <p><strong>Xin Yi and Yi Han</strong></p>
 +
                        <p>Miniprep of EsaR/I plasmid for 4 colonies                          </p>
 +
                        <p>Restriction digest for EsaR with XbaI/BamHI                        </p>
 +
                        <table width="100%" border="2" cellpadding="2">
 +
                          <tr>
 +
                            <th scope="col">RE reaction</th>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>5ul plasmid</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>5ul buffer</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>1ul XbaI</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>1ul BamHI</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>Add H2O to 50ul </td>
 +
                          </tr>
 +
                      </table>
 +
                    </div>
 +
                    <!-- 31_05 -->
 +
                    <div id = "31_05">
 +
                      <p><strong>Xin Yi                    </strong></p>
 +
                      <p>Sent EsaR clone 4 and INv-4 for sequencing. </p>
 +
                    </div>
 +
                    <!-- 2_06 -->
 +
                    <div id = "02_06">
 +
                    <strong>Yi Han</strong>
 +
<p>YFP and GFP transformation results - no colonies for YFP                        </p>
 +
                      <p>The GFP transformation repeated with 100ng of plasmid was sucessful.</p>
 +
                      <p> 4 colonies of gfp plasmid were inoculated in 3mL LB+amp and grown overnight. </p>
 +
                    </div>
 +
                    <!-- 3_06 -->
 +
                    <div id = "03_06">
 +
                    <strong>Yi Han</strong>
 +
<p>Miniprep of gfp plasmids                    </p>
 +
                      <p>RE digest with EcoRI and RsaI </p>
 +
                    </div>
 +
                    <!-- 4_06 -->
 +
                    <div id = "04_06">
 +
                      <strong>Chi Yan</strong><br>
 +
                    RE digest indicated a very faint smaller band for colonies 2-4, and hence these were likely to be positive clones
 +
                    </div>
 +
                    <!-- 5_06 -->
 +
                    <div id = "05_06">
 +
                    <p><strong>Yanting</strong>
 +
                      </p>
 +
                    <p>Inoculated 3mLS of Inv-4 and EsaR-4 plasmid carrying bacteria into 100mL LB+ appropriate Antibiotic
 +
                      </p>
 +
                    <p>Cell culture-> HEK293 cells revived from freezing down appeared detached.
 +
                     
 +
                    </p>
 +
                    </div>
 +
                    <!-- 6_06 -->
 +
                    <div id = "06_06">
 +
                      <p><strong> Yi Han + Yanting</strong>
 +
                    </p>
 +
                      <p>Storage of bacterial glycerol stocks for Inv-4, EsaR4 in 25% glycerol                        </p>
 +
                      <p>Yanting: grew HEK293T cells in T25 glask                        </p>
 +
                      <p>Gel extract to clean up gfp plasmids which loading dye had accidentally been added to. </p>
 +
                    </div>
 +
                    <!-- 8_06 -->
 +
                    <div id = "08_06">
 +
                      <p><strong>Yi Han</strong></p>
 +
                      <p> Miniprep of gfp plasmids, preparation of samples for sequencing </p>
 +
                    </div>
 +
                    <!-- 9_06 -->
 +
                    <div id = "09_06">
 +
                      <p><strong>Yi Han                    </strong></p>
 +
                      <p>All gfp plasmids had a correct sequence                        </p>
 +
                      <p>Yunting kept glycerol stocok for all, and inoculation of 3mL of gfp3 into 100mL LB+amp for midiprep </p>
 +
                    </div>
 +
                    <!-- 10_06 -->
 +
                    <div id = "10_06">
 +
                      <p><strong>Yi Han + Yunting                    </strong></p>
 +
                      <p>Midiprep of gfp plasmid
 +
                        PCR of gfp with KpnI-gfp and XhoI-gfp primers </p>
 +
                    </div>
 +
                    <!-- 11_06 -->
 +
                    <div id = "11_06">
 +
                      <p><strong>Yunting + Duy
 +
                      </strong></p>
 +
                      <p>Nanodrop of gfp product-> 595.5ng/ul
 +
                      </p>
 +
                      <p>RE digest of EsaR vector with KpnI/XHoI                        </p>
 +
                      <p>Gel electrophoreseis at 1000V for 30min                        </p>
 +
                      <p>Gel extraction: 3.9ng/ul and 6.9ng/ul for Esa fragment and GFP --&gt; low yield</p>
 +
                    </div>
 +
                    <!-- 12_06 -->
 +
            <div id = "12_06">
 +
              <p><strong>Yunting                    </strong></p>
 +
                <p>Gel extraction using Promega binding solution to melt gel, followed by thermo scientific kit</p>
 +
                <p><strong>Adrian</strong> </p>
 +
                      <p dir="ltr">Gel extraction optimisation</p>
 +
                      <p dir="ltr">Hypothesised that the Binding buffer has a problem/DNA does not bind to column</p>
 +
                      <p dir="ltr">1: 2X promega binding buffer volume</p>
 +
                      <p dir="ltr">2: Increase incubation time for binding to 5min</p>
 +
                      <p dir="ltr">Switch binding buffer to that of thermo scientific PCR purification kit</p>
 +
                      <p dir="ltr">Use sodium acetate if available? TO facilitate stronger binding to column</p>
 +
                      <p dir="ltr">Results</p>
 +
                      <p dir="ltr">1: ~10ng/ul</p>
 +
                      <p dir="ltr">2: ~9ng/ul</p>
 +
                      <p dir="ltr">not succesful</p>
 +
                      <p dir="ltr">further optimisation-&gt; warm buffer, incubate for 5min</p>
 +
                      <p dir="ltr">elute in 30/20ul smaller volumes<br>
 +
                    </p>
 +
            </div>
 +
                    <div id = "13_06">
 +
                      <p dir="ltr"><strong>Yihan</strong></p>
 +
                      <p dir="ltr">1: Thermoscientific miniprep columns with 2XThermoscientific binding buffer</p>
 +
                      <p dir="ltr">2: Thermoscientific PCR purification kit 2X buffer</p>
 +
                      <p dir="ltr">3: Promega kit 2X buffer</p>
 +
                      <br>
 +
                  </div>
 +
                  <!-- 14_06-->
 +
                    <div id = "14_06">
 +
                      <p><strong>Yihan </strong></p>
 +
                      <ul>
 +
                        <p><strong>PCR </strong>(mastermix: 8)</p>
 +
                        <table width="100%" border="2" cellpadding="2">
 +
                          <tr>
 +
                            <th scope="col">Reagent</th>
 +
                            <th scope="col">Amount</th>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>PCR buffer</td>
 +
                            <td>10 ul * 8 = 8-ul</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>primers</td>
 +
                            <td>0.8ul, 0.8ul </td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>DNA polymerase</td>
 +
                            <td>4ul</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>dH2O</td>
 +
                            <td>61.75 * 8 = 494ul</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>Templates</td>
 +
                            <td>5.55*7 = 38.75ul</td>
 +
                          </tr>
 +
                        </table>
 +
                        <p><strong>Digest more plasmid (Esa plasmid) </strong></p>
 +
                        <p> 4 rxns ( KpnI/XhoI digest) 50ul each </p>
 +
                        <table width="100%" border="2" cellpadding="2">
 +
                          <tr>
 +
                            <th scope="col">Reagent</th>
 +
                            <th scope="col">Amount</th>
 +
                          </tr>
 +
                          <tr>
 +
                            <td>Buffer</td>
 +
                            <td>&nbsp;</td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td><p dir="ltr">KpnI</p></td>
 +
                            <td><p dir="ltr">2ul</p></td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td><p dir="ltr">XhoI</p></td>
 +
                            <td><p dir="ltr">2ul</p></td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td><p dir="ltr">DNA</p></td>
 +
                            <td><p dir="ltr">34.8ul</p></td>
 +
                          </tr>
 +
                          <tr>
 +
                            <td><p dir="ltr">H2O</p></td>
 +
                            <td><p dir="ltr">141.2ul</p></td>
 +
                          </tr>
 +
                        </table></ul>
 +
                      <p>&nbsp;</p>
 +
                    </div>
 +
            <div id = "15_06">
 +
              <p><strong>Yihan</strong></p>
 +
              <p><strong>PCR </strong></p>
 +
              <p>RP_XhoI_GFP and FP_KpnI_GFP with GFP midiprep </p>
 +
              <p>For 15 reactions with control .: Mastermix * 17 </p>
 +
              <table width="100%" border="2" cellpadding="2">
 +
                <tr>
 +
                  <th scope="col">Reagent</th>
 +
                  <th scope="col">Amount</th>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">PCR buffer</p></td>
 +
                  <td><p dir="ltr">170ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">primers</p></td>
 +
                  <td><p dir="ltr">1.7ul, 1.7ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">dNTP</p></td>
 +
                  <td><p dir="ltr">34 ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">DNA polymerase</p></td>
 +
                  <td><p dir="ltr">8.5 ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">dH2O</p></td>
 +
                  <td><p dir="ltr">66.3*17 = 1127.1ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">templates</p></td>
 +
                  <td><p dir="ltr">17ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">total</p></td>
 +
                  <td><p dir="ltr">1360ul</p></td>
 +
                </tr>
 +
              </table>
 +
              <h3 dir="ltr"><strong>PCR protocol &ldquo;GFP 1&rdquo; (32 cycles)</strong></h3>
 +
              <h3 dir="ltr"><strong>GFP PCR product -&gt; 448ng/ul            </strong></h3>
 +
              <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-452f-67d8-ffd1-fb8e413164b0">Gel extraction</strong></p>
 +
              <p dir="ltr">Qiagen gel extraction kit at MBI</p>
 +
              <p dir="ltr">Esa gel band from 14/6</p>
 +
              <p dir="ltr">Nanodrop: 16.4 ng/ul, 260/280 = 2.60</p>
 +
              <strong id="docs-internal-guid-934bc9f1-4530-4a77-d62e-62ecf5445432">
 +
              <p dir="ltr">Plasmid construction</p>
 +
              </strong>
 +
              <ul>
 +
                <li dir="ltr">
 +
                  <p dir="ltr">RE digest (KpnI, XhoI)</p>
 +
                </li>
 +
                <li dir="ltr">
 +
                  <p dir="ltr">3 Replicates of the following</p>
 +
                </li>
 +
              </ul>
 +
              <table width="100%" border="2" cellpadding="2">
 +
                <tr>
 +
                  <th scope="col">Reagent</th>
 +
                  <th scope="col">Amount</th>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">DNA</p></td>
 +
                  <td><p dir="ltr">2.6ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">Buffer</p></td>
 +
                  <td><p dir="ltr">5ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">H2O</p></td>
 +
                  <td><p dir="ltr">41.5ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">KpnI</p></td>
 +
                  <td><p dir="ltr">0.5ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">XhoI</p></td>
 +
                  <td><p dir="ltr">0.5ul</p></td>
 +
                </tr>
 +
              </table>
 +
              <br>
 +
              <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-4532-aecd-1923-3e0b25b1a403">Ligation (2x reaction) 40ul</strong></p>
 +
              <table width="100%" border="2" cellpadding="2">
 +
                <tr>
 +
                  <th scope="col">Reagent</th>
 +
                  <th scope="col">Amount</th>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">10X T4 DNA ligase buffer</p></td>
 +
                  <td><p dir="ltr">4ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">Vector DNA (16ng/ul) </p></td>
 +
                  <td><p dir="ltr">100ng -&gt; 6.25ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">insert DNA </p></td>
 +
                  <td><p dir="ltr">75nl -&gt; 12 ul </p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">T4 DNA Ligase</p></td>
 +
                  <td><p dir="ltr">2ul</p></td>
 +
                </tr>
 +
                <tr>
 +
                  <td><p dir="ltr">H2O</p></td>
 +
                  <td><p dir="ltr">16ul</p></td>
 +
                </tr>
 +
              </table>
 +
              <p dir="ltr">Note: ALL digested DNA in tube labeled lacGFP.ligation was used</p>
 +
              <p dir="ltr">Nanodrop of ligation: 1114.0ng/ul. 260/280 = 3.7</p>
 +
              <br>
 +
            </div>
 +
                    <div id = "16_06">
 +
                      <p><strong>Transformation
 +
                      </strong></p>
 +
                      <p>Transformation of ligated esa-GFP plasmid into DH5\alpha cells
 +
                      </p>
 +
                      <p>DH5\alpha ,<- unlabelled brown vial inside DH5\alpha box at -80</p>
 +
                      <blockquote>
 +
                        <p>  Plates spread at 11:40h                        </p>
 +
                      </blockquote>
 +
                      <p><strong>LB + chloroamphenicol                        </strong></p>
 +
                      <p>+4x (100ul) </p>
 +
                      <p>+10x (40ul) </p>
 +
                      <p>+20x (20ul) </p>
 +
                      <p>+LB - 20x (20ul) </p>
 +
                      <p>remaining transformed cells (~220ul) are kept at 4C</p>
 +
                      <p>--&gt; labeled as placGFP in brown tube                    </p>
 +
                    </div>
 +
                    <!--17_06-->
 +
                    <div id = "17_06">
 +
                      <p><strong>Oservation: </strong>only 4x placGFP plate has colonies (7)                        </p>
 +
                      <p>spread one new LB + chlor plate with 200ul of transformed bacteria                        </p>
 +
                      <p>picked 6 colonies to grow for miniprep in LB + chl liq media                        </p>
 +
                      <p><strong>Conclusion:                        </strong></p>
 +
                      <p>+protocol works                        </p>
 +
                      <p>+optimization for increase vol needed                        </p>
 +
                      <p><strong>cloning of synparts in amp vector</strong></p>
 +
                      <p>+comes as 4mg dry DNA                        </p>
 +
                      <p>+40ul of DI/RNAse free H20                        </p>
 +
                      <p>+for transformation, 150ml on wed</p>
 +
                      <Can’t tell?>
 +
 +
                    </div>
 +
                    <!--18_06-->
 +
                    <div id = "18_06">
 +
                      <p dir="ltr"><strong>Unknown</strong></p>
 +
                      <p dir="ltr"><strong>Miniprep of placGFP followed by RE digest (Kpn, XhoI): 50 ul total</strong></p>
 +
                      <table width="100%" border="2" cellpadding="2">
 +
                        <tr>
 +
                          <th scope="col">Reagent</th>
 +
                          <th scope="col">Amount</th>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Buffer</p></td>
 +
                          <td><p dir="ltr">2.5ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">KpnI</p></td>
 +
                          <td><p dir="ltr">&lt;ILLEGIBLE&gt;</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">XhoI</p></td>
 +
                          <td><p dir="ltr">&lt;ILLEGIBLE&gt;</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">DNA</p></td>
 +
                          <td><p dir="ltr">10</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">H2O</p></td>
 +
                          <td><p dir="ltr">12025</p></td>
 +
                        </tr>
 +
                      </table>
 +
                      <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-4554-de9f-2ea4-1efa0bb8416a">Colony PCR for synparts</strong> </p>
 +
                      <p dir="ltr">+ Failed</p>
 +
                      + No specific &lt;illegible&gt; produced
 +
                      <p>+ Might need optimization</p>
 +
                      <p dir="ltr">&nbsp;</p>
 +
                    <strong id="docs-internal-guid-934bc9f1-4553-bdaa-803c-8460144487de">            </strong></div>
 +
                    <!--19_06-->
 +
                    <div id = "19_06">
 +
                      <p><strong>Yihan                      </strong></p>
 +
                      <p>RE digest (XhoI, KpnI) of esa and GFP </p>
 +
                      <p><strong>Yunting</strong> </p>
 +
                      <p>Gel electrophoresis (100V, 40min)</p>
 +
                      <p>+ Lane 2: gpf: no bands </p>
 +
                      <p>+ Lane 3: 100bp ladder </p>
 +
                      <p>+ Lane 4: blank </p>
 +
                      <p>+ Lane 5: esa: 2 bands </p>
 +
                      <p>+ Lane 6: 1kb ladder </p>
 +
                      <p>+ Lane 7:blank </p>
 +
                      <p>&lt;Picture of gel&gt;</p>
 +
                    </div>
 +
                    <!--21_06-->
 +
                    <div id = "21_06">
 +
                      <p><strong>Optimizing gel extract protocol                </strong></p>
 +
                      <p>+ RE GFP from PCR (directly RE)              </p>
 +
                      <p>+ promega agarose 1% gel</p>
 +
                      <p> + add NaAC in binding buffer</p>
 +
                      <p> <strong>Result:</strong> </p>
 +
                      <p>+ yield for cut plasmid was 12.8ng/ul </p>
 +
                      <p>+ GFP was 8.6ng/ul</p>
 +
                      <p> <strong>Ligation reaction 6 reactions </strong></p>
 +
                      <table width="100%" border="2" cellpadding="2">
 +
                        <tr>
 +
                          <th scope="col">Reagent</th>
 +
                          <th scope="col">Amount</th>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Buffer</p></td>
 +
                          <td><p dir="ltr">12ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Vector</p></td>
 +
                          <td><p dir="ltr">30ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Insert</p></td>
 +
                          <td><p dir="ltr">30ul</p></td>
 +
                        </tr>
 +
                      </table>
 +
                      <p>&nbsp;</p>
 +
                      <p> + 6x ligation result transformed into competent DH5\alpha
 +
                        20 ul, 50ul, 100ul plated on LB + chl </p>
 +
                    </div>
 +
                    <!--23_06-->
 +
                    <div id = "23_06">
 +
                        <p><strong>Yunting</strong></p>
 +
                        <p><strong>Ligation of GFP tester plasmid.                  </strong></p>
 +
                        <p>Performed 4x ligation using RE- digested esa and GFP (CY, 22/6). Ligation rxn at room temperature for 30min instead of 10min.                  </p>
 +
                        <p>Included vector-only and insert-only controls.                  </p>
 +
                        <p>Stored in -20deg.                  </p>
 +
                        <p>Will run gel tmr. Insert only control should be same size as gfp product. Same for the other control. Can try to plate vector only to see re-ligation??                  </p>
 +
                        <p><strong>Nanodrop:                  </strong></p>
 +
                        <p>PlacGFP - 642.8ng/ul. 260/280=3.89</p>
 +
                        <p> Vector ctrl - 756.6ng/ul. 260/280=4.11</p>
 +
                        <p> Insert ctrl - 557 ng/ul. 260/280=3.86 </p>
 +
            </div>
 +
                    <!--25_06-->
 +
              <div id = "25_06">
 +
                <p><strong>Yanting</strong></p>
 +
                <p>Ran 0.8% pre-cast gel at 100V for 45min. </p>
 +
                <p>10ul of each sample to 2ul of loading dye. </p>
 +
                <p><strong>Gel lanes: </strong></p>
 +
                <p>100bp; uncut esa (used esa4 from -20); </p>
 +
                <p>pLacGFP; vector ctrl; insert ctrl; 1kb.                  </p>
 +
                <p><strong>[YH] Re-run gel.</strong> 35ul of each sample. No bands. </p>
 +
                <p>&lt;insert gel picture&gt;</p>
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-4578-e9aa-242f-73f4dc94cc3f">RE of esa and Gfp pcr product. </strong></p>
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-457a-7ead-b589-a735f588b766">Gel electrophoresis. </strong></p>
 +
                <p dir="ltr">Cast a thick 1% gel (60ml) with combined wells. [Don't need to cast thick gel next time, takes too long to melt]</p>
 +
                <p dir="ltr">Gel run at 100V, &nbsp;45min. Lanes: 100bp, esa, gfp 1&amp;2, 1kb </p>
 +
                Image after cutting is also saved.
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-457b-7c6c-4056-14590d25f13e">Gel extraction of RE esa &amp; gfp.</strong></p>
 +
                Used Promega kit, loaded both gfp bands into one column. Eluted with 30ul water for 5min before centrifugation.
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-457c-0a29-4143-410f5a206639">Nanodrop:</strong></p>
 +
                <p dir="ltr">Esa- 37.7ng/ul. 260/280= 1.83</p>
 +
                <p dir="ltr">Gfp - 25.1ng/ul. 260/280= 1.84</p>
 +
                <strong id="docs-internal-guid-934bc9f1-457c-4799-66ba-fc8406b4fa38">
 +
                <p dir="ltr">Overnight ligation</p>
 +
                </strong>
 +
                <p dir="ltr">6x ligation: </p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Buffer</p></td>
 +
                    <td><p dir="ltr">6ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Vector (37.7ng/ul)</p></td>
 +
                    <td><p dir="ltr">50ng = 7.8ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Insert (25.1ng/ul)</p></td>
 +
                    <td><p dir="ltr">37.7 ng = 6.6ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">H2O</p></td>
 +
                    <td><p dir="ltr">87.6ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Ligase</p></td>
 +
                    <td><p dir="ltr">6ul</p></td>
 +
                  </tr>
 +
                </table>
 +
                Ligation reaction run overnight in 16 deg hold in thermocycler - 15h, 8pm - 11am. <br>
 +
                <p dir="ltr">&nbsp;              </p>
 +
              </div>
 +
              <!--26_06-->
 +
              <div id = "26_06">
 +
                <p><strong>[Chi Yan + Yunting] Midiprep of EsaR plasmid   </strong></p>
 +
                <p><strong>[Yihan Yunting] Gel electrophoresis of inv colony PCR </strong></p>
 +
                <p>insert picture gel </p>
 +
              </div>
 +
              <div id = "27_06">
 +
                <p><strong>[Xinyi] Colony pcr for placgfp
 +
                  for >18 colonies
 +
                </strong></p>
 +
                <p> insert gel picture </p>
 +
              <strong>[Adrian] Gfp expression observed using gfp filter with the SPS microscope </strong></div>
 +
            <div id = "23_07">
 +
    </div>
 +
             
 +
          <!--start green events [HEK293]-->
 +
          <!--17_06-->
 +
                    <div id = "17_06green" >
 +
                      <p><strong>Yanting</strong></p>
 +
                      <p><strong>Subculture of HEK 293
 +
                      </strong></p>
 +
                      <p>P4 -> p5</p>
 +
                      <p> Grow/split into 150mm dish for freezing on sat(20/6) </p>
 +
                      <p>--&gt;30ml DMEM + 1ml cells                        </p>
 +
                      <p>90mm dish for maintenance (buffer)                        </p>
 +
                      <p>--&gt;10ml DMEM + 30ul cells                        </p>
 +
                      <p>Cells combined from 3 90mm dishes </p>
 +
                    </div>
 +
                    <!--20_06-->
 +
                    <div id = "20_06green">
 +
                      <p><strong>Yanting</strong></p>
 +
                      <p><strong>Freezing of HEK293
 +
                        </strong>
 +
                      </p>
 +
                      <p>P6                        </p>
 +
                      <p>Cells from a 150 mm dish and 90mm dish </p>
 +
                    </div>
 +
          <!--start blue event [Invasin +Listeriolysin]-->
 +
          <!--12_07-->
 +
          <div id = "12_07blue">
 +
                      <p><strong>Adrian</strong> </p>
 +
                      <p>Prepared restreak of inv/hly plasmid from original stab culture </p>
 +
          </div>
 +
                    <!--14_07-->
 +
                    <div id = "14_07blue">
 +
                      <p><strong>Yanting and Yunting</strong></p>
 +
                      <p>Colony PCR of invasin
 +
                      </p>
 +
                      <p>Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7). </p>
 +
                      <p>Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.</p>
 +
                      <p> Also constituted dNTP w 2.5mM of each atcg triphosphate. </p>
 +
                    </div>
 +
                    <!--15_07-->
 +
                    <div id = "15_07blue">
 +
                      <p><strong>Yanting</strong>
 +
                    </p>
 +
                      <p>100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”. </p>
 +
                      <p>When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front. </p>
 +
                      <p><strong>Yunting</strong>                    </p>
 +
                      <p>Placed BBa_K299812 plate in incubator for overnight growth. </p>
 +
                    </div>
 +
                    <!--16_07-->
 +
                    <div id = "16_07blue">
 +
                      <p><strong>Yanting and Yunting</strong></p>
 +
                      <p>Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator. </p>
 +
                      <p>Primer conc=0.5 uM, template DNA dissolved in 10ul h20.</p>
 +
                      <p>Thermocycler &ldquo;colony_inv&rdquo; protocol, with adjusted extension time and annealing time&amp;temp from standard &ldquo;colony&rdquo; protocol.</p>
 +
                      <p dir="ltr">100V for 34min. </p>
 +
                      <p dir="ltr">Tubes 1-2: FP-prefix, RP-suffix. </p>
 +
                      <p dir="ltr">3-4: FP-VF2, RP-VR. </p>
 +
                      <p dir="ltr">5-6: FP-prefix, RP_Inv_M2.</p>
 +
                      <p dir="ltr"> 7-8: RP-suffix, FP_Inv_M1. </p>
 +
                      <p dir="ltr">No template control with FP-prefix, RP-suffix.</p>
 +
                      <p dir="ltr">[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2-&gt;GCTCATTATAGTCCGCGAAATCACG]. </p>
 +
                      Gel image saved as &ldquo;7.17_inv colony.sgd&rdquo; (handphone pic below).
 +
                      <p dir="ltr"><strong>Results</strong>: Tubes 3&amp;4 with universal primers VF2 VR have a band between 4&amp;5kb - Inv+LLO is 4.1kb, probably are positive colonies. </p>
 +
                      <p dir="ltr">Tubes 1&amp;2, 5&amp;6 have bands &lt;750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I&rsquo;ll try thermo-gradient thermocycler protocol next time).</p>
 +
                      <p dir="ltr"> Expected band size for 5&amp;6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb. </p>
 +
                      No bands for tubes 7&amp;8. Expected band size for 7&amp;8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.
 +
                     
 +
                      <p>&nbsp;</p>
 +
                    </div>
 +
                    <!--19_07-->
 +
                    <div id = "19_07blue">
 +
                      <p><strong>Yihan</strong></p>
 +
                      <p>Inoculation of positive colonies in liquid culture. 3mL and shaking incubation. </p>
 +
                    </div>
 +
                    <!--20_07-->
 +
                    <div id = "20_07blue">
 +
                      <p><strong>Yunting</strong></p>
 +
                      <p>Miniprep of positive colonies from 30h liquid culture.                        </p>
 +
                      <p>Eluted in 50ul elution buffer and stored at -20.                        </p>
 +
                      <p>C= 225.9ng/ul. 260/280=1.86                        </p>
 +
                      <p>D= 297.7ng/ul. 1.87 </p>
 +
                    </div>
 +
                    <!--21_07-->
 +
                    <div id = "21_07blue">
 +
                      <p><strong>Yunting</strong>
 +
                      </p>
 +
                      <p dir="ltr"><strong>Colony PCR with thermogradient: 14rxn</strong>                      </p>
 +
                      <table width="100%" border="2" cellpadding="2">
 +
                        <tr>
 +
                          <th scope="col">Reagent</th>
 +
                          <th scope="col">Amount</th>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">H2O</p></td>
 +
                          <td><p dir="ltr">70ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">dNTP</p></td>
 +
                          <td><p dir="ltr">14ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">MgCl2</p></td>
 +
                          <td><p dir="ltr">35ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Taq</p></td>
 +
                          <td><p dir="ltr">3.25ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">primers (forward + reverse)</p></td>
 +
                          <td><p dir="ltr">14ul*2</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Template DNA</p></td>
 +
                          <td><p dir="ltr">14ul</p></td>
 +
                        </tr>
 +
                      </table>
 +
                      <p dir="ltr">C/D-1,2: Col3. </p>
 +
                      <p dir="ltr">C/D-3,4: Col12. </p>
 +
                      <p dir="ltr">D-5,6: Col 9. </p>
 +
                      <p dir="ltr">D-7,8: Col 10.</p>
 +
                      <p dir="ltr">Negative control (no template): Col 8.</p>
 +
                      <br>
 +
                      <p dir="ltr">Gel ran for 80V, 1h. </p>
 +
                      <p dir="ltr">D-1,2: VF2, VR. </p>
 +
                      <p dir="ltr">D-3,4: FP-prefix, RP-suffix. </p>
 +
                      <p dir="ltr">D-5,6: FP-prefix, FP_M2. </p>
 +
                      <p dir="ltr">D-7,8: FP-prefix, FP_invF.</p>
 +
                      <p dir="ltr">C-1,2: VF2, VR. </p>
 +
                      <p dir="ltr">C-3,4: FP-prefix, RP-suffix. </p>
 +
                      <p><strong>Results Notes</strong>: </p>
 +
                      <p>Too much template DNA (~250ng). Separate the universal primers (to avoid differing extension time).<br>
 +
                      </p>
 +
                    </div>
 +
                    <!--23_07-->
 +
                    <div id = "23_07blue">
 +
                      <p><strong>Yanting</strong>
 +
                    </p>
 +
                      <p>RE digest of inv/hyl plasmid with EcoRI and PstI for 2 hours at 37oC. </p>
 +
                      <p dir="ltr">Lane 1-4: 1kb ladder, 100bp ladder, RE of colony C, RE of colony D.</p>
 +
                      <p dir="ltr">Size is correct: 4kb main band (inv+hly part) and 2kb (plasmid backbone). These plasmid DNA should have the part.<br>
 +
                      </p>
 +
                    </div>
 +
                    <!--24_07-->
 +
                    <div id = "24_07blue">
 +
                      <p><strong>Yanting and Yunting</strong>
 +
                    </p>
 +
                      <p><strong>Colony PCR, used with temperature gradient to vary annealing temperature.
 +
                        10rxn </strong></p>
 +
                      <table width="100%" border="2" cellpadding="2">
 +
                        <tr>
 +
                          <th scope="col">Reagent</th>
 +
                          <th scope="col">Amount</th>
 +
                        </tr>
 +
                        <tr>
 +
                          <td>5x buffer</td>
 +
                          <td>50ul</td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">H2O</p></td>
 +
                          <td><p dir="ltr">127.5ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">dNTP</p></td>
 +
                          <td><p dir="ltr">50ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">MgCl2</p></td>
 +
                          <td><p dir="ltr">10ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Taq</p></td>
 +
                          <td><p dir="ltr">3.25ul</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">primers (forward + reverse)</p></td>
 +
                          <td><p dir="ltr">14ul*2</p></td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td><p dir="ltr">Template DNA</p></td>
 +
                          <td><p dir="ltr">14ul</p></td>
 +
                        </tr>
 +
                      </table>
 +
                      <p>100V for 45min (can run for longer).</p>
 +
                      <p><strong>Result:</strong></p>
 +
                      <p dir="ltr">Lane 1: 1kb ladder; lane 2: 100bp ladder; </p>
 +
                      <p dir="ltr">lane 3-7: FP prefix + RP suffix (5 repeats with increasing annealing temperatures) has 2 bands ~800 bp &amp; 100-200bp (probably non specific bands, will lower # of cycles in future, use higher annealing temp, lower annealing time). </p>
 +
                      <p dir="ltr">Expected size of inv+hly part is 4.1kb.</p>
 +
                      <p dir="ltr">lane 8-9: VF + M2 has a thick band 800-900bp. </p>
 +
                      <p dir="ltr">Expected size is 600+130bp (VF adds ~130bp compared to FP_prefix) .: doesn&rsquo;t seem to be correct…. </p>
 +
                      <p dir="ltr">lane 10-11: VF + inv F has no bands. Expected is at least 200bp (bcos universal primers). </p>
 +
                      <p dir="ltr">lane 12: VR + inv F seems to have a small band &lt;100bp. Non specific amplification? </p>
 +
                      <p dir="ltr">Expected is 1.5+0.1 kb (from VR).<br>
 +
                      </p>
 +
                    </div>
 +
                    <!--31_05-->
 +
                    <div id = "31_07blue">
 +
                      <p><strong>Yanting</strong>
 +
                    </p>
 +
                      <p><strong>RE with XbaI and PstI </strong></p>
 +
                      <table width="100%" border="2" cellpadding="2">
 +
                        <tr>
 +
                          <th width="36%" scope="col">Reagent</th>
 +
                          <th width="64%" scope="col">Amount</th>
 +
                        </tr>
 +
                        <tr>
 +
                          <td>Restriction enzyme</td>
 +
                          <td>2ul</td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td>Buffer</td>
 +
                          <td>5ul</td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td>DNA (4x of miniprep=74.5ng/ul)</td>
 +
                          <td>13.4ul</td>
 +
                        </tr>
 +
                        <tr>
 +
                          <td>H2O</td>
 +
                          <td>29.6ul</td>
 +
                        </tr>
 +
                      </table>
 +
                      <p>Incubate at 37degC for 2.5h (1130-1400)</p>
 +
<br>
 +
                      <p dir="ltr"><strong>Results</strong>: Gel loaded 1kb ladder, uncut, RE digested. 100V for 1h. </p>
 +
                      <p dir="ltr">Plasmid doesn't have XbaI site - RE digested DNA is a linear 6kb band. </p>
 +
                      <br>
 +
                    </div>
 +
          <!--start red event [Maintenance]-->
 +
          <!--23_06-->
 +
          <div id = "23_06red">
 +
                    <p><strong>Yunting</strong>
 +
                    </p>
 +
                    <p>Cast a big gel. Stored in 4 deg. [Used up 26/6] </p>
 +
                    <p>Pre-cast two 0. 8% gels. Stored in 4deg. [Used up on 24 & 25/6]
 +
                    </p>
 +
          </div>
 +
                    <!--26_06-->
 +
                    <div id = "26_06red">
 +
                      <p><strong>Chi Yan and Yunting</strong>
 +
                    </p>
 +
                      <p>Midiprep of esaR plasmid. </p>
 +
                      <p>Airdry ON. </p>
 +
                    </div>
 +
                    <!--29_06-->
 +
                    <div id = "29_06red">
 +
                    Safety Inspection for our lab by OSHE. We passed with flying colours!
 +
    </div>
 +
                    <!--14_07-->
 +
                    <div id = "14_07red">
 +
                      <p>Transformation of ligated FNRgfp plasmid into dH5alpha                        </p>
 +
                      <p>Cleaned waterbath, de-iced the fridge. </p>
 +
                      <p>Today, we also did a spring cleaning for the lab </p>
 +
                    </div>
 +
                    <!--17_07-->
 +
  <div id = "17_07red">
 +
                    Pre-cast big and small gels and stored in 4deg in the blue tupperware.  [Used up on 20 & 22/7]
 +
 +
    </div>
 +
          <!--start yellow event [esaGFP]-->
 +
              <!--28_06-->
 +
            <div id = "28_06yellow">
 +
                <p><strong>Adrian</strong>                  </p>
 +
                <p><strong>BBPrefix_esaRBS PCR</strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">H2O</p></td>
 +
                    <td><p dir="ltr">221ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Buffer</p></td>
 +
                    <td><p dir="ltr">80ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">MgCl</p></td>
 +
                    <td><p dir="ltr">32ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">dNTP</p></td>
 +
                    <td><p dir="ltr">32ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Forward Primer_Biobrick Prefix</p></td>
 +
                    <td><p dir="ltr">16ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">ORP_esaRBS_fragsyn</p></td>
 +
                    <td><p dir="ltr">16ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">synpart_BBP_esaRBS</p></td>
 +
                    <td><p dir="ltr">1ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">gotaq</p></td>
 +
                    <td><p dir="ltr">2ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">total</p></td>
 +
                    <td><p dir="ltr">400ul</p></td>
 +
                  </tr>
 +
                </table>
 +
                <p><strong id="docs-internal-guid-934bc9f1-46c9-7554-40b8-48a3cad9d865">success-&gt; PCR purification</strong></p>
 +
                <p><strong id="docs-internal-guid-934bc9f1-46ca-0aee-b546-3982d573bbe8">esaRBS_GFP_BBsuffix</strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">H2O</p></td>
 +
                    <td><p dir="ltr">237ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Buffer</p></td>
 +
                    <td><p dir="ltr">80ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">MgCl2</p></td>
 +
                    <td><p dir="ltr">32ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">dNTP</p></td>
 +
                    <td><p dir="ltr">32ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Reverse primer_BB_suffix</p></td>
 +
                    <td><br>
 +
                    ??</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">ORP_esaRS_GFP</p></td>
 +
                    <td><p dir="ltr">16ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Plac_GFPPLASMID</p></td>
 +
                    <td><p dir="ltr">1ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">gotaq</p></td>
 +
                    <td><p dir="ltr">2ul</p></td>
 +
                  </tr>
 +
                </table>
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-46cc-6a7d-ce73-e1023973a74a">failed -&gt; troubleshooting-&gt; new OFP_esaRBBS_GFP</strong></p>
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-46cc-6a7d-ce73-e1023973a74a">Redid 30/6 with new primers</strong></p>
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-46cc-6a7d-ce73-e1023973a74a">success with new primers-&gt; fusion pcr</strong></p>
 +
                <br>
 +
                PCR with inv primers (adrian&rsquo;s primers)
 +
                <p>&nbsp;</p>
 +
<br>
 +
    </div>
 +
              <!--02_07-->
 +
              <div id = "02_07yellow">
 +
                <p><strong>Clarice</strong></p>
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-46cf-9174-adfe-47a39589e85a">Fusion PCR with esaRBS, GFP</strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">H2O</p></td>
 +
                    <td><p dir="ltr">104.07ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Buffer</p></td>
 +
                    <td><p dir="ltr">40ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">MgCl2</p></td>
 +
                    <td><p dir="ltr">16ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">dNTP</p></td>
 +
                    <td><p dir="ltr">16ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Forward primer_BB_prefix</p></td>
 +
                    <td><p dir="ltr">8ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Reverse primer_BB_prefix</p></td>
 +
                    <td><p dir="ltr">8ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">400ng esaRBS</p></td>
 +
                    <td><p dir="ltr">2.13ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">400ng esaRBSgfp</p></td>
 +
                    <td><p dir="ltr">4.8ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">gotaq</p></td>
 +
                    <td><p dir="ltr">1ul</p></td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td><p dir="ltr">Total</p></td>
 +
                    <td><p dir="ltr">200ul</p></td>
 +
                  </tr>
 +
                </table>
 +
                <p dir="ltr">annealing temp 50degC</p>
 +
                <br>
 +
                <p dir="ltr"><strong id="docs-internal-guid-934bc9f1-46dd-d6fc-13e8-2e66bbd94e7a">Gel electrophoresis: looks correct-&gt; PCR Purification</strong></p>
 +
                <p><br>
 +
                <strong id="docs-internal-guid-934bc9f1-46dd-f312-fb45-0cdcebf3a920">RE digest of esaRBS+GFP</strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Insert</th>
 +
                    <th scope="col">Vector</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>2ul</td>
 +
                    <td>2ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>EcoRI/PstI</td>
 +
                    <td>1ul</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Template(2ug)</td>
 +
                    <td>5ul</td>
 +
                    <td>4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dH2O</td>
 +
                    <td>11ul</td>
 +
                    <td>12ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>total</td>
 +
                    <td>20ul</td>
 +
                    <td>20ul</td>
 +
                  </tr>
 +
                </table>
 +
             
 +
    </div>
 +
              <!--06_07-->
 +
              <div id = "06_07yellow">
 +
                <p><strong>Clarice</strong></p>
 +
                <p>COlny PCR with different colonies (15 colonies)                </p>
 +
                <p> FP_BB_Prefix and RP_BB_Suffix                  </p>
 +
                <p><strong>Success </strong></p>
 +
              </div>
 +
              <!--07_07-->
 +
              <div id = "07_07yellow">
 +
                <p><strong>Clarice</strong>
 +
              </p>
 +
                <p>Colony PCR successful - inouclated colony 2,3,4,12 in 3mL LB </p>
 +
                <p><strong id="docs-internal-guid-934bc9f1-46ea-c6bd-c68a-2b1fe837f12f">PCR-FNRsynpart BBP</strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dH2O</td>
 +
                    <td>221ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>80ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>MgCl2</td>
 +
                    <td>32ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dNTPs</td>
 +
                    <td>32ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>FP_RNE_PromoterBBP</td>
 +
                    <td>16ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>GFP_FNR_Prom_GFP</td>
 +
                    <td>16ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>synpart FNR</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>gotaq</td>
 +
                    <td>2ul</td>
 +
                  </tr>
 +
                </table>
 +
                <p>&nbsp;</p>
 +
              </div>
 +
              <!--10_07-->
 +
              <div id = "10_07yellow">
 +
                <p><strong>Clarice</strong>
 +
                </p>
 +
                <p><strong id="docs-internal-guid-934bc9f1-46ed-4e6a-9565-a718a1856946">Verify minipreppped esaGFP plasmid</strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>2ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>EcoRI</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Pst1</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Plasmid</td>
 +
                    <td>5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dH2O</td>
 +
                    <td>11ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>total</td>
 +
                    <td>20ul</td>
 +
                  </tr>
 +
                </table>
 +
              </div>
 +
              <!--14_07-->
 +
              <div id = "14_07yellow">
 +
                <p><strong>Clarice</strong>
 +
                </p>
 +
                <p dir="ltr">Transformatin of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)</p>
 +
                plate O/N
 +
              </div>
 +
          <!--start brown event [FNRgfp]-->          <!--03_07-->
 +
              <div id = "03_07brown">
 +
                <p><strong>Yihan</strong>
 +
                </p>
 +
                <p>Ran gel of gfp plasmid EcoRI/PstI, took out gel slice for vector - 4kb                  </p>
 +
                <p>Gel extraction:                  </p>
 +
                <p>+gfpvector->38.7ng/ul
 +
                  fragment-> direction purification 226.4ng/ul                  </p>
 +
                <p>+LIgation reaction (5:1) 6X                  </p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>300ng vector</td>
 +
                    <td>7.8ng/ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>531.2ng of insert</td>
 +
                    <td>2.4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>12ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Enzyme</td>
 +
                    <td>6ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>H2O</td>
 +
                    <td>91.8ul</td>
 +
                  </tr>
 +
                </table>
 +
                <p>ligate for 2 hours at 16 hours
 +
                  transform, plate, grow ON </p>
 +
              </div>
 +
              <!--04_07-->
 +
              <div id = "04_07brown">
 +
                <p><strong>Yihan</strong>
 +
                </p>
 +
                <p>No colonies-> ligation did not work
 +
                </p>
 +
                <p>Recalcualte ligation reaction (3:1),7x
 +
                </p>
 +
                <p>350ng vector->9ul vector
 +
                </p>
 +
                <p>446.3ng insert-> 2ul
 +
                7ul </p>
 +
                <p>ligase
 +
                  110</p>
 +
                <p>H2O </p>
 +
                <p>12ul buffer </p>
 +
              </div>
 +
              <!--05_07-->
 +
              <div id = "05_07brown">
 +
                <p><strong>Yihan and Clarice</strong>
 +
                </p>
 +
                <p>colonies for EsaGFP </p>
 +
                <p>grew
 +
                  Colony PCR for 14 colonies
 +
                </p>
 +
                <p>Unsuccessful-> no bands observed
 +
                </p>
 +
              </div>
 +
              <!--07_07-->
 +
              <div id = "07_07brown">
 +
                <p><strong>Yihan</strong>
 +
              </p>
 +
                <p>Trying out an idea for workshop </p>
 +
                <p>Trial for blue/white screen                </p>
 +
                <p>Streak out pGFPuv and pGEMT on plate with amp added
 +
                spread 40ul of 0.1M IPTG and 30ul of 5%xgal, dried
 +
                and on plate without amp </p>
 +
              </div>
 +
              <!--08_07-->
 +
              <div id = "08_07brown">
 +
                <p><strong>Yihan</strong>
 +
                </p>
 +
                <p>Ran gel with FNR Pcr and gfp pcr
 +
                </p>
 +
                <p>size of pcr product was correct but gel picture was not saved
 +
                </p>
 +
                <p>FNR Product was pcr purified
 +
                 
 +
                </p>
 +
                <p>Plasmid extraction for colony 2,3,4 of esaGFP - > 2,3 were sent for sequencing and primers did not bind, chromatogram was messed up.
 +
                 
 +
                </p>
 +
                <p>Fusion PCR for FNRGFP:</p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dH2O</td>
 +
                    <td>218ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>10X buffer</td>
 +
                    <td>80ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>MgCl2</td>
 +
                    <td>23ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dNTP</td>
 +
                    <td>32ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Template FNR PCR (40ng)</td>
 +
                    <td>3ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>gfp PCR (400ng)</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>FP_BB_Suffix</td>
 +
                    <td>16ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>RP_BB_Suffix</td>
 +
                    <td>16ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>gotaq</td>
 +
                    <td>2ul</td>
 +
                  </tr>
 +
                </table>
 +
              </div>
 +
              <!--09_07-->
 +
              <div id = "09_07brown">
 +
                <p><strong>Chi yan</strong>
 +
              </p>
 +
                <p>Gel was run for fusion pcr size was correct </p>
 +
                <p><strong>Clarice RE digest:                </strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>PstI</td>
 +
                    <td>1.5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>EcoRI</td>
 +
                    <td>1.5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Template</td>
 +
                    <td>3ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>H2O</td>
 +
                    <td>20ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Total</td>
 +
                    <td>40ul</td>
 +
                  </tr>
 +
                </table>
 +
              </div>
 +
              <!--10_07-->
 +
              <div id = "10_07brown">
 +
                <p><strong>Chi yan</strong>
 +
              </p>
 +
                <p>Ran gel for gfpp plasmid                </p>
 +
                <p>gel purificaiton and extraction of 4kb fragment                </p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>ligation reaction (2X)</td>
 +
                    <td>40ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>100ng of DNA vector</td>
 +
                    <td>3.4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>157ng insert</td>
 +
                    <td>16ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>enzyme</td>
 +
                    <td>2ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>H2O</td>
 +
                    <td>14.6ul</td>
 +
                  </tr>
 +
                </table>
 +
              </div>
 +
              <!--14_07-->
 +
              <div id = "14_07brown">
 +
                <p><strong>Yihan</strong>
 +
                </p>
 +
                <p>no colonies for FNRgfp plasmid
 +
                </p>
 +
                <p><strong>Inv plasmid verification
 +
                </strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>buffer</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>EcoRI</td>
 +
                    <td>0.5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>invasin plasmid</td>
 +
                    <td>0.5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dH2O</td>
 +
                    <td>8ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Total</td>
 +
                    <td>10ul</td>
 +
                  </tr>
 +
                </table>
 +
                <p>Gel extraction RE digest of EsaR-GFP plasmid
 +
                </p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Ligation</th>
 +
                    <th scope="col">Control</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Vector (45ng)</td>
 +
                    <td>1ul</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Insert</td>
 +
                    <td>1ul</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>1ul</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>dH2O</td>
 +
                    <td>6ul</td>
 +
                    <td>7ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>ligase</td>
 +
                    <td>1ul</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                </table>
 +
                <p>Transformation of FNRgfp
 +
                  anaerobe jar
 +
                </p>
 +
                <p>E. coli grew in both conditions
 +
                  p putida-> some growth in anaerobe chamber
 +
                  proper streak plate in aerobic conditions
 +
                </p>
 +
                <p>packet runs out after 16hours </p>
 +
              </div>
 +
              <!--13_07-->
 +
              <div id = "13_07brown">
 +
                <p><strong>Yihan and Yunting</strong>
 +
              </p>
 +
                <p>LIgation for FNRgfp (4X)</p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>200ng Gfp plasmid</td>
 +
                    <td>4.36ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>297ng insert (7:1)</td>
 +
                    <td>10.3ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>53.34ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>T4 ligase</td>
 +
                    <td>4ul</td>
 +
                  </tr>
 +
                </table>
 +
                <p>Trial run of anaerobe chamber:</p>
 +
                <p>+ open sachet to decrease O2 at 3.30pm                    </p>
 +
                <p>+ takes 2.5h to activate                    </p>
 +
                <p>place streak plate of p putida a strict aerobe and e coli, facultative aerobe in chamber at 30deg C to grow O/N                    </p>
 +
                <p>P. putida is an abligate aerobe and if chmaber works ,it will not grow                    </p>
 +
                <p>E. coli should grow in both conditions                </p>
 +
                <p>controls grown outside chamber </p>
 +
              </div>
 +
              <!--15_07-->
 +
              <div id = "15_07brown">
 +
                <p><strong>Yihan</strong>
 +
                </p>
 +
                <p>FNRgfp-> no colonies after transformation
 +
                </p>
 +
                <p><strong>religation (4X reaction)                  </strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>200ng GFP plasmid</td>
 +
                    <td>4.4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>2125ng of insert</td>
 +
                    <td>8ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>T4 ligase</td>
 +
                    <td>4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>H2O</td>
 +
                    <td>55.6ul</td>
 +
                  </tr>
 +
                </table>
 +
                <p>transformation of FNR gfp into 20ul of BL21 </p>
 +
              </div>
 +
              <!--16_07-->
 +
              <div id = "16_07brown">
 +
                <p><strong>Yihan</strong>
 +
              </p>
 +
                <p>No colonies grew                  </p>
 +
                <p>Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder </p>
 +
              </div>
 +
              <!--17_07-->
 +
              <div id = "17_07brown">
 +
                <p><strong>Chi Yan</strong>
 +
                </p>
 +
                <p><strong>RE digest of FNR-GFP fusion PCR with EcoRI and PstI
 +
                </strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>EcoRI</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>PstI</td>
 +
                    <td>1ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Buffer</td>
 +
                    <td>5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>FNR-GFP from 12/7 in RIP box 1ug</td>
 +
                    <td>2.5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>H2O</td>
 +
                    <td>40.5ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>Total</td>
 +
                    <td>50ul</td>
 +
                  </tr>
 +
                </table>
 +
                <p>Direct purification using Promega kit</p>
 +
                <p> <strong>Overnight ligation (4X reaction) </strong></p>
 +
                <table width="100%" border="2" cellpadding="2">
 +
                  <tr>
 +
                    <th scope="col">Reagent</th>
 +
                    <th scope="col">Amount</th>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>200ng of GFP plasmid</td>
 +
                    <td>4.4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>400ng of insert (5:1)</td>
 +
                    <td>?</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>T4 ligase</td>
 +
                    <td>4ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>T4 ligase buffer</td>
 +
                    <td>8ul</td>
 +
                  </tr>
 +
                  <tr>
 +
                    <td>H2O</td>
 +
                    <td>?</td>
 +
                  </tr>
 +
                </table>
 +
                <p>&nbsp;</p>
 +
                <p>200ng of gfp plasmid (4.4ul)                </p>
 +
                <p>400ng of insert (5:1) (?ul)                </p>
 +
                <p>4ul T4 ligase                </p>
 +
                <p>8ul T4 ligase buffer                </p>
 +
                <p>? H2O </p>
 +
              </div>
 +
              <!--18_07-->
 +
              <div id = "18_07brown">
 +
                <p><strong>Yihan</strong>
 +
                </p>
 +
                <p>Ncbi search in BL21 genome revealed that it does have FNR transcriptional regulator                    </p>
 +
                <p>http://www.ncbi.nlm.nih.gov/nuccore/CP010816.1                    </p>
 +
                <p>In dH5alpha as well                    </p>
 +
                <p>http://www.ncbi.nlm.nih.gov/gene/945908                    </p>
 +
                <p>However no direct data on our specific strains of dH5alpha and BL21 </p>
 
               </div>
 
               </div>
 
           </div>
 
           </div>

Revision as of 23:21, 19 August 2015

Classic parallax page

Home
kenneth

Kenneth Lim Kun Ming

Research Interest: Bioinformatics, Genetic analysis Random fact: Is apparently Schrˆdinger's Biologist

Clarice Hong Kit Yee

Research Interest: genetics, RNA, cancer Past research projects: (can't rmb, tell you later)

Current project: Differential roles of SALL4A and SALL4B in HCC

chiyan

Wong Chi Yan

Research Interest: Microbiology, molecular biology, proteomics

Past research project: Genetic studies on Salmonella biofilms

Current project: Role of fumarase and cysteine dehydrogenase in DNA damage response

Random fact: Likes statistics and playing volleyball :)

Yeo Xin Yi

Research Interests: Neurobiology, Neurosciences

Past research projects: Role of STAT in neuroinflammation and the pathogenesis of Alzheimer's Disease

Current research projects: Synaptic plasticity threshold in hippocampal CA1 pyramidal neurons, Role of WNK1 in neuronal survival and development

Random fact: Blah ~

Tan Yi Han

Research Interests: Pathogens, Immunology, Synthetic biology

Past research projects: Genetic studies on plant pathogenic fungi, Drug screening for Acute Lymphoblastic Leukemia

Current project: Characterisation of Klebsiella pneumoniae isolates from liver abscess

Random fact: Knits and bakes in spare time. =)

yanting Hee Yanting

Research Interests: RNA, genomics, epigenetics

Past research projects: microRNA as a potential therapeutic strategy for colorectal cancer, Characterising LPA1 antagonists using calcium imaging

Current project: The role and targeting of EZH2 in lymphoma

Random fact: Plays the erhu and self-learning cello and classical guitar

Adrian Tan Hong Ji

Research Interest: Genetic Engineering, Cancer, Immunology

Random fact: 500 Hours in Terraria

yunting

Soong Yun Ting

Research Interests: Proteomics, Past research projects: Genetic studies on Salmonella biofilms

Current project: Identification of protein players in metastasis

Random fact: Plays the harmonica

duy

Nguyen Duy

Research Interest: Pharmacoinfomatics, Bioinformatics, Neurosciences

Past research project: Genetic linkage analysis of asthma

Current project: Neurodegeneration of Drosophila Melanogaster.

Random fact: 0 hour in Terraria

ourBelovedMentors
linda_stuti_leslie

Leslie

Leslie Gapter

Dr. Leslie is trained as a molecular biologist and her dissertation focused on breast development and tumorigenesis. Leslie joined NUS in 2005 and her past research has focused on analyzing botanical products for breast and prostate cancer treatment.

In 2008, Leslie became a full time scientific writer at the Mechanobiology Institute, Singapore, before moving into her current position as a Lecturer in 2010. Leslie teaches 'The Cell' module, which examines the universal mechanics and functions of cells from an integrated science perspective, for the Special Program in Science.

Linda

Linda J Kenney

Dr Kenney is a Professor of Microbiology at the University of Illinois-Chicago. Her laboratory studies two-component systems in bacteria that control gene expression at a single cell and nanometer level.

Stuti

Stuti Desai

She joined the Kenney group in May, 2012 with a strong urge to amalgamate her doctoral training in studying silent genetic systems in enterics to decipher the behavior of bacteria under various environmental challenges. She obtained her doctorate from the Indian Institute of Science, Bangalore, India, under the guidance of Prof Subramony Mahadevan. She studied Biochemistry for my Master's degree and Chemistry, Physics and Zoology for her Bachelor's degree at the Maharaja Sayajirao University of Baroda, Baroda, India.

theProject

Description

For description

Experiment and Protocol

For experiment and protocol

Result

For result

Design

For design

Parts

Team part

For Team part

Basic part

For basic part

Composite part

For composite part

Part collection

For part collection

notebook

[DONE] pLac-GFP tester plasmid
[PAUSED] HEK293
Invasin + Listeriolysin [YanTing, YunTing]
Maintenance
esaGFP [Adrian, Clarice, Kenneth]
FNRgfp [YiHan, ChiYan]

Yi Han

Received 2 bacterial stab cultures, EsaR/I plasmid from addgene (CHL) and BBa_K299812 from iGEM HQ.

Streaked out on plates with amp.

Adrian

Transformed:

+Kit plate 1 9N Ba_K763002 chl

+Kit plate 4 13L BBa_E0040 amp

DNa was received in powder form in plates, and resuspended in 10ul ultrapure H2O respectively. Plates were stored in -20/

Yi Han

Plates cracked in incubator as they dried from lack of humidity.

Transfer to small incubator with beaker of water for humidity no single colonies for inv plasmid -> streak again.

Wrong antibiotic for EsaR/I plasmid-> streak out again

Yi Han

Inoculate single colony of invasin plasmid carrying bacteria in 3mL LB+amp

Transformation of 13L repeated with 1ul of DNA.

Xin Yi

No colonies grew for 13L on all plates ->adjust incubator, make new media

Miniprep of inoculated bacteria for invasin plasmid, incubate sample in 37degC for 1h 20min

RE of invasin plasmid RE control
Rsal 1ul Rsal 0 ul
EcoRI 1 ul EcoRI 0 ul
INv plasmid 7.5ul Inv plasmid 7.5 ul
H2O 35.5 ul H2O 37.5 ul
NEB buffer 4.5 ul Buffer 4.5 ul

 

29_05_gelRun

Repeat transformation of 13L with 1ul

Xin Yi and Yi Han

Miniprep of EsaR/I plasmid for 4 colonies

Restriction digest for EsaR with XbaI/BamHI

RE reaction
5ul plasmid
5ul buffer
1ul XbaI
1ul BamHI
Add H2O to 50ul

Xin Yi

Sent EsaR clone 4 and INv-4 for sequencing.

Yi Han

YFP and GFP transformation results - no colonies for YFP

The GFP transformation repeated with 100ng of plasmid was sucessful.

4 colonies of gfp plasmid were inoculated in 3mL LB+amp and grown overnight.

Yi Han

Miniprep of gfp plasmids

RE digest with EcoRI and RsaI

Chi Yan
RE digest indicated a very faint smaller band for colonies 2-4, and hence these were likely to be positive clones

Yanting

Inoculated 3mLS of Inv-4 and EsaR-4 plasmid carrying bacteria into 100mL LB+ appropriate Antibiotic

Cell culture-> HEK293 cells revived from freezing down appeared detached.

Yi Han + Yanting

Storage of bacterial glycerol stocks for Inv-4, EsaR4 in 25% glycerol

Yanting: grew HEK293T cells in T25 glask

Gel extract to clean up gfp plasmids which loading dye had accidentally been added to.

Yi Han

Miniprep of gfp plasmids, preparation of samples for sequencing

Yi Han

All gfp plasmids had a correct sequence

Yunting kept glycerol stocok for all, and inoculation of 3mL of gfp3 into 100mL LB+amp for midiprep

Yi Han + Yunting

Midiprep of gfp plasmid PCR of gfp with KpnI-gfp and XhoI-gfp primers

Yunting + Duy

Nanodrop of gfp product-> 595.5ng/ul

RE digest of EsaR vector with KpnI/XHoI

Gel electrophoreseis at 1000V for 30min

Gel extraction: 3.9ng/ul and 6.9ng/ul for Esa fragment and GFP --> low yield

Yunting

Gel extraction using Promega binding solution to melt gel, followed by thermo scientific kit

Adrian

Gel extraction optimisation

Hypothesised that the Binding buffer has a problem/DNA does not bind to column

1: 2X promega binding buffer volume

2: Increase incubation time for binding to 5min

Switch binding buffer to that of thermo scientific PCR purification kit

Use sodium acetate if available? TO facilitate stronger binding to column

Results

1: ~10ng/ul

2: ~9ng/ul

not succesful

further optimisation-> warm buffer, incubate for 5min

elute in 30/20ul smaller volumes

Yihan

1: Thermoscientific miniprep columns with 2XThermoscientific binding buffer

2: Thermoscientific PCR purification kit 2X buffer

3: Promega kit 2X buffer


Yihan

    PCR (mastermix: 8)

    Reagent Amount
    PCR buffer 10 ul * 8 = 8-ul
    primers 0.8ul, 0.8ul
    DNA polymerase 4ul
    dH2O 61.75 * 8 = 494ul
    Templates 5.55*7 = 38.75ul

    Digest more plasmid (Esa plasmid)

    4 rxns ( KpnI/XhoI digest) 50ul each

    Reagent Amount
    Buffer  

    KpnI

    2ul

    XhoI

    2ul

    DNA

    34.8ul

    H2O

    141.2ul

 

Yihan

PCR

RP_XhoI_GFP and FP_KpnI_GFP with GFP midiprep

For 15 reactions with control .: Mastermix * 17

Reagent Amount

PCR buffer

170ul

primers

1.7ul, 1.7ul

dNTP

34 ul

DNA polymerase

8.5 ul

dH2O

66.3*17 = 1127.1ul

templates

17ul

total

1360ul

PCR protocol “GFP 1” (32 cycles)

GFP PCR product -> 448ng/ul

Gel extraction

Qiagen gel extraction kit at MBI

Esa gel band from 14/6

Nanodrop: 16.4 ng/ul, 260/280 = 2.60

Plasmid construction

  • RE digest (KpnI, XhoI)

  • 3 Replicates of the following

Reagent Amount

DNA

2.6ul

Buffer

5ul

H2O

41.5ul

KpnI

0.5ul

XhoI

0.5ul

Ligation (2x reaction) 40ul

Reagent Amount

10X T4 DNA ligase buffer

4ul

Vector DNA (16ng/ul)

100ng -> 6.25ul

insert DNA

75nl -> 12 ul

T4 DNA Ligase

2ul

H2O

16ul

Note: ALL digested DNA in tube labeled lacGFP.ligation was used

Nanodrop of ligation: 1114.0ng/ul. 260/280 = 3.7


Transformation

Transformation of ligated esa-GFP plasmid into DH5\alpha cells

DH5\alpha ,<- unlabelled brown vial inside DH5\alpha box at -80

Plates spread at 11:40h

LB + chloroamphenicol

+4x (100ul)

+10x (40ul)

+20x (20ul)

+LB - 20x (20ul)

remaining transformed cells (~220ul) are kept at 4C

--> labeled as placGFP in brown tube

Oservation: only 4x placGFP plate has colonies (7)

spread one new LB + chlor plate with 200ul of transformed bacteria

picked 6 colonies to grow for miniprep in LB + chl liq media

Conclusion:

+protocol works

+optimization for increase vol needed

cloning of synparts in amp vector

+comes as 4mg dry DNA

+40ul of DI/RNAse free H20

+for transformation, 150ml on wed

Unknown

Miniprep of placGFP followed by RE digest (Kpn, XhoI): 50 ul total

Reagent Amount

Buffer

2.5ul

KpnI

<ILLEGIBLE>

XhoI

<ILLEGIBLE>

DNA

10

H2O

12025

Colony PCR for synparts

+ Failed

+ No specific <illegible> produced

+ Might need optimization

 

Yihan

RE digest (XhoI, KpnI) of esa and GFP

Yunting

Gel electrophoresis (100V, 40min)

+ Lane 2: gpf: no bands

+ Lane 3: 100bp ladder

+ Lane 4: blank

+ Lane 5: esa: 2 bands

+ Lane 6: 1kb ladder

+ Lane 7:blank

<Picture of gel>

Optimizing gel extract protocol

+ RE GFP from PCR (directly RE)

+ promega agarose 1% gel

+ add NaAC in binding buffer

Result:

+ yield for cut plasmid was 12.8ng/ul

+ GFP was 8.6ng/ul

Ligation reaction 6 reactions

Reagent Amount

Buffer

12ul

Vector

30ul

Insert

30ul

 

+ 6x ligation result transformed into competent DH5\alpha 20 ul, 50ul, 100ul plated on LB + chl

Yunting

Ligation of GFP tester plasmid.

Performed 4x ligation using RE- digested esa and GFP (CY, 22/6). Ligation rxn at room temperature for 30min instead of 10min.

Included vector-only and insert-only controls.

Stored in -20deg.

Will run gel tmr. Insert only control should be same size as gfp product. Same for the other control. Can try to plate vector only to see re-ligation??

Nanodrop:

PlacGFP - 642.8ng/ul. 260/280=3.89

Vector ctrl - 756.6ng/ul. 260/280=4.11

Insert ctrl - 557 ng/ul. 260/280=3.86

Yanting

Ran 0.8% pre-cast gel at 100V for 45min.

10ul of each sample to 2ul of loading dye.

Gel lanes:

100bp; uncut esa (used esa4 from -20);

pLacGFP; vector ctrl; insert ctrl; 1kb.

[YH] Re-run gel. 35ul of each sample. No bands.

<insert gel picture>

RE of esa and Gfp pcr product.

Gel electrophoresis.

Cast a thick 1% gel (60ml) with combined wells. [Don't need to cast thick gel next time, takes too long to melt]

Gel run at 100V,  45min. Lanes: 100bp, esa, gfp 1&2, 1kb

Image after cutting is also saved.

Gel extraction of RE esa & gfp.

Used Promega kit, loaded both gfp bands into one column. Eluted with 30ul water for 5min before centrifugation.

Nanodrop:

Esa- 37.7ng/ul. 260/280= 1.83

Gfp - 25.1ng/ul. 260/280= 1.84

Overnight ligation

6x ligation:

Reagent Amount

Buffer

6ul

Vector (37.7ng/ul)

50ng = 7.8ul

Insert (25.1ng/ul)

37.7 ng = 6.6ul

H2O

87.6ul

Ligase

6ul
Ligation reaction run overnight in 16 deg hold in thermocycler - 15h, 8pm - 11am.

 

[Chi Yan + Yunting] Midiprep of EsaR plasmid

[Yihan Yunting] Gel electrophoresis of inv colony PCR

insert picture gel

[Xinyi] Colony pcr for placgfp for >18 colonies

insert gel picture

[Adrian] Gfp expression observed using gfp filter with the SPS microscope

Yanting

Subculture of HEK 293

P4 -> p5

Grow/split into 150mm dish for freezing on sat(20/6)

-->30ml DMEM + 1ml cells

90mm dish for maintenance (buffer)

-->10ml DMEM + 30ul cells

Cells combined from 3 90mm dishes

Yanting

Freezing of HEK293

P6

Cells from a 150 mm dish and 90mm dish

Adrian

Prepared restreak of inv/hly plasmid from original stab culture

Yanting and Yunting

Colony PCR of invasin

Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7).

Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.

Also constituted dNTP w 2.5mM of each atcg triphosphate.

Yanting

100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”.

When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.

Yunting

Placed BBa_K299812 plate in incubator for overnight growth.

Yanting and Yunting

Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.

Primer conc=0.5 uM, template DNA dissolved in 10ul h20.

Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.

100V for 34min.

Tubes 1-2: FP-prefix, RP-suffix.

3-4: FP-VF2, RP-VR.

5-6: FP-prefix, RP_Inv_M2.

7-8: RP-suffix, FP_Inv_M1.

No template control with FP-prefix, RP-suffix.

[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG].

Gel image saved as “7.17_inv colony.sgd” (handphone pic below).

Results: Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.

Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time).

Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.

No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.

 

Yihan

Inoculation of positive colonies in liquid culture. 3mL and shaking incubation.

Yunting

Miniprep of positive colonies from 30h liquid culture.

Eluted in 50ul elution buffer and stored at -20.

C= 225.9ng/ul. 260/280=1.86

D= 297.7ng/ul. 1.87

Yunting

Colony PCR with thermogradient: 14rxn

Reagent Amount

H2O

70ul

dNTP

14ul

MgCl2

35ul

Taq

3.25ul

primers (forward + reverse)

14ul*2

Template DNA

14ul

C/D-1,2: Col3.

C/D-3,4: Col12.

D-5,6: Col 9.

D-7,8: Col 10.

Negative control (no template): Col 8.


Gel ran for 80V, 1h.

D-1,2: VF2, VR.

D-3,4: FP-prefix, RP-suffix.

D-5,6: FP-prefix, FP_M2.

D-7,8: FP-prefix, FP_invF.

C-1,2: VF2, VR.

C-3,4: FP-prefix, RP-suffix.

Results Notes:

Too much template DNA (~250ng). Separate the universal primers (to avoid differing extension time).

Yanting

RE digest of inv/hyl plasmid with EcoRI and PstI for 2 hours at 37oC.

Lane 1-4: 1kb ladder, 100bp ladder, RE of colony C, RE of colony D.

Size is correct: 4kb main band (inv+hly part) and 2kb (plasmid backbone). These plasmid DNA should have the part.

Yanting and Yunting

Colony PCR, used with temperature gradient to vary annealing temperature. 10rxn

Reagent Amount
5x buffer 50ul

H2O

127.5ul

dNTP

50ul

MgCl2

10ul

Taq

3.25ul

primers (forward + reverse)

14ul*2

Template DNA

14ul

100V for 45min (can run for longer).

Result:

Lane 1: 1kb ladder; lane 2: 100bp ladder;

lane 3-7: FP prefix + RP suffix (5 repeats with increasing annealing temperatures) has 2 bands ~800 bp & 100-200bp (probably non specific bands, will lower # of cycles in future, use higher annealing temp, lower annealing time).

Expected size of inv+hly part is 4.1kb.

lane 8-9: VF + M2 has a thick band 800-900bp.

Expected size is 600+130bp (VF adds ~130bp compared to FP_prefix) .: doesn’t seem to be correct….

lane 10-11: VF + inv F has no bands. Expected is at least 200bp (bcos universal primers).

lane 12: VR + inv F seems to have a small band <100bp. Non specific amplification?

Expected is 1.5+0.1 kb (from VR).

Yanting

RE with XbaI and PstI

Reagent Amount
Restriction enzyme 2ul
Buffer 5ul
DNA (4x of miniprep=74.5ng/ul) 13.4ul
H2O 29.6ul

Incubate at 37degC for 2.5h (1130-1400)


Results: Gel loaded 1kb ladder, uncut, RE digested. 100V for 1h.

Plasmid doesn't have XbaI site - RE digested DNA is a linear 6kb band.


Yunting

Cast a big gel. Stored in 4 deg. [Used up 26/6]

Pre-cast two 0. 8% gels. Stored in 4deg. [Used up on 24 & 25/6]

Chi Yan and Yunting

Midiprep of esaR plasmid.

Airdry ON.

Safety Inspection for our lab by OSHE. We passed with flying colours!

Transformation of ligated FNRgfp plasmid into dH5alpha

Cleaned waterbath, de-iced the fridge.

Today, we also did a spring cleaning for the lab

Pre-cast big and small gels and stored in 4deg in the blue tupperware. [Used up on 20 & 22/7]

Adrian

BBPrefix_esaRBS PCR

Reagent Amount

H2O

221ul

Buffer

80ul

MgCl

32ul

dNTP

32ul

Forward Primer_Biobrick Prefix

16ul

ORP_esaRBS_fragsyn

16ul

synpart_BBP_esaRBS

1ul

gotaq

2ul

total

400ul

success-> PCR purification

esaRBS_GFP_BBsuffix

Reagent Amount

H2O

237ul

Buffer

80ul

MgCl2

32ul

dNTP

32ul

Reverse primer_BB_suffix
??

ORP_esaRS_GFP

16ul

Plac_GFPPLASMID

1ul

gotaq

2ul

failed -> troubleshooting-> new OFP_esaRBBS_GFP

Redid 30/6 with new primers

success with new primers-> fusion pcr


PCR with inv primers (adrian’s primers)

 


Clarice

Fusion PCR with esaRBS, GFP

Reagent Amount

H2O

104.07ul

Buffer

40ul

MgCl2

16ul

dNTP

16ul

Forward primer_BB_prefix

8ul

Reverse primer_BB_prefix

8ul

400ng esaRBS

2.13ul

400ng esaRBSgfp

4.8ul

gotaq

1ul

Total

200ul

annealing temp 50degC


Gel electrophoresis: looks correct-> PCR Purification


RE digest of esaRBS+GFP

Reagent Insert Vector
Buffer 2ul 2ul
EcoRI/PstI 1ul 1ul
Template(2ug) 5ul 4ul
dH2O 11ul 12ul
total 20ul 20ul

Clarice

COlny PCR with different colonies (15 colonies)

FP_BB_Prefix and RP_BB_Suffix

Success

Clarice

Colony PCR successful - inouclated colony 2,3,4,12 in 3mL LB

PCR-FNRsynpart BBP

Reagent Amount
dH2O 221ul
Buffer 80ul
MgCl2 32ul
dNTPs 32ul
FP_RNE_PromoterBBP 16ul
GFP_FNR_Prom_GFP 16ul
synpart FNR 1ul
gotaq 2ul

 

Clarice

Verify minipreppped esaGFP plasmid

Reagent Amount
Buffer 2ul
EcoRI 1ul
Pst1 1ul
Plasmid 5ul
dH2O 11ul
total 20ul

Clarice

Transformatin of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)

plate O/N

Yihan

Ran gel of gfp plasmid EcoRI/PstI, took out gel slice for vector - 4kb

Gel extraction:

+gfpvector->38.7ng/ul fragment-> direction purification 226.4ng/ul

+LIgation reaction (5:1) 6X

Reagent Amount
300ng vector 7.8ng/ul
531.2ng of insert 2.4ul
Buffer 12ul
Enzyme 6ul
H2O 91.8ul

ligate for 2 hours at 16 hours transform, plate, grow ON

Yihan

No colonies-> ligation did not work

Recalcualte ligation reaction (3:1),7x

350ng vector->9ul vector

446.3ng insert-> 2ul 7ul

ligase 110

H2O

12ul buffer

Yihan and Clarice

colonies for EsaGFP

grew Colony PCR for 14 colonies

Unsuccessful-> no bands observed

Yihan

Trying out an idea for workshop

Trial for blue/white screen

Streak out pGFPuv and pGEMT on plate with amp added spread 40ul of 0.1M IPTG and 30ul of 5%xgal, dried and on plate without amp

Yihan

Ran gel with FNR Pcr and gfp pcr

size of pcr product was correct but gel picture was not saved

FNR Product was pcr purified

Plasmid extraction for colony 2,3,4 of esaGFP - > 2,3 were sent for sequencing and primers did not bind, chromatogram was messed up.

Fusion PCR for FNRGFP:

Reagent Amount
dH2O 218ul
10X buffer 80ul
MgCl2 23ul
dNTP 32ul
Template FNR PCR (40ng) 3ul
gfp PCR (400ng) 1ul
FP_BB_Suffix 16ul
RP_BB_Suffix 16ul
gotaq 2ul

Chi yan

Gel was run for fusion pcr size was correct

Clarice RE digest:

Reagent Amount
PstI 1.5ul
EcoRI 1.5ul
Buffer 4ul
Template 3ul
H2O 20ul
Total 40ul

Chi yan

Ran gel for gfpp plasmid

gel purificaiton and extraction of 4kb fragment

Reagent Amount
ligation reaction (2X) 40ul
Buffer 4ul
100ng of DNA vector 3.4ul
157ng insert 16ul
enzyme 2ul
H2O 14.6ul

Yihan

no colonies for FNRgfp plasmid

Inv plasmid verification

Reagent Amount
buffer 1ul
EcoRI 0.5ul
invasin plasmid 0.5ul
dH2O 8ul
Total 10ul

Gel extraction RE digest of EsaR-GFP plasmid

Reagent Ligation Control
Vector (45ng) 1ul 1ul
Insert 1ul 1ul
Buffer 1ul 1ul
dH2O 6ul 7ul
ligase 1ul 1ul

Transformation of FNRgfp anaerobe jar

E. coli grew in both conditions p putida-> some growth in anaerobe chamber proper streak plate in aerobic conditions

packet runs out after 16hours

Yihan and Yunting

LIgation for FNRgfp (4X)

Reagent Amount
200ng Gfp plasmid 4.36ul
297ng insert (7:1) 10.3ul
Buffer 53.34ul
T4 ligase 4ul

Trial run of anaerobe chamber:

+ open sachet to decrease O2 at 3.30pm

+ takes 2.5h to activate

place streak plate of p putida a strict aerobe and e coli, facultative aerobe in chamber at 30deg C to grow O/N

P. putida is an abligate aerobe and if chmaber works ,it will not grow

E. coli should grow in both conditions

controls grown outside chamber

Yihan

FNRgfp-> no colonies after transformation

religation (4X reaction)

Reagent Amount
200ng GFP plasmid 4.4ul
2125ng of insert 8ul
T4 ligase 4ul
H2O 55.6ul

transformation of FNR gfp into 20ul of BL21

Yihan

No colonies grew

Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder

Chi Yan

RE digest of FNR-GFP fusion PCR with EcoRI and PstI

Reagent Amount
EcoRI 1ul
PstI 1ul
Buffer 5ul
FNR-GFP from 12/7 in RIP box 1ug 2.5ul
H2O 40.5ul
Total 50ul

Direct purification using Promega kit

Overnight ligation (4X reaction)

Reagent Amount
200ng of GFP plasmid 4.4ul
400ng of insert (5:1) ?
T4 ligase 4ul
T4 ligase buffer 8ul
H2O ?

 

200ng of gfp plasmid (4.4ul)

400ng of insert (5:1) (?ul)

4ul T4 ligase

8ul T4 ligase buffer

? H2O

Yihan

Ncbi search in BL21 genome revealed that it does have FNR transcriptional regulator

http://www.ncbi.nlm.nih.gov/nuccore/CP010816.1

In dH5alpha as well

http://www.ncbi.nlm.nih.gov/gene/945908

However no direct data on our specific strains of dH5alpha and BL21

human practice
safety
done