Material

1. E.coli(DH5α、CmR J22102)
2. Tube
3. LB broth
4. Inoculating loop
5. Alcohol Burner

Procedure

Step1:Draw 10mL LB broth with 5mL pipet into a tube (total4).

Step2: Scrape a colony with an inoculating loop sterilized by alcohol burner.

Step3: Add the colony into the tube (two for each strain).

Step4:Keep it in 37℃ incubator.

Material

1. LB agar
2. 0.85% saline
3. Tube
4. Dish

Procedure

1. Solid medium

   Step1:Get certain weight of LB broth (25g/L) and agar (1.5%)

   Step2: Add the powder into the serum bottle with a wash bottle.

   Step3: Add certain amount of ddH₂O into the serum bottle.

   Step4:Dissolve the solution with a spinbar.

   Step5:Sterilization for 1.5hr.

   Step6:Distribute to each dish (10mL/dish).

2. Buffer solution

   Step1: Get certain weight of saline (0.85%)

   Step2: Add the powder into the serum bottle with a wash bottle.

   Step3: Add certain amount of ddH₂O into the serum bottle.

   Step4:Sterilization for 1.5hr.

   Step5:Distribute to each tube (9mL/tube).

We extract the plasmid of B0015

We transform J22106 this time.

Procedure

1. Add 223.3 μl and 291.1 μl water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes
2. Diluted the two primer 10-fold to a concentration of 10μM for use

3. 1μg of the plasmid (220ng/μl)	4.5(μl)
   ddH2O	5.5(μl)
   Total	10(μ)l
   Primer	2(μl)
   	12(μ)l

4. Send the DNA sequencing

Procedure

1. Add 223.3 μl and 291.1 μl water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes
2. Diluted the two primer 10-fold to a concentration of 10μM for use

3. 1μg of the plasmid (220ng/μl)	4.5(μl)
   ddH2O	5.5(μl)
   Total	10(μ)l
   Primer	2(μl)
   	12(μ)l

4. Send the DNA sequencing

the primer of second DNA sequencing

TACAGAGTTCTTGAAGTGGTGGCC

TTTAAAGAAAAAGGGCAGGGTGGT

We extract the plasmid of B0034 and J23119 and test their concentration

We transform J23119 this time.

Because transformation we did on 6/11 was fail, this week, we did transformation again.

In order to find the cause, we did two control group. One is J23102 the other is the kit provided. And we transform B0034 this time.

Material:

1. 70 % Ethanol
2. Isopropanol
3. 50 ml centrifuge tubes
4. Plasmid DNA Midi Kit
5. pSB1C3-BBa_B0030 in DH5α
6. pSB1C3-BBa_E1010 in DH5α
7. pSB1A2-BBa_E0040 in DH5α
8. pSB1A2-BBa_B0010 in DH5α

Notes:

1. Add RNase A to PL1 Buffer and store at 4℃
2. Warm PL2 Buffer in a 37℃ waterbath
3. Use 100~150 ml of bacterial culture for Midi Kit

Protocol:

1. Flick a PM Column 2~3 times, then place the PM Column on a conical flask.
2. Equilibrate the PM Column by applying 5 ml of PL4 Buffer by gravity flow
3. Harvest the bacterial culture 100 ml by centrifuge at 6000 x g for 10 mins
4. Add 5 ml of PL1 Buffer to resuspend the cell pellet by vortexing or pipetting
5. Add 5 ml of PL2 Buffer and mix gently by inverting the tube 10 times. DO NOT VORTEX!!!
6. Place for 10 mins at room temperature until lysate clears
7. Add 5 ml of PL3 Buffer and mix immediately by inverting the tube 10 times. DO NOT VORTEX!!!
8. Centrifuge at 15000g for 20 minutes or filtered with a filter paper
9. Apply the supernatant from step 8. to the equilibrated PM Column and allow it to flow by gravity flow.
10. Wash the PM Column by using PL5 Buffer 15 ml and allow the column empty by gravity flow.
11. Discard the filtrate.
12. Place PM Column in a clean centrifuge and apply 10 ml of PL6 Buffer to elute DNA by gravity flow
13. Using eluates from step 12. Add 7.5 ml of room temperature isopropanol. Vortex well and let the mixture sit for 2 minutes.
14. Centrifuge at 12500 x g for 30 minutes.
15. Remove the supernatant, then add 3 ml of 70% ethanol to wash.
16. Centrifuge at 12500 x g for 5 minutes, then dry ethanol at room temperature.
17. Apply 0.2 ml of TE Buffer to resuspend DNA.

Material:

1. E.coli DH5α (ps: E.coli should be kept on the ice at all time)
2. Plasmid : pSB1A2-BBa_E0040(Ampicillin-resistant) GFP
3. Plasmid : pSB1C3-BBa_B0010(Chloramphenicol-resistant) Terminator
4. Plasmid : pSB1C3-BBa_B0030(Chloramphenicol-resistant) RBS
5. Plasmid : pSB1C3-BBa_E1010(Chloramphenicol-resistant) RFP
6. LB broth (10 g /L Tryptone, 5 g/L Yeast extract, 5 g/L NaCl )
7. LB plate(LB broth + 1% agar)
8. Antibiotics : Ampicillin & Chloramphenicol (100μg/mL for each)

Protocol:

1. Add 0.5μL of plasmid into 100μL of E.coli and mix by tapping the tube.(ps: the quantity of plasmid is dependent on bacterial competency)
2. Put the tube on the ice for 20~30mins.
3. Remove from the ice and put the tube to the 42℃ hot bath for 45 sec.
4. After heat shock, put the tube into the ice IMMEDIATELY for 2 mins.
5. Add 500 μL of LB broth into the tube and incubate for 30~60 mins at 37℃
6. Take out the tube and put into 6000 rpm centrifuge for 5 mins.
7. Remove supertant and remain about 100μL of LB to resuspend
8. Spread onto LB plate containing the appropriate antibiotic
9. Incubate overnight for 12~16 hrs at 37℃.

This week, we did transformation.

We transform B0034, B0015, I765001, I732005.

Materials

• Resuspended DNA (B0015, E0240, E0840, E0420, E0430, I13001, J23119, B1006)
• Competent cells (20μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic
• Spreader
• 37℃ incubator
• SOC Media (180μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 20 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 180 μL of SOC Media(without antibiotic) and then incubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 100 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(chloramphenicol). Plate 100 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. Store the plate in 4 ℃.

Materials

• Resuspended DNA (Resuspend well in 10μl dH₂0, pipette up and down several times, let sit for a few minutes)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube (1 per transformation)
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic (1 per transformation)
• Spreader (2 per transformation)
• 37℃ incubator
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 150 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. After picking colonies, store the plate in 4 ℃.

Materials

• Resuspended DNA (Resuspend well in 10μl ddH₂0, pipette up and down several times, let sit for a few minutes)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube (1 per transformation)
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic (1 per transformation)
• Spreader (1 per transformation)
• 37℃ incubator
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up, and then store the plate in 4 ℃.

Material

1. randon primer 1㎕
2. 2MUG RNA F10 1.95㎕
3. 2MUG RNA m1 1.95㎕
4. 10mM dNTP 1㎕
5. ddH₂O
6. 5× FSB 4㎕
7. 0.1M DTT 2㎕
8. RNase out 1㎕
9. M-MLV RT 1㎕
10. eppendorf

Procedure

A 20-㎕ reaction volume can be used for 1 ng-5MUG of total RNA or 1-500 ng of mRNA.

1. Add the following components to a nuclease-free microcentrifuge tube:
   • 1㎕ oligo(dT)_12-18(500μg/ml), or 50-250 ng random primers, or 2pmole gene -specific primer
   • 1 ng to 5MUG total RNA or 1 ng to 500ng of mRNA
   • 1㎕ 10 mM dNTP Mix(10 mM each dATP,dGTP,dCTP and dTTP at neutral pH)
   • Sterile, distilled water to 12㎕
2. Heat mixture to 65℃ for 5 min an quick chill on ice. Collect the contents of the tube by brief centrifugation and add:
   • 4㎕ 5X First-Strand Buffer
   • 2㎕ 0.1 M DTT
   • 1㎕ RNaseOUTTM Recombinant Ribonuclease Inhibitor (40 units/㎕)

   (Note: When using less than 50 ng of starting RNA, the addition of RNaseOUTTM is essential.)

3. Mix contents of the tube gently and incubate at 37℃ for 2 min.
4. Add 1㎕(200 units) of M-MLV RT,a and mix by pipetting gently up and down. If using random primers, incubate tube at 25℃ for 10 min.
5. Incubate 50 min at 37℃.
6. Inactivate the reaction by heating at 70℃ for 15 min.

Result

Materials

• Resuspended DNA (J04450)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic
• Spreader
• 37℃ incubator
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 2 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 100 μl and 100 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. After picking colonies, store the plate in 4 ℃.

Preparing Samples

Homogenizing samples

• Determine your sample type, and perform homogenization at room temperature according to the table below. The sample volume should not exceed 10% of the volume of TRIzol Reagent used for homogenization. Be sure to use the indicated amount of TRIzol Reagent, because an insufficient volume can result in DNA contamination of isolated RNA.

RNA Isolation Procedurec

Always use the appropriate precautions to avoid RNase contamination when preparing and handling RNA.

RNA precipitation

1. (Optional) When precipitating RNA from small sample quantities (<10⁶ cells or < 10 mg tissue), add 5-10μg of RNase-free glycogen as a carrier to the aqueous phase.
   • Note: Glycogen is co-precipitated with the RNA,but does not inhibit first-strand synthesis at concentrations ≤4mg/mL,and does not inhibit PCR.
2. Add 0.5mL of 100% isopropanol to the aqueous phase, per 1mL of TRIzol Reagent used for homogenization.
3. Incubate at room temperature for 10 minutes.
4. Centrifuge at 12,000 × g for 10 minutes at 4℃.
   • Note: The RNA is often invisible prior to centrifugation, and forms a gel-like pellet on the side and bottom of the tube.
5. Proceed to RNA wash.

Proceed to RNA wash.

1. Remove the supernatant from the tube,leaving only the RNA pellet.
2. Wash the pellet,with 1mL of 75% ethanol per 1mL of TRIzol Reagent used in the initial homogenization.
   • Note: The RNA can be stored in 75% ethanol at least 1 year at-20℃, or at least 1 week at 4℃.
3. Vortex the sample briefly,then centrifuge the tube at 7500 × g for 5 minutes at 4℃.Discard the wash.
4. Vacuum or air dry the RNA pellet for 5-10 minutes. Do not dry the pellet by vacuum centrifuge.
   Note: Do not allow the RNA to dry completely,because the pellet can lose solubility.Partially dissolved RNA samples have an A_260/280 ratio<1.6.
5. Proceed to RNA resuspension.

RNA resuspension

1. Resuspend the RNA pellet in RNase-free water or 0.5% SDS solution(20-50㎕) by passing the solution up and down several times through a pipette tip.
   • Note: Do not dissolve the RNA in 0.5% SDS if it is to be used in subsequent enzymatic reactions.
2. Incubate in a water bath or heat block set at 55-60℃ for 10-15 minutes.
3. Proceed to downstream application, or store at -70℃.

1. To an autoclaved, 1.5ml microcentrifuge tube, add the following:

   	For Cohesive Ends
   5X Ligase Reaction	4 μl
   Vector D	3 to 30 fmol
   Insert D	9 to 90 fmol
   T4 DNA Ligase (	1 unit (in 1 μl)
   Autoclaved distilled	to 20 μl

2. Mix gently. Centrifuge briefly the contents to the bottom of the tube.
3. Incubate at room temperature for 5 min.
4. Use 2 μl of the ligation reaction to transform 100 μl of competent cells.

Add restriction enzyme (EcoRI / SpeI)

Total:40ul

Plasmid DNA:500ng (77.7ng/ul, 500/77.7≒6.5ul)

Materials

• Resuspended DNA (Resuspend well in 10μl dH₂0, pipette up and down several times, let sit for a few minutes)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube (1 per transformation)
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic (2 per transformation)
• Spreader (2 per transformation)
• 37℃ incubator
• 10pg/μl RFP Control (pSB1C3 w/ BBa_J23102)
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA with RFP Control to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 3 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 μl and 150 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. After picking colonies, store the plate in 4 ℃.