Difference between revisions of "Team:HUST-China/Collaborations"

Collaboration

HUST-China, WHU-China and HZAU-China,three universities located in Wuhan region have been keeping close communications and collaborations these years. This summer, we continue the tradition, we three iGEM teams held a seminar in 29st Jul, during which we reached the consensus to establish Wuhan iGEM Committee in the future and held conferences and Science Fair at regular intervals to spread the idea of synthesis biology. Moreover we discussed about our project and exchange some valuable suggestions. Here are the three main collaborations we made this summer.

Construction of CI-PSB1C3

We help WHU team construct a standardized plasmid C1-pSB1C3. Owing to the limit of time and the cost of fragment’s synthesis, WHU decided to generate a short C1 fragment through anneal of single-stranded DNA then insert it into the pSB1C3 between the restriction sites of XbaI and PstI. But they met difficulties and failed after several attempts. After discussions and new experiment design, we helped them finish the construction through the following protocol:
1. Mix up 2.5μL primer F and R
2. Put the mixture in PCR Amplifier :
DNA denateration for 5 minutes
Annealing for 30 seconds
3. Ligation with pSB1C3(XbaI and PstI digested) for 1h
4. Transformation to E.coli
5. Plasmid extract

Notes:
F:
5’ CTAGATTGACAAACAAGATACATTGTATGAAAATACAAGAAAGTTTGTTGAACTAGTAGCGGCCGCCTGCA 3’

R:
5’ GGCGGCCGCTACTAGTTCAACAAACTTTCTTGTATTTTCATACAATGTATCTTGTTTGTCAAT 3’
The result of prime F and R pairing:

(The green part is the cohesive end of XbaI restriction enzyme and the orange part is the cohesive end of PstI)

Lyophilization of plasmid samples

As this year 96-well plate, the lyophilizer of WHU-China cannot handle, must be used to send the DNA submission samples, they ask us for assistance on the lyophilization of samples before shipment. In order to share experimental resources and promote work efficiency, we undertake the job to help them submit all the samples.

Help from HZAU

We met difficulties when amplifying the reporter BBa_E0040 owing to some unknown factors. Considering the limited time, we turned to HZAU-China iGEM team for help. Finally, with the construction of RBS+GFP-pSB1C3 plasmid generously offered from HZAU, they succeeded inserting the reporter gene GFP with RBS respectively to the downstream of the three ptrp mutants.

Others

Apart from these collaborations, we also tried to make collaborations away from Wuhan region. For example: We had planned to utilize a device NZAU designed as a fluorescence detector to achieve a part of our characterization work and help them test the accuracy of the device. But it was a pity that we did not achieve the cooperation this year, because we didn’t finish this corresponding reporter plasmid in time. And we also offered some reasonable advise to ZJU team on safety problems of their project, provided the ideas of kill switch in our previous project. But finally after deep considerations, for the reason of not suiting their project, they adopted another kill switch.

Conclution

All in all, we have achieved several successful collaborations this summer. In the future, we aim at expanding the collaboration region and diversifying the cooperation content, such as helping high school teams with their project for instance.