Difference between revisions of "Team:Tianjin/GFP"
Line 273: | Line 273: | ||
<div id="content-in"> | <div id="content-in"> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">Saturday.6.6.2015</span></strong></span> | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">Saturday.6.6.2015</span></strong><strong><span style="font-size: 19px;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 279: | Line 279: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer: Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP-linker</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Xba1-GFP: 5’-GCTCTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTC</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">GFP-linker: 5’-AGAACCACCACCACCAGAACCACCACCACCTTTGTATAGTTCATC</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<table align="center" cellpadding="0" cellspacing="0" width="269"> | <table align="center" cellpadding="0" cellspacing="0" width="269"> | ||
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
− | <td style="border: 1px solid black; padding: 0px 7px;" valign=" | + | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">Buffer</span> |
</p> | </p> | ||
</td> | </td> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign=" | + | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">5μl</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">dNTPS</span> |
</p> | </p> | ||
</td> | </td> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">5μl</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> |
− | <p style="text-align: center; | + | <p style="text-align:center"> |
− | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">linker-</span><span style="font-size:19px;font-family: 'Arial Unicode MS',sans-serif"> sJanus</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif"> primer</span> | |
</p> | </p> | ||
</td> | </td> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">2μl</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> |
− | <p style="text-align: center; | + | <p style="text-align:center"> |
− | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">sJanus</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif"> -Pst1 primer</span> | |
</p> | </p> | ||
</td> | </td> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">2μl</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">sJanus-m pET28a(+)</span> |
</p> | </p> | ||
</td> | </td> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">1μl</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">Pfu enzyme</span> |
</p> | </p> | ||
</td> | </td> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">0.5μl</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">ddH2O</span> |
</p> | </p> | ||
</td> | </td> | ||
− | <td style="border-width: 1px; border-style: solid; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign=" | + | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132"> |
− | <p style="text-align: center | + | <p style="text-align:center"> |
− | <span style="font-size: 19px; font-family: | + | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">34.5μl</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 381: | Line 381: | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
− | <p style="text-align: center | + | <p> |
+ | <br/> | ||
+ | </p> | ||
+ | <p style="text-align: center;"> | ||
<span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span> | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span> | ||
</p> | </p> | ||
Line 389: | Line 392: | ||
<td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 401: | Line 404: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 413: | Line 416: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">55</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">58</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">60</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 434: | Line 437: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 446: | Line 449: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 458: | Line 461: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 473: | Line 476: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP on 55, 58, 60 centigrade worked well.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 485: | Line 488: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"></ | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><br/></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 491: | Line 494: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 497: | Line 500: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Monday,7.13.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker-sJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker-sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<table align="center" cellpadding="0" cellspacing="0" width="269"> | <table align="center" cellpadding="0" cellspacing="0" width="269"> | ||
Line 546: | Line 549: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- sJanus primer</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 558: | Line 561: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus -Pst1 primer</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 570: | Line 573: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus pET28a(+)</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 613: | Line 616: | ||
<td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 625: | Line 628: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 637: | Line 640: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif; | + | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2:55℃</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif; | + | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3:58℃</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">60</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 658: | Line 661: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 670: | Line 673: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 682: | Line 685: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 694: | Line 697: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"> <span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"> <span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus on all centigrades worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 703: | Line 706: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 709: | Line 712: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Monday,7.13.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-m</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker- sJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">SJANUS-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<table align="center" cellpadding="0" cellspacing="0" width="269"> | <table align="center" cellpadding="0" cellspacing="0" width="269"> | ||
Line 758: | Line 761: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- sJanus primer</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 770: | Line 773: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus -Pst1 primer</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 825: | Line 828: | ||
<td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 837: | Line 840: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 849: | Line 852: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">55</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">58</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">60</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 870: | Line 873: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 882: | Line 885: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 894: | Line 897: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 906: | Line 909: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-m on all centigrades worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 912: | Line 915: | ||
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 921: | Line 924: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Monday,7.13.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker- inJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- inJanus: 5’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">INJANUS-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<table align="center" cellpadding="0" cellspacing="0" width="269"> | <table align="center" cellpadding="0" cellspacing="0" width="269"> | ||
Line 1,037: | Line 1,040: | ||
<td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,049: | Line 1,052: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,061: | Line 1,064: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:50.1</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:53.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:56.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4:58.5</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,082: | Line 1,085: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,094: | Line 1,097: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,106: | Line 1,109: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,121: | Line 1,124: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus didn’t work well. The electrophoretic bands towing phenomenon is obvious.</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 1,133: | Line 1,136: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">analyse</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> We suspect is caused by low temperature. So we raise the temperature to conduct the PCR later.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Tuesday,7.14.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker- inJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- inJanus:</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 1,154: | Line 1,157: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<table align="center" cellpadding="0" cellspacing="0" width="269"> | <table align="center" cellpadding="0" cellspacing="0" width="269"> | ||
Line 1,188: | Line 1,191: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- inJanus</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 1,264: | Line 1,267: | ||
<td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,276: | Line 1,279: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,288: | Line 1,291: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:59.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:65.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:67.0</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,306: | Line 1,309: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,318: | Line 1,321: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,330: | Line 1,333: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,342: | Line 1,345: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 1,348: | Line 1,351: | ||
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 1,357: | Line 1,360: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">: Tuesday,7.14.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker-inJanus-m</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker-inJanus-m:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTCTACCACTGGC</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 1,375: | Line 1,378: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<table align="center" cellpadding="0" cellspacing="0" width="269"> | <table align="center" cellpadding="0" cellspacing="0" width="269"> | ||
Line 1,479: | Line 1,482: | ||
<td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,491: | Line 1,494: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,503: | Line 1,506: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:59.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:65.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:67.0</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,521: | Line 1,524: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,533: | Line 1,536: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,545: | Line 1,548: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,557: | Line 1,560: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m on these three centigrades worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 1,563: | Line 1,566: | ||
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 1,572: | Line 1,575: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 1,584: | Line 1,587: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP- sJanus</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 1,593: | Line 1,596: | ||
</p> | </p> | ||
<p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | ||
+ | |||
<span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> | ||
</p> | </p> | ||
Line 1,636: | Line 1,640: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146"> | ||
<p style="text-align: center; text-indent: 0px; line-height: 1.5em;"> | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus fragment</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 1,832: | Line 1,836: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus for SOE</span> <span style="font-size: 19px; font-family: arial;,sans-serif;">PCR with PSB1C3 worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 1,841: | Line 1,845: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 1,847: | Line 1,851: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 1,853: | Line 1,857: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP-sJanus-m</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus -Pst1</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">temperature</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> 53, 55, 56, and 58 centigrade.</span></span> |
</p> | </p> | ||
<p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | ||
Line 2,095: | Line 2,099: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-m for SOE</span> <span style="font-size: 19px; font-family: arial;,sans-serif;">PCR with PSB1C3 worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 2,104: | Line 2,108: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
Line 2,110: | Line 2,114: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 2,116: | Line 2,120: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP- sJanus</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;"> temperature</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> 55, 56.3 ,57.8 and 58.9 centigrade.</span></span> |
</p> | </p> | ||
<p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | ||
Line 2,162: | Line 2,166: | ||
<p style="text-align: center; text-indent: 0px; line-height: 1.5em;"> | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;"> | ||
<span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span> | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span> | ||
+ | |||
</p> | </p> | ||
</td> | </td> | ||
Line 2,168: | Line 2,173: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146"> | ||
<p style="text-align: center; text-indent: 0px; line-height: 1.5em;"> | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus fragment</span> |
</p> | </p> | ||
</td> | </td> | ||
Line 2,361: | Line 2,366: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus for SOE PCR with PSB1C3 worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 2,367: | Line 2,372: | ||
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
Line 2,376: | Line 2,381: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date</span></strong><strong><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 2,382: | Line 2,387: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP-inJanus</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;"> temperature</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> 55, 56.3 ,57.8 and 58.9 centigrade.</span></span> |
</p> | </p> | ||
<p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;"> | ||
Line 2,627: | Line 2,632: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"> <span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"> <span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m for SOE</span> <span style="font-size: 19px; font-family: arial;,sans-serif;">PCR with PSB1C3 worked</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 2,633: | Line 2,638: | ||
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 2,642: | Line 2,647: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"> <strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"> <strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Thursday,7.16.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 2,657: | Line 2,662: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Friday,7.17.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 2,663: | Line 2,668: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Transformed the expression vectors we had already connected into the <em>Escherichia coli </em>DH5α, then incubated the bacteria for 12h (37</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: arial;,sans-serif;">).</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 2,675: | Line 2,680: | ||
</p> | </p> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 8000bp, and following is 8000, 5000, 3000,1500,1000and 500bp from up and down, our target sequence is about 1000bp approximately. But the bands in this figure are all about 5000bp, so we suspect that the fragments are not connected to plasmid.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Analyse</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The fragments are not connected to plasmid.</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Sunday,7.19.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 2,690: | Line 2,695: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Monday,7.20.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 2,696: | Line 2,701: | ||
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Tuesday,7.21.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
Line 2,702: | Line 2,707: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">EcoR1-GFP-sJanus -Xho1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">EcoR1-GFP-sJanus-m-Xho1</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">EcoR1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Xho1</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">EcoR1-GFP: 5’-CGGAATTCATGCGTAAAGGAGAAGAACTT</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
Line 2,714: | Line 2,719: | ||
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<table align="center" cellpadding="0" cellspacing="0" width="269"> | <table align="center" cellpadding="0" cellspacing="0" width="269"> | ||
Line 2,812: | Line 2,817: | ||
<td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 2,824: | Line 2,829: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 2,836: | Line 2,841: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:55.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:56.6</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:57.8</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4:60.3</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 2,857: | Line 2,862: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 2,869: | Line 2,874: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 2,881: | Line 2,886: | ||
<td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136"> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span> |
</p> | </p> | ||
</td> | </td> | ||
Line 2,893: | Line 2,898: | ||
</table> | </table> | ||
<p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">fragments on these four centigrades all worked well.</span></span> |
</p> | </p> | ||
<p style="text-align: center; line-height: 1.5em;"> | <p style="text-align: center; line-height: 1.5em;"> | ||
Line 2,899: | Line 2,904: | ||
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="line-height: 1.5em;"> | <p style="line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Fragment concentration:EcoR1-GFP-sJanus -Xho1:55.0ng/μL</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">EcoR1-GFP-sJanus-m-Xho1:60ng/μL</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Saturday,8.1.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">We used enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We used T4 DNA ligase to connect them at the temperature of 22 centigrade for about one hour. Then we transformed the expression vectors we had already connected into the <em>Escherichia coli </em>DH5α, then incubated the bacteria for 12h (37</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: arial;,sans-serif;">)</span></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-size: 19px; font-family: | + | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">It has been confirmed that these sequences we get are right when detecting them in company.</span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date:Monday,8.10.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span> |
</p> | </p> | ||
<p style="text-align: left; line-height: 1.5em;"> | <p style="text-align: left; line-height: 1.5em;"> | ||
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: | + | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Transformed the expression vectors(concentration:140.3ng/μL</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">121.4ng/μL) we had already built before (pET28a(+)) into the <em>Escherichia coli </em>BL21, then incubated the bacteria for 12h (37</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: arial;,sans-serif;">).</span></span> |
</p> | </p> | ||
+ | |||
</div> | </div> | ||
<div>2</div> | <div>2</div> |
Latest revision as of 02:20, 14 September 2015
Saturday.6.6.2015
PCR on PSB1C3
gene of interst:GFP
primer: Xba1-GFP、GFP-linker
Xba1-GFP: 5’-GCTCTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTC
GFP-linker: 5’-AGAACCACCACCACCAGAACCACCACCACCTTTGTATAGTTCATC
PCR system:(50μl)
Buffer |
5μl |
dNTPS |
5μl |
linker- sJanus primer |
2μl |
sJanus -Pst1 primer |
2μl |
sJanus-m pET28a(+) |
1μl |
Pfu enzyme |
0.5μl |
ddH2O |
34.5μl |
cycle
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:55℃ 3:58℃ 4:60℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
qualitative agarose gel electrophpresis:GFP on 55, 58, 60 centigrade worked well.
(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 750bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration: 51.7 ng/μL
Date: Monday,7.13.2015
PCR on pET28a(+)
gene of interst:sJanus
primer:linker-sJanus、sJanus-Pst1
linker-sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA
sJanus-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG
PCR system:(50μl)
Buffer |
5μl |
dNTPS |
5μl |
linker- sJanus primer |
2μl |
sJanus -Pst1 primer |
2μl |
sJanus pET28a(+) |
1μl |
Pfu enzyme |
0.5μl |
ddH2O |
34.5μl |
cycle
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:55℃ 3:58℃ 4:60℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:sJanus on all centigrades worked
(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:70.2ng/μL
Date: Monday,7.13.2015
PCR on pET28a(+)
gene of interst:sJanus-m
primer:linker- sJanus、sJanus-Pst1
linker- sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA
SJANUS-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG
PCR system:(50μl)
Buffer |
5μl |
dNTPS |
5μl |
linker- sJanus primer |
2μl |
sJanus -Pst1 primer |
2μl |
sJanus-m pET28a(+) |
1μl |
Pfu enzyme |
0.5μl |
ddH2O |
34.5μl |
cycle
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:55℃ 3:58℃ 4:60℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:sJanus-m on all centigrades worked
(The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:70.6ng/μL
Date: Monday,7.13.2015
PCR on pET28a(+)
gene of interst:inJanus
primer:linker- inJanus、inJanus-Pst1
linker- inJanus: 5’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
INJANUS-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
PCR system:(50μl)
Buffer |
5μl |
dNTPS |
5μl |
BFP_F primer |
2μl |
BFP_R primer |
2μl |
BFP pSB1C3 |
1μl |
Pfu enzyme |
0.5μl |
ddH2O |
34.5μl |
cycle
95℃ |
5min |
95℃ |
30s |
1:50.1℃ 2:53.4℃ 3:56.4℃ 4:58.5℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:inJanus didn’t work well. The electrophoretic bands towing phenomenon is obvious.
(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)
analyse: We suspect is caused by low temperature. So we raise the temperature to conduct the PCR later.
Date: Tuesday,7.14.2015
PCR on pET28a(+)
gene of interst:inJanus
primer:linker- inJanus、inJanus-Pst1
linker- inJanus:
5’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
inJanus-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
PCR system:(50μl)
Buffer |
5μl |
dNTPS |
5μl |
linker- inJanus primer |
2μl |
inJanus -Pst1 primer |
2μl |
inJanus pET28a(+) |
1μl |
Pfu enzyme |
0.5μl |
ddH2O |
34.5μl |
cycle
95℃ |
5min |
95℃ |
30s |
1:59.4℃ 2:65.4℃ 3:67.0℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:inJanus-m worked
(The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:43.5ng/μL
Date: Tuesday,7.14.2015
PCR on pET28a(+)
gene of interst:inJanus-m
primer:linker-inJanus-m、inJanus-Pst1
linker-inJanus-m:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTCTACCACTGGC
inJanus
-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
PCR system:(50μl)
Buffer |
5μl |
dNTPS |
5μl |
linker-inJanus-m primer |
2μl |
inJanus -Pst1 primer |
2μl |
inJanus-m pET28a(+) |
1μl |
Pfu enzyme |
0.5μl |
ddH2O |
34.5μl |
cycle
95℃ |
5min |
95℃ |
30s |
1:59.4℃ 2:65.4℃ 3:67.0℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:inJanus-m on these three centigrades worked
(The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:55.0ng/μL
Date: Wednesday,7.15.2015
SOE PCR
SOE PCR stands for Splicing by Overlapp Extension PCR. It is a standard overlapp extension procedure, enabling the assembly of genes wihtout performing any cloning, digesting or ligation inbetween. All you need to do ist running PCRs with specific primers. If gene A is the upstream part and gene B has to be assembled downstream of gene A, primer lo of gene A should have an overlapp of around 20 nucleotides complementary to the first 20 nucleotides of gene B. Primer up of gene B should haven a complementary overlapp of 20 nucleotides to the end of gene A.
gene of interst:GFP- sJanus
primer:Xba1-GFP、sJanus-Pst1
temperature: 53, 55, 56, and 58 centigrade.
PCR system(100μl)
Buffer |
10μl |
dNTPS |
10μl |
GFP fragment |
5μl |
sJanus fragment |
5μl |
Pfu enzyme |
1μl |
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:56℃ 3:65℃ |
30s |
72℃ |
2min |
72℃ |
10min |
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:56℃ 3:65℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:GFP-sJanus for SOE PCR with PSB1C3 worked
The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:32.2ng/μL
Date: Wednesday,7.15.2015
SOE PCR
gene of interst:GFP-sJanus-m
primer:Xba1-GFP、sJanus -Pst1
temperature: 53, 55, 56, and 58 centigrade.
PCR system(100μl)
Buffer |
10μl |
dNTPS |
10μl |
GFP fragment |
5μl |
sJanus-m fragment |
5μl |
Pfu enzyme |
1μl |
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:56℃ 3:65℃ |
30s |
72℃ |
2min |
72℃ |
10min |
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:56℃ 3:65℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:GFP-sJanus-m for SOE PCR with PSB1C3 worked
The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration: 30.5ng/μL
Date: Wednesday,7.15.2015
SOE PCR
gene of interst:GFP- sJanus
primer:Xba1-GFP、inJanus-Pst1
temperature: 55, 56.3 ,57.8 and 58.9 centigrade.
PCR system(100μl)
Buffer |
10μl |
dNTPS |
10μl |
GFP fragment |
5μl |
inJanus fragment |
5μl |
Pfu enzyme |
1μl |
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
95℃ |
5min |
95℃ |
30s |
1:55℃ 2:56.3℃ 3:57.8℃ 4:58.9℃ |
30s |
72℃ |
2min |
72℃ |
10min |
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:56℃ 3:65℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:GFP-inJanus for SOE PCR with PSB1C3 worked
(The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:31.1ng/μL
Date:Wednesday,7.15.2015
SOE PCR
gene of interst:GFP-inJanus
primer:Xba1-GFP、inJanus-Pst1
temperature: 55, 56.3 ,57.8 and 58.9 centigrade.
PCR system(100μl)
Buffer |
10μl |
dNTPS |
10μl |
GFP fragment |
5μl |
inJanus-m fragment |
5μl |
Pfu enzyme |
1μl |
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
95℃ |
5min |
95℃ |
30s |
1:55℃ 2:56.3℃ 3:57.8℃ 4:58.9℃ |
30s |
72℃ |
2min |
72℃ |
10min |
95℃ |
5min |
95℃ |
30s |
1:50℃ 2:56℃ 3:65℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:GFP-inJanus-m for SOE PCR with PSB1C3 worked
(The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:50.3ng/μL
Date: Thursday,7.16.2015
restriction enzyme digestion
After qualitative agarose gel electrophpresis, all the target sequence are 1000bp approximately.
Fragment concentration: sJanus is 6.9ng/μL, sJanus-m is 15.3ng/μL, inJanus is 4.6ng/μL, inJanus-m is 7.0ng/μL.
Date: Friday,7.17.2015
We used T4 DNA ligase to connect them at the temperature of 22 centigrade about an hour.
Transformed the expression vectors we had already connected into the Escherichia coli DH5α, then incubated the bacteria for 12h (37℃).
Date:Saturday,7.18.2015
Enzymes cut each, but they did not work.
(The maximum of marker is 8000bp, and following is 8000, 5000, 3000,1500,1000and 500bp from up and down, our target sequence is about 1000bp approximately. But the bands in this figure are all about 5000bp, so we suspect that the fragments are not connected to plasmid.)
Analyse:The fragments are not connected to plasmid.
Date: Sunday,7.19.2015
We chose another DH5α and trans
formed again.
Date: Monday,7.20.2015
Enzyme cut,
Date: Tuesday,7.21.2015
We design another kind of primer and reverse which contain EcoRI and XhoI site. We have got the standard GFP-sJanus and GFP-sJanus-m fragments, and we got the target fragments used to construct the expression vector by PCR.
gene of interst:EcoR1-GFP-sJanus -Xho1、EcoR1-GFP-sJanus-m-Xho1
primer:EcoR1-GFP、sJanus-Xho1
EcoR1-GFP: 5’-CGGAATTCATGCGTAAAGGAGAAGAACTT
sJanus-Xho1: 5’-CCGCTCGAGTCAAGCACCGACGGCC
PCR system:(50μl)
Buffer |
5μl |
dNTPS |
5μl |
EcoR1-GFP primer |
2μl |
sJanus-Xho1 primer |
2μl |
Xba1-GFP-sJanus -Pst1/ Xba1-GFP-sJanus-m-Pst1 |
1μl |
Pfu enzyme |
0.5μl |
ddH2O |
34.5μl |
cycle
95℃ |
5min |
95℃ |
30s |
1:55.4℃ 2:56.6℃ 3:57.8℃ 4:60.3℃ |
30s |
72℃ |
2min |
72℃ |
10min |
4℃ |
Forever |
qualitative agarose gel electrophpresis:fragments on these four centigrades all worked well.
(The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:EcoR1-GFP-sJanus -Xho1:55.0ng/μL、EcoR1-GFP-sJanus-m-Xho1:60ng/μL
Date: Saturday,8.1.2015
We used enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We used T4 DNA ligase to connect them at the temperature of 22 centigrade for about one hour. Then we transformed the expression vectors we had already connected into the Escherichia coli DH5α, then incubated the bacteria for 12h (37℃)
It has been confirmed that these sequences we get are right when detecting them in company.
Date:Monday,8.10.2015
Transformed the expression vectors(concentration:140.3ng/μL、121.4ng/μL) we had already built before (pET28a(+)) into the Escherichia coli BL21, then incubated the bacteria for 12h (37℃).