Difference between revisions of "Team:CHINA CD UESTC/Method"
Line 120: | Line 120: | ||
•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg | •ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg | ||
<br> | <br> | ||
− | Same as the ( | + | Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between <i>mamW</i>, <i>RFP</i> and <i>laccase</i>. |
</p> | </p> | ||
<p> | <p> | ||
•gcaggtagcggcagcggtagcggtagcggcagcgcg | •gcaggtagcggcagcggtagcggtagcggcagcgcg | ||
<br> | <br> | ||
− | Refer to 6aa [GS] linker(Name: <a href="http://parts.igem.org/Part:BBa_J18921">BBa_J18921</a>): between <i>mamW</i> and <i>RFP</i>. | + | Refer to 6aa [GS]x linker(Name: <a href="http://parts.igem.org/Part:BBa_J18921">BBa_J18921</a>): between <i>mamW</i> and <i>RFP</i>. |
</p> | </p> | ||
<div class="project_pic"> | <div class="project_pic"> |
Revision as of 04:39, 17 September 2015
<!DOCTYPE html>
METHOD
We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time.