|
|
Line 5: |
Line 5: |
| <div class="text"> | | <div class="text"> |
| Colonies from the transformation were checked with a colony PCR. Herefore the following primers were used. | | Colonies from the transformation were checked with a colony PCR. Herefore the following primers were used. |
| + | |
| + | |
| | | |
| | | |
Line 10: |
Line 12: |
| AATTCATGTAAAAGATGAGGTTGGTTCATT | | AATTCATGTAAAAGATGAGGTTGGTTCATT |
| | | |
| + | |
| + | |
| | | |
| | | |
| iGEM erm-thrC rev 2 | | iGEM erm-thrC rev 2 |
| AGGAAGTTAAAGGAGCTCGAATTAATTCC | | AGGAAGTTAAAGGAGCTCGAATTAATTCC |
| + | |
| + | |
| | | |
| | | |
Revision as of 20:05, 17 September 2015
00:00, 4 September 2015 - 00:00, 4 September 2015
Colonies from the transformation were checked with a colony PCR. Herefore the following primers were used.
IGEM thrC forward
AATTCATGTAAAAGATGAGGTTGGTTCATT
iGEM erm-thrC rev 2
AGGAAGTTAAAGGAGCTCGAATTAATTCC
expected bands around 2500 bp.
Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37°C