Difference between revisions of "Team:CHINA CD UESTC/Method"

 
(52 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
{{Template:Team:CHINA_CD_UESTC/menu}}
 
{{Template:Team:CHINA_CD_UESTC/menu}}
 +
{{Template:Team:CHINA_CD_UESTC/cssstyle}}
 +
 
<!DOCTYPE html>
 
<!DOCTYPE html>
−
<!-- saved from url=(0028)http://www.whitefrontier.ch/ -->
 
 
<html>
 
<html>
 
<head>
 
<head>
  
−
<link rel="stylesheet" href="https://2015.igem.org/Team:CHINA_CD_UESTC/Template:RightStyle.css?action=raw&ctype=text/css" type="text/css" />
 
 
</head>
 
</head>
  
−
<style type="text/css">
+
    <style type="text/css">
 
/*************************************************
 
/*************************************************
−
whole right section
+
                whole right section
  
 
***********************************************/
 
***********************************************/
 
#RightSection {
 
#RightSection {
−
position: fixed;
+
    position: fixed;
−
left: 260px;
+
    left: 260px;
−
top: 0;
+
    top: 0;
−
right: 0;
+
    right: 0;
−
height:100%;
+
    height:100%;
−
background:#F0F0F0;
+
    background:#F0F0F0;
−
background-image:url("https://static.igem.org/mediawiki/2015/8/8e/CHINA_CD_UESTC_PROJECTbg.jpg");
+
    background-image:url("https://static.igem.org/mediawiki/2015/8/8e/CHINA_CD_UESTC_PROJECTbg.jpg");
−
overflow-y: scroll;
+
    overflow-y: scroll;
−
background-repeat: repeat;
+
    background-repeat: repeat;
−
background-size: 180px;
+
    background-size: 180px;
−
transition: all 200ms ease-out;
+
    transition: all 200ms ease-out;
−
transform: translate3d(0, 0, 0);
+
    transform: translate3d(0, 0, 0);
−
z-index:1;
+
    z-index:1;
  
 +
}
 +
.clear {
 +
    display: block;
 +
    height: 10px;
 
}
 
}
  
−
</style>
+
.surround_cont {
−
<body id="homeIndexBody">
+
    display: inline-block;
 +
width: 100%;
 +
}
 +
.surround_pic {
 +
    float: right;
 +
    border: 10px ;
 +
}
  
−
<div id="RightSection"></div>
+
#array_illustration {
 +
float: left;
 +
margin-top: 100%;
 +
}
  
−
<div id="title">
 
  
−
<div id="firstTitle">
 
−
<p>
 
−
<B>METHOD</B>
 
−
</p>
 
−
</div>
 
−
</div>
 
  
−
<div id="RightContent">
+
</style>
−
<div class="transparent_class ">
+
<body id="homeIndexBody">
−
<p class="blockWords">
+
−
&nbsp;&nbsp;We are a skillful and persistent group of nine Finns. We started as a group of students who didn't really know each other, assuming that we were going to spend our summer studying synthetic biology with strange colleagues. In the end we got a bunch of new friends and (in addition to studying synthetic biology) we just might have spent one of the best summers of our lives.
+
−
</p>
+
−
</div>
+
−
 
+
−
<div id="RightContentText">
+
−
<div class="slide" id="slide2" data-slide="2" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;">
+
−
<div class="container clearfix">
+
−
 
+
−
<div id="content" class="grid_12">
+
−
<h2>About Me</h2>
+
−
</div>
+
−
<div class="clear"></div>
+
  
−
<div id="content">
+
    <div id="RightSection"></div>
−
<div class="grid_8">
+
−
<h4>Biography</h4>
+
−
<p>
+
−
Morbi rutrum, elit ac fermentum egestas, tortor ante vestibulum est, eget scelerisque nisl velit eget tellus. Fusce porta facilisis luctus. Integer neque dolor, rhoncus nec euismod eget, pharetra et tortor. Nulla id pulvinar nunc. Vestibulum auctor nisl vel lectus ullamcorper sed pellentesque dolor eleifend. Praesent lobortis magna vel diam mattis sagittis.
+
−
</p>
+
−
<p>
+
−
Mauris porta odio eu risus scelerisque id facilisis ipsum dictum vitae volutpat. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed pulvinar neque eu purus sollicitudin et sollicitudin dui ultricies. Maecenas cursus auctor tellus sit amet blandit. Maecenas a erat ac nibh molestie interdum. Class aptent taciti sociosqu ad litora torquent per conubia nostra, per inceptos himenaeos. Sed lorem enim, ultricies sed sodales id, convallis molestie ipsum. Morbi eget dolor ligula. Vivamus accumsan rutrum nisi nec elementum. Pellentesque at nunc risus. Phasellus ullamcorper bibendum varius.  Quisque quis ligula sit amet felis ornare porta. Aenean viverra lacus et mi elementum mollis. Praesent eu justo elit.
+
−
</p>
+
−
</div>
+
−
<div class="clear"></div>
+
  
−
</div>
+
    <div id="title">
  
−
</div>
+
        <div id="firstTitle">
−
</div>
+
            <p>
 +
                <B>METHOD</B>
 +
            </p>
 +
        </div>
 +
    </div>
  
−
<div class="slide" id="slide2" data-slide="4" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;">
+
    <div id="RightContent">
−
<div class="container clearfix">
+
        <div class="transparent_class ">
 +
            <p class="blockWords">
 +
                &nbsp;&nbsp;We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time.
 +
            </p>
 +
        </div>
  
−
<div id="content" class="grid_12">
+
        <div id="RightContentText">
−
<h2>About Me</h2>
+
            <div class="slide" id="slide2" data-slide="2" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;">
−
</div>
+
                <div class="container clearfix">
−
<div class="clear"></div>
+
                    <div id="content">
 +
                        <div class="grid_8">
 +
                            <p>
 +
                                If you want to check or follow our project, you can read this page to get the main information concerning our project. In addition, you will get more details about experiment from our protocols.
 +
                                <br>
 +
                                <br></p>
 +
                            <div class="array_foto">
 +
                                <div class="client_foto">
 +
                                    <img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%">
 +
                                    <p id="array_illustration"><strong>Figure 1.</strong>Gene and clusters mainly related to our project</p>
 +
                                    </div>
 +
                                <h3>Q1: How to get target gene?</h3>
 +
                                <p>Four operons related to magnetosome synthesis (<i>mamAB</i>/<i>mamGFDC</i>/<i>mamXY</i>/<i>mms6</i>) and <i>mamW</i>: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify(Figure 1).
 +
                                </p>
 +
                                <p>
 +
                                    <i>laccase</i> gene and <i>RFP</i>: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: <a href="http://parts.igem.org/Part:BBa_K863005">BBa_K863005</a>, <a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and amplify them through common PCR.
 +
                                </p>
 +
                            </div>
 +
                            <br>
 +
                            <div class="clear"></div>
 +
                            <h3>Q2: Where are the backbone vectors from?</h3>
 +
                            <p>
 +
                                All backbone vectors are purchased from Biotech Corp. They are pET-28a(Figure 2), pCDFDuet-1(Figure 3) and pACYCDuet-1(Figure 4), the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (<i>mamW</i> + <i>RFP</i> + <i>laccase</i>) together.
 +
                            </p>
  
−
<div id="content">
+
                            <div class="project_pic">
−
<div class="grid_8">
+
                                <p id="pic_title"></p>
−
<h4>Biography</h4>
+
                                <img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%">
−
<p>
+
                                <p id="pic_illustration">
−
Morbi rutrum, elit ac fermentum egestas, tortor ante vestibulum est, eget scelerisque nisl velit eget tellus. Fusce porta facilisis luctus. Integer neque dolor, rhoncus nec euismod eget, pharetra et tortor. Nulla id pulvinar nunc. Vestibulum auctor nisl vel lectus ullamcorper sed pellentesque dolor eleifend. Praesent lobortis magna vel diam mattis sagittis.
+
                                <strong>Figure 2.</strong> This vector backbone (pET-28a) will be inserted <i>mamAB</i></p>
−
</p>
+
                            </div>
−
<p>
+
                            <div class="project_pic">
−
Mauris porta odio eu risus scelerisque id facilisis ipsum dictum vitae volutpat. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed pulvinar neque eu purus sollicitudin et sollicitudin dui ultricies. Maecenas cursus auctor tellus sit amet blandit. Maecenas a erat ac nibh molestie interdum. Class aptent taciti sociosqu ad litora torquent per conubia nostra, per inceptos himenaeos. Sed lorem enim, ultricies sed sodales id, convallis molestie ipsum. Morbi eget dolor ligula. Vivamus accumsan rutrum nisi nec elementum. Pellentesque at nunc risus. Phasellus ullamcorper bibendum varius.  Quisque quis ligula sit amet felis ornare porta. Aenean viverra lacus et mi elementum mollis. Praesent eu justo elit.
+
                                <p id="pic_title"></p>
−
</p>
+
                                <img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%">
−
</div>
+
                                <p id="pic_illustration">
−
<div class="clear"></div>
+
                                <strong>Figure 3.</strong> This vector backbone (pCDFDuet-1) will be inserted <i>mamGFDC</i>+<i>mms6</i>+<i>mamXY</i> and <i>mamGFDC</i>+<i>mms6</i></p>
 +
                            </div>
 +
                            <div class="project_pic">
 +
                                <p id="pic_title"></p>
 +
                                <img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%">
 +
                                <p id="pic_illustration">
 +
                                <strong>Figure 4.</strong> This vector backbone (pACYCDuet-1) will be inserted <i>mamW</i>+<i>RFP</i>+<i>laccase</i>, <i>RFP</i>+<i>laccase</i> and <i>mamW</i>+<i>laccase</i></p>
 +
                            </div>
  
−
</div>
+
                            <h3>
 +
                                Q3: What kinds of linker we chose for linking between our protein domains?
 +
                            </h3>
 +
                            <p>
 +
                                We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers(Figure 5).
 +
                            </p>
 +
                            <p>
 +
                                •ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
 +
                                <br>
 +
                                Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between <i>mamW</i>, <i>RFP</i> and <i>laccase</i>.
 +
                            </p>
 +
                            <p>
 +
                                •gcaggtagcggcagcggtagcggtagcggcagcgcg
 +
                                <br>
 +
                                Refer to 6aa [GS]x linker(Name: <a href="http://parts.igem.org/Part:BBa_J18921">BBa_J18921</a>): between <i>mamW</i> and <i>RFP</i>.
 +
                            </p>
 +
                            <div class="project_pic">
 +
                                <p id="pic_title"></p>
 +
                                <img src="https://static.igem.org/mediawiki/2015/6/67/CHINA_CD_UESTC_METHOD06.png" width="60%">
 +
                                <p id="pic_illustration"><strong>Figure 5.</strong>Three combinations of linking between various protein domains</p>
 +
                            </div>
  
−
</div>
+
                            <h3>
−
</div>
+
                                Q4: What kinds of enzymes did we use when we made target gene insert into vectors?
 +
                            </h3>
 +
                            <div class="surround_cont">
 +
                            <p>
 +
                                <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%">
 +
                                •pET28a: <br>Considered  that it is the largest operon size (17kb), we divided <i>mamAB</i> operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of <i>mamAB</i> come true.
 +
                            </p>
 +
                        </div>
 +
                            <div class="surround_cont">
  
−
</div>
+
                            <p>
−
</div>
+
                                <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%">
 +
                                •pCDFDuet-1: <br>The restriction sites flanking <i>mamGFDC</i>+<i>mms6</i> on either side are (HindⅢ) and (XhoⅠ), flanking <i>mamXY</i> on either side are (XbaⅠ)and (PstⅠ)
 +
                            </p></div>
 +
                                                        <div class="surround_cont">
  
 +
                            <p>
 +
                                <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%">
 +
                                •pACYCDuet-1: <br>The restriction sites flanking <i>mamW</i>+<i>RFP</i>+<i>laccase</i> on either side are (PstⅠ) and (XhoⅠ).
 +
                            </p>
 +
                        </div>
 +
                        </div>
 +
                    </div>
 +
                </div>
 +
            </div>
 +
        </div>
 +
    </div>
 
</body>
 
</body>
  
 
</html>
 
</html>

Latest revision as of 02:52, 18 September 2015

<!DOCTYPE html>

METHOD

  We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time.

If you want to check or follow our project, you can read this page to get the main information concerning our project. In addition, you will get more details about experiment from our protocols.

Figure 1.Gene and clusters mainly related to our project

Q1: How to get target gene?

Four operons related to magnetosome synthesis (mamAB/mamGFDC/mamXY/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify(Figure 1).

laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: BBa_K863005, BBa_E1010) and amplify them through common PCR.


Q2: Where are the backbone vectors from?

All backbone vectors are purchased from Biotech Corp. They are pET-28a(Figure 2), pCDFDuet-1(Figure 3) and pACYCDuet-1(Figure 4), the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (mamW + RFP + laccase) together.

Figure 2. This vector backbone (pET-28a) will be inserted mamAB

Figure 3. This vector backbone (pCDFDuet-1) will be inserted mamGFDC+mms6+mamXY and mamGFDC+mms6

Figure 4. This vector backbone (pACYCDuet-1) will be inserted mamW+RFP+laccase, RFP+laccase and mamW+laccase

Q3: What kinds of linker we chose for linking between our protein domains?

We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers(Figure 5).

•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: BBa_K416001): between mamW, RFP and laccase.

•gcaggtagcggcagcggtagcggtagcggcagcgcg
Refer to 6aa [GS]x linker(Name: BBa_J18921): between mamW and RFP.

Figure 5.Three combinations of linking between various protein domains

Q4: What kinds of enzymes did we use when we made target gene insert into vectors?

•pET28a:
Considered that it is the largest operon size (17kb), we divided mamAB operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of mamAB come true.

•pCDFDuet-1:
The restriction sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamXY on either side are (XbaⅠ)and (PstⅠ)

•pACYCDuet-1:
The restriction sites flanking mamW+RFP+laccase on either side are (PstⅠ) and (XhoⅠ).