Difference between revisions of "Team:CHINA CD UESTC/Method"

 
(40 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
{{Template:Team:CHINA_CD_UESTC/menu}}
 
{{Template:Team:CHINA_CD_UESTC/menu}}
 +
{{Template:Team:CHINA_CD_UESTC/cssstyle}}
 +
 
<!DOCTYPE html>
 
<!DOCTYPE html>
 
<html>
 
<html>
 
<head>
 
<head>
  
−
<link rel="stylesheet" href="https://2015.igem.org/Team:CHINA_CD_UESTC/Template:RightStyle.css?action=raw&ctype=text/css" type="text/css" />
 
 
</head>
 
</head>
  
−
<style type="text/css">
+
    <style type="text/css">
 
/*************************************************
 
/*************************************************
−
whole right section
+
                whole right section
  
 
***********************************************/
 
***********************************************/
 
#RightSection {
 
#RightSection {
−
position: fixed;
+
    position: fixed;
−
left: 260px;
+
    left: 260px;
−
top: 0;
+
    top: 0;
−
right: 0;
+
    right: 0;
−
height:100%;
+
    height:100%;
−
background:#F0F0F0;
+
    background:#F0F0F0;
−
background-image:url("https://static.igem.org/mediawiki/2015/8/8e/CHINA_CD_UESTC_PROJECTbg.jpg");
+
    background-image:url("https://static.igem.org/mediawiki/2015/8/8e/CHINA_CD_UESTC_PROJECTbg.jpg");
−
overflow-y: scroll;
+
    overflow-y: scroll;
−
background-repeat: repeat;
+
    background-repeat: repeat;
−
background-size: 180px;
+
    background-size: 180px;
−
transition: all 200ms ease-out;
+
    transition: all 200ms ease-out;
−
transform: translate3d(0, 0, 0);
+
    transform: translate3d(0, 0, 0);
−
z-index:1;
+
    z-index:1;
  
 
}
 
}
 
.clear {
 
.clear {
−
display: block;
+
    display: block;
−
height: 10px;
+
    height: 10px;
 
}
 
}
  
 
.surround_cont {
 
.surround_cont {
−
display: inline-block;
+
    display: inline-block;
 +
width: 100%;
 
}
 
}
 
.surround_pic {
 
.surround_pic {
−
float: right;
+
    float: right;
 
     border: 10px ;
 
     border: 10px ;
 
}
 
}
  
−
 
+
#array_illustration {
−
.project_pic {
+
float: left;
−
width: 100%;
+
margin-top: 100%;
−
padding: 10px 0px 10px 20%;
+
 
}
 
}
  
−
#pic_title {
 
−
    width: 100%;
 
−
    font-size: 20px;
 
−
    font-family: Helvetica;
 
−
    font-weight: 500;
 
−
    margin-left: -20%;
 
−
    color: rgb(185, 87, 0);
 
−
}
 
−
#pic_illustration {
 
−
font-size: 15px;
 
−
}
 
  
−
.list_txt {
 
−
padding:0px 30px 10px 20px;
 
−
}
 
−
.list_txt ul li{
 
−
list-style-image:none;
 
−
}
 
  
−
.reference p {
 
−
    font-size: 16px;
 
−
    margin-left: 30px;
 
−
    font-weight: 500;
 
−
    font-family: inherit;
 
−
}
 
 
</style>
 
</style>
 
<body id="homeIndexBody">
 
<body id="homeIndexBody">
  
−
<div id="RightSection"></div>
+
    <div id="RightSection"></div>
  
−
<div id="title">
+
    <div id="title">
  
−
<div id="firstTitle">
+
        <div id="firstTitle">
−
<p>
+
            <p>
−
<B>METHOD</B>
+
                <B>METHOD</B>
−
</p>
+
            </p>
−
</div>
+
        </div>
−
</div>
+
    </div>
  
−
<div id="RightContent">
+
    <div id="RightContent">
−
<div class="transparent_class ">
+
        <div class="transparent_class ">
−
<p class="blockWords">
+
            <p class="blockWords">
−
&nbsp;&nbsp;We present details on the various methods such as vectors design, domain linker selection and choose of enzyme insertion site that used in the experiment on this page, if you are willing to check or follow our work, you can scan the methods here. Any questions or advice to us are acceptable at any time.
+
                &nbsp;&nbsp;We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time.
−
</p>
+
            </p>
−
</div>
+
        </div>
  
−
<div id="RightContentText">
+
        <div id="RightContentText">
−
<div class="slide" id="slide2" data-slide="2" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;">
+
            <div class="slide" id="slide2" data-slide="2" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;">
−
<div class="container clearfix">
+
                <div class="container clearfix">
−
<div id="content">
+
                    <div id="content">
−
<div class="grid_8">
+
                        <div class="grid_8">
−
<p>
+
                            <p>
−
If you want to check or follow our project, you can read the METHOD page to get main information concerning our project. In addition, you will get more details about experiment from our protocols.
+
                                If you want to check or follow our project, you can read this page to get the main information concerning our project. In addition, you will get more details about experiment from our protocols.
−
<br>
+
                                <br>
−
<br></p>
+
                                <br></p>
−
<div class="array_foto">
+
                            <div class="array_foto">
−
<div class="client_foto">
+
                                <div class="client_foto">
−
<img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%"></div>
+
                                    <img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%">
−
<h3>Q1: How to get target gene?</h3>
+
                                    <p id="array_illustration"><strong>Figure 1.</strong>Gene and clusters mainly related to our project</p>
−
<p>
+
                                    </div>
−
Four operon related to magnetosome synthesis(mamAB/mamGFDC/mamXY/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify.
+
                                <h3>Q1: How to get target gene?</h3>
−
</p>
+
                                <p>Four operons related to magnetosome synthesis (<i>mamAB</i>/<i>mamGFDC</i>/<i>mamXY</i>/<i>mms6</i>) and <i>mamW</i>: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify(Figure 1).
−
<p>
+
                                </p>
−
Laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: BBa_K863005, BBa_E1010) and amplify them through common PCR.
+
                                <p>
−
</p>
+
                                    <i>laccase</i> gene and <i>RFP</i>: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: <a href="http://parts.igem.org/Part:BBa_K863005">BBa_K863005</a>, <a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and amplify them through common PCR.
−
</div>
+
                                </p>
−
<br>
+
                            </div>
−
<div class="clear"></div>
+
                            <br>
−
<h3>Q2: Where are the backbone vectors from?</h3>
+
                            <div class="clear"></div>
−
<p>
+
                            <h3>Q2: Where are the backbone vectors from?</h3>
−
All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aim to carry gene clusters that realize magnetosome generating and the last one is for putting together the genes of mamW + RFP + laccase.
+
                            <p>
−
</p>
+
                                All backbone vectors are purchased from Biotech Corp. They are pET-28a(Figure 2), pCDFDuet-1(Figure 3) and pACYCDuet-1(Figure 4), the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (<i>mamW</i> + <i>RFP</i> + <i>laccase</i>) together.
 +
                            </p>
  
−
<div class="project_pic">
+
                            <div class="project_pic">
−
<p id="pic_title"></p>
+
                                <p id="pic_title"></p>
−
<img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%">
+
                                <img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%">
−
<p id="pic_illustration"></p>
+
                                <p id="pic_illustration">
−
</div>
+
                                <strong>Figure 2.</strong> This vector backbone (pET-28a) will be inserted <i>mamAB</i></p>
−
<div class="project_pic">
+
                            </div>
−
<p id="pic_title"></p>
+
                            <div class="project_pic">
−
<img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%">
+
                                <p id="pic_title"></p>
−
<p id="pic_illustration"></p>
+
                                <img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%">
−
</div>
+
                                <p id="pic_illustration">
−
<div class="project_pic">
+
                                <strong>Figure 3.</strong> This vector backbone (pCDFDuet-1) will be inserted <i>mamGFDC</i>+<i>mms6</i>+<i>mamXY</i> and <i>mamGFDC</i>+<i>mms6</i></p>
−
<p id="pic_title"></p>
+
                            </div>
−
<img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%">
+
                            <div class="project_pic">
−
<p id="pic_illustration"></p>
+
                                <p id="pic_title"></p>
−
</div>
+
                                <img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%">
 +
                                <p id="pic_illustration">
 +
                                <strong>Figure 4.</strong> This vector backbone (pACYCDuet-1) will be inserted <i>mamW</i>+<i>RFP</i>+<i>laccase</i>, <i>RFP</i>+<i>laccase</i> and <i>mamW</i>+<i>laccase</i></p>
 +
                            </div>
  
−
<h3>
+
                            <h3>
−
Q3: What kinds of linker we chose for linking between our protein domains?
+
                                Q3: What kinds of linker we chose for linking between our protein domains?
−
</h3>
+
                            </h3>
−
<p>
+
                            <p>
−
We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers.
+
                                We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers(Figure 5).
−
</p>
+
                            </p>
−
<p>
+
                            <p>
−
•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
+
                                •ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
−
<br>
+
                                <br>
−
Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: BBa_K416001): between mamW, RFP and Laccase.
+
                                Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between <i>mamW</i>, <i>RFP</i> and <i>laccase</i>.
−
</p>
+
                            </p>
−
<p>
+
                            <p>
−
•gcaggtagcggcagcggtagcggtagcggcagcgcg
+
                                •gcaggtagcggcagcggtagcggtagcggcagcgcg
−
<br>
+
                                <br>
−
Refer to 6aa [GS]x linker(Name: BBa_J18921): between mamW and RFP.
+
                                Refer to 6aa [GS]x linker(Name: <a href="http://parts.igem.org/Part:BBa_J18921">BBa_J18921</a>): between <i>mamW</i> and <i>RFP</i>.
−
</p>
+
                            </p>
−
<div class="project_pic">
+
                            <div class="project_pic">
−
<p id="pic_title"></p>
+
                                <p id="pic_title"></p>
−
<img src="https://static.igem.org/mediawiki/2015/6/67/CHINA_CD_UESTC_METHOD06.png" width="60%">
+
                                <img src="https://static.igem.org/mediawiki/2015/6/67/CHINA_CD_UESTC_METHOD06.png" width="60%">
−
<p id="pic_illustration"></p>
+
                                <p id="pic_illustration"><strong>Figure 5.</strong>Three combinations of linking between various protein domains</p>
−
</div>
+
                            </div>
  
−
<h3>
+
                            <h3>
−
Q4: What kinds of enzymes we used when we made target gene insert into vectors?
+
                                Q4: What kinds of enzymes did we use when we made target gene insert into vectors?
−
</h3>
+
                            </h3>
−
<div class="surround_cont">
+
                            <div class="surround_cont">
−
<p>
+
                            <p>
−
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%">
+
                                <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%">
−
•pET28a: <br>For consideration of the longest operon size (17kb), we divided mamAB operon into three parts, we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to come true the insertion of mamAB.
+
                                •pET28a: <br>Considered  that it is the largest operon size (17kb), we divided <i>mamAB</i> operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of <i>mamAB</i> come true.
−
</p>
+
                            </p>
−
</div>
+
                        </div>
−
<div class="surround_cont">
+
                            <div class="surround_cont">
  
−
<p>
+
                            <p>
−
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%">
+
                                <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%">
−
•pCDFDuet-1: <br>The restriction enzyme cut sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamYXZ on either side are (XbaⅠ)and (PstⅠ)
+
                                •pCDFDuet-1: <br>The restriction sites flanking <i>mamGFDC</i>+<i>mms6</i> on either side are (HindⅢ) and (XhoⅠ), flanking <i>mamXY</i> on either side are (XbaⅠ)and (PstⅠ)
−
</p></div>
+
                            </p></div>
−
<div class="surround_cont">
+
                                                        <div class="surround_cont">
  
−
<p>
+
                            <p>
−
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%">
+
                                <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%">
−
•pACYCDuet-1: <br>The restriction enzyme cut sites flanking Laccase + mamW + RFP on either side are (PstⅠ) and (XhoⅠ).
+
                                •pACYCDuet-1: <br>The restriction sites flanking <i>mamW</i>+<i>RFP</i>+<i>laccase</i> on either side are (PstⅠ) and (XhoⅠ).
−
</p>
+
                            </p>
−
</div>
+
                        </div>
−
</div>
+
                        </div>
−
</div>
+
                    </div>
−
</div>
+
                </div>
−
</div>
+
            </div>
−
</div>
+
        </div>
−
</div>
+
    </div>
 
</body>
 
</body>
  
 
</html>
 
</html>

Latest revision as of 02:52, 18 September 2015

<!DOCTYPE html>

METHOD

  We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time.

If you want to check or follow our project, you can read this page to get the main information concerning our project. In addition, you will get more details about experiment from our protocols.

Figure 1.Gene and clusters mainly related to our project

Q1: How to get target gene?

Four operons related to magnetosome synthesis (mamAB/mamGFDC/mamXY/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify(Figure 1).

laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: BBa_K863005, BBa_E1010) and amplify them through common PCR.


Q2: Where are the backbone vectors from?

All backbone vectors are purchased from Biotech Corp. They are pET-28a(Figure 2), pCDFDuet-1(Figure 3) and pACYCDuet-1(Figure 4), the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (mamW + RFP + laccase) together.

Figure 2. This vector backbone (pET-28a) will be inserted mamAB

Figure 3. This vector backbone (pCDFDuet-1) will be inserted mamGFDC+mms6+mamXY and mamGFDC+mms6

Figure 4. This vector backbone (pACYCDuet-1) will be inserted mamW+RFP+laccase, RFP+laccase and mamW+laccase

Q3: What kinds of linker we chose for linking between our protein domains?

We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers(Figure 5).

•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: BBa_K416001): between mamW, RFP and laccase.

•gcaggtagcggcagcggtagcggtagcggcagcgcg
Refer to 6aa [GS]x linker(Name: BBa_J18921): between mamW and RFP.

Figure 5.Three combinations of linking between various protein domains

Q4: What kinds of enzymes did we use when we made target gene insert into vectors?

•pET28a:
Considered that it is the largest operon size (17kb), we divided mamAB operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of mamAB come true.

•pCDFDuet-1:
The restriction sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamXY on either side are (XbaⅠ)and (PstⅠ)

•pACYCDuet-1:
The restriction sites flanking mamW+RFP+laccase on either side are (PstⅠ) and (XhoⅠ).