Difference between revisions of "Team:CHINA CD UESTC/Method"
Qiuxingyang (Talk | contribs) |
|||
(28 intermediate revisions by 5 users not shown) | |||
Line 8: | Line 8: | ||
</head> | </head> | ||
− | + | <style type="text/css"> | |
/************************************************* | /************************************************* | ||
− | + | whole right section | |
***********************************************/ | ***********************************************/ | ||
#RightSection { | #RightSection { | ||
− | + | position: fixed; | |
− | + | left: 260px; | |
− | + | top: 0; | |
− | + | right: 0; | |
− | + | height:100%; | |
− | + | background:#F0F0F0; | |
− | + | background-image:url("https://static.igem.org/mediawiki/2015/8/8e/CHINA_CD_UESTC_PROJECTbg.jpg"); | |
− | + | overflow-y: scroll; | |
− | + | background-repeat: repeat; | |
− | + | background-size: 180px; | |
− | + | transition: all 200ms ease-out; | |
− | + | transform: translate3d(0, 0, 0); | |
− | + | z-index:1; | |
} | } | ||
.clear { | .clear { | ||
− | + | display: block; | |
− | + | height: 10px; | |
} | } | ||
.surround_cont { | .surround_cont { | ||
− | + | display: inline-block; | |
width: 100%; | width: 100%; | ||
} | } | ||
.surround_pic { | .surround_pic { | ||
− | + | float: right; | |
border: 10px ; | border: 10px ; | ||
+ | } | ||
+ | |||
+ | #array_illustration { | ||
+ | float: left; | ||
+ | margin-top: 100%; | ||
} | } | ||
Line 48: | Line 53: | ||
<body id="homeIndexBody"> | <body id="homeIndexBody"> | ||
− | + | <div id="RightSection"></div> | |
− | + | <div id="title"> | |
− | + | <div id="firstTitle"> | |
− | + | <p> | |
− | + | <B>METHOD</B> | |
− | + | </p> | |
− | + | </div> | |
− | + | </div> | |
− | + | <div id="RightContent"> | |
− | + | <div class="transparent_class "> | |
− | + | <p class="blockWords"> | |
− | + | We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time. | |
− | + | </p> | |
− | + | </div> | |
− | + | <div id="RightContentText"> | |
− | + | <div class="slide" id="slide2" data-slide="2" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;"> | |
− | + | <div class="container clearfix"> | |
− | + | <div id="content"> | |
− | + | <div class="grid_8"> | |
− | + | <p> | |
− | + | If you want to check or follow our project, you can read this page to get the main information concerning our project. In addition, you will get more details about experiment from our protocols. | |
− | + | <br> | |
− | + | <br></p> | |
− | + | <div class="array_foto"> | |
− | + | <div class="client_foto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%"> | |
− | + | <p id="array_illustration"><strong>Figure 1.</strong>Gene and clusters mainly related to our project</p> | |
− | + | </div> | |
− | + | <h3>Q1: How to get target gene?</h3> | |
− | + | <p>Four operons related to magnetosome synthesis (<i>mamAB</i>/<i>mamGFDC</i>/<i>mamXY</i>/<i>mms6</i>) and <i>mamW</i>: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify(Figure 1). | |
− | + | </p> | |
− | + | <p> | |
− | + | <i>laccase</i> gene and <i>RFP</i>: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: <a href="http://parts.igem.org/Part:BBa_K863005">BBa_K863005</a>, <a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and amplify them through common PCR. | |
− | + | </p> | |
− | + | </div> | |
− | + | <br> | |
− | + | <div class="clear"></div> | |
− | + | <h3>Q2: Where are the backbone vectors from?</h3> | |
− | + | <p> | |
+ | All backbone vectors are purchased from Biotech Corp. They are pET-28a(Figure 2), pCDFDuet-1(Figure 3) and pACYCDuet-1(Figure 4), the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (<i>mamW</i> + <i>RFP</i> + <i>laccase</i>) together. | ||
+ | </p> | ||
− | + | <div class="project_pic"> | |
− | + | <p id="pic_title"></p> | |
− | + | <img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%"> | |
− | + | <p id="pic_illustration"> | |
− | + | <strong>Figure 2.</strong> This vector backbone (pET-28a) will be inserted <i>mamAB</i></p> | |
− | + | </div> | |
− | + | <div class="project_pic"> | |
− | + | <p id="pic_title"></p> | |
− | + | <img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%"> | |
− | + | <p id="pic_illustration"> | |
− | + | <strong>Figure 3.</strong> This vector backbone (pCDFDuet-1) will be inserted <i>mamGFDC</i>+<i>mms6</i>+<i>mamXY</i> and <i>mamGFDC</i>+<i>mms6</i></p> | |
− | + | </div> | |
− | + | <div class="project_pic"> | |
− | + | <p id="pic_title"></p> | |
− | + | <img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%"> | |
+ | <p id="pic_illustration"> | ||
+ | <strong>Figure 4.</strong> This vector backbone (pACYCDuet-1) will be inserted <i>mamW</i>+<i>RFP</i>+<i>laccase</i>, <i>RFP</i>+<i>laccase</i> and <i>mamW</i>+<i>laccase</i></p> | ||
+ | </div> | ||
− | + | <h3> | |
− | + | Q3: What kinds of linker we chose for linking between our protein domains? | |
− | + | </h3> | |
− | + | <p> | |
− | + | We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers(Figure 5). | |
− | + | </p> | |
− | + | <p> | |
− | + | •ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg | |
− | + | <br> | |
− | + | Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between <i>mamW</i>, <i>RFP</i> and <i>laccase</i>. | |
− | + | </p> | |
− | + | <p> | |
− | + | •gcaggtagcggcagcggtagcggtagcggcagcgcg | |
− | + | <br> | |
− | + | Refer to 6aa [GS]x linker(Name: <a href="http://parts.igem.org/Part:BBa_J18921">BBa_J18921</a>): between <i>mamW</i> and <i>RFP</i>. | |
− | + | </p> | |
− | + | <div class="project_pic"> | |
− | + | <p id="pic_title"></p> | |
− | + | <img src="https://static.igem.org/mediawiki/2015/6/67/CHINA_CD_UESTC_METHOD06.png" width="60%"> | |
− | + | <p id="pic_illustration"><strong>Figure 5.</strong>Three combinations of linking between various protein domains</p> | |
− | + | </div> | |
− | + | <h3> | |
− | + | Q4: What kinds of enzymes did we use when we made target gene insert into vectors? | |
− | + | </h3> | |
− | + | <div class="surround_cont"> | |
− | + | <p> | |
− | + | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%"> | |
− | + | •pET28a: <br>Considered that it is the largest operon size (17kb), we divided <i>mamAB</i> operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of <i>mamAB</i> come true. | |
− | + | </p> | |
− | + | </div> | |
− | + | <div class="surround_cont"> | |
− | + | <p> | |
− | + | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%"> | |
− | + | •pCDFDuet-1: <br>The restriction sites flanking <i>mamGFDC</i>+<i>mms6</i> on either side are (HindⅢ) and (XhoⅠ), flanking <i>mamXY</i> on either side are (XbaⅠ)and (PstⅠ) | |
− | + | </p></div> | |
− | + | <div class="surround_cont"> | |
− | + | <p> | |
− | + | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%"> | |
− | + | •pACYCDuet-1: <br>The restriction sites flanking <i>mamW</i>+<i>RFP</i>+<i>laccase</i> on either side are (PstⅠ) and (XhoⅠ). | |
− | + | </p> | |
− | + | </div> | |
− | + | </div> | |
− | + | </div> | |
− | + | </div> | |
− | + | </div> | |
− | + | </div> | |
− | + | </div> | |
</body> | </body> | ||
</html> | </html> |
Latest revision as of 02:52, 18 September 2015
<!DOCTYPE html>
METHOD
We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time.