Difference between revisions of "Team:CHINA CD UESTC/Method"
Qiuxingyang (Talk | contribs) |
|||
(22 intermediate revisions by 4 users not shown) | |||
Line 41: | Line 41: | ||
float: right; | float: right; | ||
border: 10px ; | border: 10px ; | ||
+ | } | ||
+ | |||
+ | #array_illustration { | ||
+ | float: left; | ||
+ | margin-top: 100%; | ||
} | } | ||
Line 62: | Line 67: | ||
<div class="transparent_class "> | <div class="transparent_class "> | ||
<p class="blockWords"> | <p class="blockWords"> | ||
− | We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page | + | We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time. |
</p> | </p> | ||
</div> | </div> | ||
Line 72: | Line 77: | ||
<div class="grid_8"> | <div class="grid_8"> | ||
<p> | <p> | ||
− | If you want to check or follow our project, you can read | + | If you want to check or follow our project, you can read this page to get the main information concerning our project. In addition, you will get more details about experiment from our protocols. |
<br> | <br> | ||
<br></p> | <br></p> | ||
<div class="array_foto"> | <div class="array_foto"> | ||
<div class="client_foto"> | <div class="client_foto"> | ||
− | <img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%"></div> | + | <img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%"> |
+ | <p id="array_illustration"><strong>Figure 1.</strong>Gene and clusters mainly related to our project</p> | ||
+ | </div> | ||
<h3>Q1: How to get target gene?</h3> | <h3>Q1: How to get target gene?</h3> | ||
− | <p>Four operons related to magnetosome synthesis (mamAB/mamGFDC/mamXY/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify. | + | <p>Four operons related to magnetosome synthesis (<i>mamAB</i>/<i>mamGFDC</i>/<i>mamXY</i>/<i>mms6</i>) and <i>mamW</i>: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify(Figure 1). |
</p> | </p> | ||
<p> | <p> | ||
− | + | <i>laccase</i> gene and <i>RFP</i>: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: <a href="http://parts.igem.org/Part:BBa_K863005">BBa_K863005</a>, <a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and amplify them through common PCR. | |
</p> | </p> | ||
</div> | </div> | ||
Line 89: | Line 96: | ||
<h3>Q2: Where are the backbone vectors from?</h3> | <h3>Q2: Where are the backbone vectors from?</h3> | ||
<p> | <p> | ||
− | All backbone vectors are purchased from Biotech Corp. They are | + | All backbone vectors are purchased from Biotech Corp. They are pET-28a(Figure 2), pCDFDuet-1(Figure 3) and pACYCDuet-1(Figure 4), the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (<i>mamW</i> + <i>RFP</i> + <i>laccase</i>) together. |
</p> | </p> | ||
Line 96: | Line 103: | ||
<img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%"> | <img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%"> | ||
<p id="pic_illustration"> | <p id="pic_illustration"> | ||
− | <strong>Figure | + | <strong>Figure 2.</strong> This vector backbone (pET-28a) will be inserted <i>mamAB</i></p> |
</div> | </div> | ||
<div class="project_pic"> | <div class="project_pic"> | ||
Line 102: | Line 109: | ||
<img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%"> | <img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%"> | ||
<p id="pic_illustration"> | <p id="pic_illustration"> | ||
− | <strong>Figure | + | <strong>Figure 3.</strong> This vector backbone (pCDFDuet-1) will be inserted <i>mamGFDC</i>+<i>mms6</i>+<i>mamXY</i> and <i>mamGFDC</i>+<i>mms6</i></p> |
</div> | </div> | ||
<div class="project_pic"> | <div class="project_pic"> | ||
Line 108: | Line 115: | ||
<img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%"> | <img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%"> | ||
<p id="pic_illustration"> | <p id="pic_illustration"> | ||
− | <strong>Figure | + | <strong>Figure 4.</strong> This vector backbone (pACYCDuet-1) will be inserted <i>mamW</i>+<i>RFP</i>+<i>laccase</i>, <i>RFP</i>+<i>laccase</i> and <i>mamW</i>+<i>laccase</i></p> |
</div> | </div> | ||
Line 115: | Line 122: | ||
</h3> | </h3> | ||
<p> | <p> | ||
− | We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers. | + | We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers(Figure 5). |
</p> | </p> | ||
<p> | <p> | ||
•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg | •ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg | ||
<br> | <br> | ||
− | Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between mamW, RFP and | + | Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between <i>mamW</i>, <i>RFP</i> and <i>laccase</i>. |
</p> | </p> | ||
<p> | <p> | ||
•gcaggtagcggcagcggtagcggtagcggcagcgcg | •gcaggtagcggcagcggtagcggtagcggcagcgcg | ||
<br> | <br> | ||
− | Refer to 6aa [GS]x linker(Name: <a href="http://parts.igem.org/Part:BBa_J18921">BBa_J18921</a>): between mamW and RFP. | + | Refer to 6aa [GS]x linker(Name: <a href="http://parts.igem.org/Part:BBa_J18921">BBa_J18921</a>): between <i>mamW</i> and <i>RFP</i>. |
</p> | </p> | ||
<div class="project_pic"> | <div class="project_pic"> | ||
<p id="pic_title"></p> | <p id="pic_title"></p> | ||
<img src="https://static.igem.org/mediawiki/2015/6/67/CHINA_CD_UESTC_METHOD06.png" width="60%"> | <img src="https://static.igem.org/mediawiki/2015/6/67/CHINA_CD_UESTC_METHOD06.png" width="60%"> | ||
− | <p id="pic_illustration"></p> | + | <p id="pic_illustration"><strong>Figure 5.</strong>Three combinations of linking between various protein domains</p> |
</div> | </div> | ||
Line 139: | Line 146: | ||
<p> | <p> | ||
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%"> | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%"> | ||
− | •pET28a: <br>Considered that it is the largest operon size (17kb), we divided mamAB operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of mamAB come true. | + | •pET28a: <br>Considered that it is the largest operon size (17kb), we divided <i>mamAB</i> operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of <i>mamAB</i> come true. |
</p> | </p> | ||
</div> | </div> | ||
Line 146: | Line 153: | ||
<p> | <p> | ||
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%"> | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%"> | ||
− | •pCDFDuet-1: <br>The restriction sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamXY on either side are (XbaⅠ)and (PstⅠ) | + | •pCDFDuet-1: <br>The restriction sites flanking <i>mamGFDC</i>+<i>mms6</i> on either side are (HindⅢ) and (XhoⅠ), flanking <i>mamXY</i> on either side are (XbaⅠ)and (PstⅠ) |
</p></div> | </p></div> | ||
<div class="surround_cont"> | <div class="surround_cont"> | ||
Line 152: | Line 159: | ||
<p> | <p> | ||
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%"> | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%"> | ||
− | •pACYCDuet-1: <br>The restriction sites flanking | + | •pACYCDuet-1: <br>The restriction sites flanking <i>mamW</i>+<i>RFP</i>+<i>laccase</i> on either side are (PstⅠ) and (XhoⅠ). |
</p> | </p> | ||
</div> | </div> |
Latest revision as of 02:52, 18 September 2015
<!DOCTYPE html>
METHOD
We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. Any questions or advice are welcomed at any time.