Difference between revisions of "Team:UAM Poznan/Parts"

(Prototype team page)
 
Line 1: Line 1:
−
{{UAM_Poznan}}
+
<DOCTYPE! html>
 
<html>
 
<html>
 +
<head>
 +
<style>
 +
<style>
  
−
<h2> Part Documentation</h2>
+
body {
 +
/* Permalink - use to edit and share this gradient: http://colorzilla.com/gradient-editor/#f9fcf7+89,ffffff+89,d5d4d8+100 */
 +
background: rgb(249,252,247); /* Old browsers */
 +
background: -moz-linear-gradient(top,  rgba(249,252,247,1) 89%, rgba(255,255,255,1) 89%, rgba(213,212,216,1) 100%); /* FF3.6+ */
 +
background: -webkit-gradient(linear, left top, left bottom, color-stop(89%,rgba(249,252,247,1)), color-stop(89%,rgba(255,255,255,1)), color-stop(100%,rgba(213,212,216,1))); /* Chrome,Safari4+ */
 +
background: -webkit-linear-gradient(top,  rgba(249,252,247,1) 89%,rgba(255,255,255,1) 89%,rgba(213,212,216,1) 100%); /* Chrome10+,Safari5.1+ */
 +
background: -o-linear-gradient(top,  rgba(249,252,247,1) 89%,rgba(255,255,255,1) 89%,rgba(213,212,216,1) 100%); /* Opera 11.10+ */
 +
background: -ms-linear-gradient(top,  rgba(249,252,247,1) 89%,rgba(255,255,255,1) 89%,rgba(213,212,216,1) 100%); /* IE10+ */
 +
background: linear-gradient(to bottom,  rgba(249,252,247,1) 89%,rgba(255,255,255,1) 89%,rgba(213,212,216,1) 100%); /* W3C */
 +
filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#f9fcf7', endColorstr='#d5d4d8',GradientType=0 ); /* IE6-9 */
 +
background-attachment: fixed;
 +
}
  
−
<p>Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The <code>&lt;groupparts&gt;</code> tag (see below) will generate a table with all of the parts that your team adds to your team sandbox.</p>
+
h2 {  text-decoration: underline;
−
<p>Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without needing to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.</p>
+
  text-align: center;
 +
  text-transform: uppercase;
 +
  letter-spacing: 1px;
 +
  line-height: 150%;
 +
  font-family: "Fairview Regular";
 +
  color: ;
 +
}
  
 +
h4 {background-color: ;
 +
  text-align: center;
 +
  text-transform: uppercase;
 +
  letter-spacing: 1px;
 +
  line-height: 150%;
 +
  font-family: "Fairview Regular";
 +
  color: ;
 +
}
  
−
<div class="highlightBox">
+
p {
−
<h4>Note</h4>
+
  text-indent: 50px;
−
<p>Note that parts must be documented on the <a href="http://parts.igem.org/Main_Page"> Registry</a>. This page serves to <i>showcase</i> the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.</p>
+
  word-spacing: 3px;
−
</div>
+
  line-height: 200%; 
 +
}
  
  
 +
a:link {
 +
  text-decoration: none;
 +
  font-weight: bold;
 +
  color:
 +
}
  
−
<h4>Adding parts to the registry</h4>
 
−
<p>You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry">Add a Part to the Registry</a> link.</p>
 
−
<p>We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you <b>do</b> need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)</p>
 
  
 +
a:visited {
 +
  text-decoration: none;
 +
  font-weight: bold;
 +
  color:
 +
}
  
−
<h4>What information do I need to start putting my parts on the Registry?</h4>
+
a:hover {
−
<p>The information needed to initially create a part on the Registry is:</p>
+
  text-decoration: underline;
−
<ul>
+
  font-weight: bold;
−
<li>Part Name</li>
+
  color:
−
<li>Part type</li>
+
}
−
<li>Creator</li>
+
−
<li>Sequence</li>
+
−
<li>Short Description (60 characters on what the DNA does)</li>
+
−
<li>Long Description (Longer description of what the DNA does)</li>
+
−
<li>Design considerations</li>
+
−
</ul>
+
  
−
<p>
+
/* ============================================================
−
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. </p>
+
  TILE NAVIGATION
 +
============================================================ */
 +
/* nav styles */
 +
nav.cmn-tile-nav {
 +
  display: none;
 +
}
 +
nav.cmn-tile-nav.open {
 +
  display: block;
 +
}
 +
nav.cmn-tile-nav ul {
 +
  list-style: none;
 +
}
 +
nav.cmn-tile-nav li {
 +
  display: block;
 +
  overflow: hidden;
 +
  font-family: "Oswald", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif;
 +
  text-shadow: -1px 1px rgba(0, 0, 0, 0.3);
 +
  -webkit-transition: background 0.3s;
 +
  -moz-transition: background 0.3s;
 +
  -o-transition: background 0.3s;
 +
  transition: background 0.3s;
 +
}
 +
nav.cmn-tile-nav a {
 +
  display: block;
 +
  padding: 20px;
 +
  color: #fff;
 +
  -webkit-transition: background 0.3s, -webkit-transform 0.3s;
 +
  -moz-transition: background 0.3s, -moz-transform 0.3s;
 +
  -o-transition: background 0.3s, -o-transform 0.3s;
 +
  transition: background 0.3s, transform 0.3s;
 +
}
 +
nav.cmn-tile-nav a:hover {
 +
  -webkit-transform: translateX(20px);
 +
  -moz-transform: translateX(20px);
 +
  -ms-transform: translateX(20px);
 +
  -o-transform: translateX(20px);
 +
  transform: translateX(20px);
 +
}
 +
nav.cmn-tile-nav li.colour-1 {
 +
  background-color: #28aadc;
 +
}
 +
nav.cmn-tile-nav li.colour-1 a {
 +
  background-color: #28aadc;
 +
}
 +
nav.cmn-tile-nav li.colour-1:hover, nav.cmn-tile-nav li.colour-1:hover a {
 +
  background-color: #166888;
 +
}
 +
nav.cmn-tile-nav li.colour-2 {
 +
  background-color: #0a8cbe;
 +
}
 +
nav.cmn-tile-nav li.colour-2 a {
 +
  background-color: #0a8cbe;
 +
}
 +
nav.cmn-tile-nav li.colour-2:hover, nav.cmn-tile-nav li.colour-2:hover a {
 +
  background-color: #05455d;
 +
}
 +
nav.cmn-tile-nav li.colour-3 {
 +
  background-color: #006ea0;
 +
}
 +
nav.cmn-tile-nav li.colour-3 a {
 +
  background-color: #006ea0;
 +
}
 +
nav.cmn-tile-nav li.colour-3:hover, nav.cmn-tile-nav li.colour-3:hover a {
 +
  background-color: #00283a;
 +
}
 +
nav.cmn-tile-nav li.colour-4 {
 +
  background-color: #006478;
 +
}
 +
nav.cmn-tile-nav li.colour-4 a {
 +
  background-color: #006478;
 +
}
 +
nav.cmn-tile-nav li.colour-4:hover, nav.cmn-tile-nav li.colour-4:hover a {
 +
  background-color: #000f12;
 +
}
 +
nav.cmn-tile-nav li.colour-5 {
 +
  background-color: #005a5a;
 +
}
 +
nav.cmn-tile-nav li.colour-5 a {
 +
  background-color: #005a5a;
 +
}
 +
nav.cmn-tile-nav li.colour-5:hover, nav.cmn-tile-nav li.colour-5:hover a {
 +
  background-color: black;
 +
}
 +
nav.cmn-tile-nav li.colour-6 {
 +
  background-color: #007864;
 +
}
 +
nav.cmn-tile-nav li.colour-6 a {
 +
  background-color: #007864;
 +
}
 +
nav.cmn-tile-nav li.colour-6:hover, nav.cmn-tile-nav li.colour-6:hover a {
 +
  background-color: #00120f;
 +
}
 +
nav.cmn-tile-nav li.colour-7 {
 +
  background-color: #0aa06e;
 +
}
 +
nav.cmn-tile-nav li.colour-7 a {
 +
  background-color: #0aa06e;
 +
}
 +
nav.cmn-tile-nav li.colour-7:hover, nav.cmn-tile-nav li.colour-7:hover a {
 +
  background-color: #04402c;
 +
}
 +
nav.cmn-tile-nav li.colour-8 {
 +
  background-color: #0abe8c;
 +
}
 +
nav.cmn-tile-nav li.colour-8 a {
 +
  background-color: #0abe8c;
 +
}
 +
nav.cmn-tile-nav li.colour-8:hover, nav.cmn-tile-nav li.colour-8:hover a {
 +
  background-color: #055d45;
 +
}
  
 +
/* smoother transitions */
 +
nav.cmn-tile-nav li,
 +
nav.cmn-tile-nav a {
 +
  -webkit-transform: translate3d(0, 0, 0);
 +
  -moz-transform: translate3d(0, 0, 0);
 +
  -ms-transform: translate3d(0, 0, 0);
 +
  -o-transform: translate3d(0, 0, 0);
 +
  transform: translate3d(0, 0, 0);
 +
}
  
 +
/* media queries */
 +
@media all and (min-width: 480px) {
 +
  nav.cmn-tile-nav {
 +
    display: block;
 +
  }
 +
  nav.cmn-tile-nav li {
 +
    width: 50%;
 +
    float: left;
 +
  }
 +
}
 +
@media all and (min-width: 768px) {
 +
  nav.cmn-tile-nav li {
 +
    width: 25%;
 +
  }
 +
  nav.cmn-tile-nav a {
 +
    text-align: center;
 +
    padding: 60px 20px 20px 20px;
 +
  }
 +
  nav.cmn-tile-nav a:hover {
 +
    -webkit-transform: translateX(0);
 +
    -moz-transform: translateX(0);
 +
    -ms-transform: translateX(0);
 +
    -o-transform: translateX(0);
 +
    transform: translateX(0);
 +
    -webkit-transform: translateY(-20px);
 +
    -moz-transform: translateY(-20px);
 +
    -ms-transform: translateY(-20px);
 +
    -o-transform: translateY(-20px);
 +
    transform: translateY(-20px);
 +
  }
 +
}
 +
@media all and (min-width: 1024px) {
 +
  nav.cmn-tile-nav li {
 +
    overflow: visible;
 +
    width: 20%;
 +
  }
 +
  nav.cmn-tile-nav a {
 +
    padding: 80px 20px 20px 20px;
 +
  }
 +
  nav.cmn-tile-nav a:hover {
 +
    -webkit-transform: translateY(20px);
 +
    -moz-transform: translateY(20px);
 +
    -ms-transform: translateY(20px);
 +
    -o-transform: translateY(20px);
 +
    transform: translateY(20px);
 +
  }
 +
}
 +
/* ============================================================
 +
  NAVIGATION TOGGLE
 +
============================================================ */
 +
a.nav-toggle {
 +
  display: block;
 +
  margin-bottom: 20px;
 +
  padding: 20px;
 +
  background-color: #dce6f0;
 +
  color: #646464;
 +
  font-family: "Oswald", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif;
 +
  text-align: center;
 +
}
 +
a.nav-toggle:hover {
 +
  background-color: #c8d2dc;
 +
}
  
 +
@media all and (min-width: 480px) {
 +
  a.nav-toggle {
 +
    display: none;
 +
  }
 +
}
  
  
 +
/* ============================================================
 +
  OTHER SIMPLE STYLES
 +
============================================================ */
 +
.container.content {
 +
  padding: 40px;
 +
}
 +
.container.content h2 {
 +
  margin-bottom: 20px;
 +
  color: #282828;
 +
  font-family: "Oswald", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif;
 +
  font-size: 30px;
 +
}
  
−
<h4>Inspiration</h4>
+
/*img styles */
−
<p>We have a created  a <a href="http://parts.igem.org/Well_Documented_Parts">collection of well documented parts</a> that can help you get started.</p>
+
.notebook {width: 250px;
 +
height:250px;
 +
display: block;
 +
margin-right: auto;
 +
margin-left: auto;
 +
padding: 1em;}
  
−
<p> You can also take a look at how other teams have documented their parts in their wiki:</p>
+
</style>
−
<ul>
+
</style>
−
<li><a href="https://2014.igem.org/Team:MIT/Parts"> 2014 MIT </a></li>
+
−
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts"> 2014 Heidelberg</a></li>
+
−
<li><a href="https://2014.igem.org/Team:Tokyo_Tech/Parts">2014 Tokyo Tech</a></li>
+
−
</ul>
+
  
 +
</head>
  
 +
<body>
 +
<a href="#" class="nav-toggle">Toggle Navigation</a>
 +
<nav class="cmn-tile-nav">
 +
  <ul class="clearfix">
 +
    <li class="colour-1"><a href="#">Arabinose <br>induced <br>promoters</a></li>
 +
    <li class="colour-2"><a href="#">Melibiose <br>induced <br>promoters</a></li>
 +
    <li class="colour-3"><a href="#">Rhamnose <br>induced <br>promoters</a></li>
 +
    <li class="colour-4"><a href="#">Xylose <br>induced <br>promoters</a></li>
 +
    <li class="colour-5"><a href="#">Other <br>tested <br>promoters</a></li>
 +
   
 +
  </ul>
 +
</nav>
 +
 +
 +
<p>All promoter fragments derive from Escherichia coli K12, strain DH5 alpha, some elements are synthetic. Chromosomal DNA of E. coli was isolated as described in the methods section.</p>
 +
 +
<h2>Arabinose induced promoters</h2>
 +
<h4>sfGFP under arabinose promoter s1 without AraC (Arashort1) - BBa_K1741000</h4>
 +
<p>In commercially available expression vectors arabinose promoter araBAD is usually used together with a gene for AraC transcription activator / repressor to make the system independent of chromosomal copy of AraC gene. We fused  the araBAD promoter without AraC reading frame, as other sugar induced promoters to sfGFP. The shorter version of the popular promoter is still functional i.e. induced by arabinose. Arabinose induced (0,4%) in a a short time (1-8h) expression is a bit lower than driven by AraC-araBAD but after a longer time like 18h the GFP level is higher than from AraC-araBAD promoter. New shorter versions of arabinose induced promoters, all originating from E. coli genome were compared to the biobrick <a href="http://parts.igem.org/Part:BBa_K1481002" target="_blank">BBa_K1481002</a>, provided last year by Poznan_Bioinf team.<br>The sequence of this promoter starts from O2 region the left part of the binding site of AraC in absence of arabinose.  </p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741000" target="_blank">BBa_K1741000.</a></p>
 +
 +
<h4>sfGFP under a short arabinose promoter s2 without O1 and O2 - BBa_K1741002</h4>
 +
<p>This shortened version of araBAD promoter does not contain O1 and O2 regions, but still contains the CRP binding site. We can expect than  this version of araBAD will be still repressed by CRP but not by AraC without arabinose. From our preliminary experiments it appears that the promoter is more strongly induced by arabinose than AraC-AraBAD but is weaker than arashort1. All three arabinose pomoters are repressed by glucose. </p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741002" target="_blank">BBa_K1741002.</a></p>
 +
 +
<h2>Melibiose induced promoters</h2>
 +
<h4>sfGFP under melibiose promoter - BBa_K1741003</h4>
 +
<p>MelR chromosomal copy of MelR is sufficient to activate the melibiose melAB promoter copied from E. coli K12 chromosome when melibiose is added to M9 minimal medium or to a rich medium 2xLB (0,4%). In both media induction is much weaker than of arabinose or rhamnose induced promoters. </p>
 +
<img class="notebook" src="https://static.igem.org/mediawiki/2015/8/88/UAMPOZNANhairpin.png">
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741003" target="_blank">BBa_K1741003.</a></p>
 +
 +
 +
<h4>sfGFP under melibiose promoter, with improved 5&#39;UTR - BBa_K1741004</h4>
 +
<p>Twice higher expression has been obtained by 5’UTR editing – removal of potential secondary structure which involved RBS and a better positioning of RBS - 7 nt upstream AUG start codon. The modified 5’UTR  results in about twice higher expression upon melibiose addition to the M9 or 2xLB medium. The promer is still weaker than araBAD or rhaBAD, so can be a promoter of choice if lower expression level is necessary for efficient folding or secretion of a recombinant protein. </p>
 +
<img class="notebook" src="https://static.igem.org/mediawiki/2015/5/57/UAMPOZNANhairpinremoved.png">
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741004" target="_blank">BBa_K1741004.</a></p>
 +
 +
 +
<h2>Rhamnose induced promoters</h2>
 +
 +
<h4>sfGFP under rhamnose promoter with removed EcoRI site - BBa_K1741005</h4>
 +
<p>rhaBAD promoter has been copied from E. coli genome: ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgc<mark>gaattc</mark>aggcgctttttagactggtcgtaatgaaattcagcaggatcacatt,<br>
 +
then Eco RI site was removed by PCR to obtain Rha1 in a biobrick standard:
 +
ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgc<mark>gaattt</mark>aggcgctttttagactggtcgtaatgaaattcagcaggatcacatt.<br>
 +
The only one point mutation makes the promoter slightly stronger and more sensitive to rhamnose.
 +
</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741005" target="_blank">BBa_K1741005.</a></p>
 +
 +
<h4>sfGFP under short rhamnose promoter (very weak) - BBa_K1741006</h4>
 +
<p>From rhaBAD1 promoter we removed both CRP binding sites. It seems likely thatt RhaS binding site has been also affected, so however the resulting promoter is still induced by rhamnose, the induction is very weak.</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741006" target="_blank">BBa_K1741006.</a></p>
 +
 +
<h2>Xylose induced promoters</h2>
 +
<h4>sfGFP under xylose promoter xylA (xylWT) - BBa_K1741007</h4>
 +
<p>SfGFP under xylose promoter xylA (wild type).</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741007" target="_blank">BBa_K1741007.</a></p>
 +
 +
<h4>sfGFP under xylose promoter xylA1 with improved 5&#39;UTR - BBa_K1741008</h4>
 +
<p>Xylose induced promoter xylA is weaker than arabinose and  rhamnose promoters. To enhance the efficiency of xylA driven transcription/translation we have transplanted 5&#39;UTR from the strong constitutive promoter proD. In some experiments it seems to be slightly stronger than original xylA promoter from part BBa_K1741007.</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741008" target="_blank">BBa_K1741008.</a></p>
 +
 +
<h4>sfGFP under shortened xylose promoter xylA1 with improved 5&#39;UTR BBa_K1741009</h4>
 +
<p>Short version of xylA promoter with known functional elements is stronger than two other versions. </p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741009" target="_blank">BBa_K1741009.</a></p>
 +
 +
<h4>sfGFP under xylose promoter xylF (very weak) - BBa_K1741010</h4>
 +
<p>We also tested the xylF promoter from the same double sided regulatory element, and xylF appears to be a very weak promoter slightly induced by xylose.</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741010" target="_blank">BBa_K1741010.</a></p>
 +
 +
<h2>Other promoters</h2>
 +
<h4>sfGFP under T7 promoter - BBa_K1741011</h4>
 +
<p>This part imitates the most popular IPTG/lactose dependent T7 driven expression systems. To express sfGFP or another sequence with which one can substitute sfGFP ORF using Gibson or CPEC assembly, host strain of choice expressing T7 RNA polymerase is necessary, not only DE3.</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741011" target="_blank">BBa_K1741011.</a></p>
 +
 +
<h4>sfGFP under proC promoter - BBa_K1741012</h4>
 +
<p>proC - moderately strong constitutive promoter seems to reflect growth rate of E. coli bacterial strains  on different media, and potentially can be a measure of protein biosynthesis rate, to be determined in future. Expression is higher than of inducible promoters.</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741012" target="_blank">BBa_K1741012.</a></p>
 +
 +
<h4>sfGFP under proC promoter with a hairpin in 5&#39;UTR BBa_K1741013</h4>
 +
<p>A weak hairpin introduced to 5’UTR slightly lowers transcription/translation. Will be extended to a thermometer, actually we see no temp. dependence.</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741013" target="_blank">BBa_K1741013.</a></p>
 +
 +
<h4>sfGFP under proD promoter - BBa_K1741014</h4>
 +
<p>A strong insulated constitutive promoter proD is stronger than proC. Expression profiles of proC and proD are similar on different media = both seem to be really constitutive and the expression level does depend  on E. coli growth rate.</p>
 +
<p>You can find this part&#39;s sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741014" target="_blank">BBa_K1741014.</a></p>
  
−
<h4>Part Table </h4>
 
−
</html>
 
−
<groupparts>iGEM015 Example</groupparts>
 
−
<html>
 
  
  
 +
</body>
  
−
</div>
 
 
</html>
 
</html>

Revision as of 12:33, 18 September 2015

<DOCTYPE! html> Toggle Navigation

All promoter fragments derive from Escherichia coli K12, strain DH5 alpha, some elements are synthetic. Chromosomal DNA of E. coli was isolated as described in the methods section.

Arabinose induced promoters

sfGFP under arabinose promoter s1 without AraC (Arashort1) - BBa_K1741000

In commercially available expression vectors arabinose promoter araBAD is usually used together with a gene for AraC transcription activator / repressor to make the system independent of chromosomal copy of AraC gene. We fused the araBAD promoter without AraC reading frame, as other sugar induced promoters to sfGFP. The shorter version of the popular promoter is still functional i.e. induced by arabinose. Arabinose induced (0,4%) in a a short time (1-8h) expression is a bit lower than driven by AraC-araBAD but after a longer time like 18h the GFP level is higher than from AraC-araBAD promoter. New shorter versions of arabinose induced promoters, all originating from E. coli genome were compared to the biobrick BBa_K1481002, provided last year by Poznan_Bioinf team.
The sequence of this promoter starts from O2 region the left part of the binding site of AraC in absence of arabinose.

You can find this part's sequence with more information in registry: BBa_K1741000.

sfGFP under a short arabinose promoter s2 without O1 and O2 - BBa_K1741002

This shortened version of araBAD promoter does not contain O1 and O2 regions, but still contains the CRP binding site. We can expect than this version of araBAD will be still repressed by CRP but not by AraC without arabinose. From our preliminary experiments it appears that the promoter is more strongly induced by arabinose than AraC-AraBAD but is weaker than arashort1. All three arabinose pomoters are repressed by glucose.

You can find this part's sequence with more information in registry: BBa_K1741002.

Melibiose induced promoters

sfGFP under melibiose promoter - BBa_K1741003

MelR chromosomal copy of MelR is sufficient to activate the melibiose melAB promoter copied from E. coli K12 chromosome when melibiose is added to M9 minimal medium or to a rich medium 2xLB (0,4%). In both media induction is much weaker than of arabinose or rhamnose induced promoters.

You can find this part's sequence with more information in registry: BBa_K1741003.

sfGFP under melibiose promoter, with improved 5'UTR - BBa_K1741004

Twice higher expression has been obtained by 5’UTR editing – removal of potential secondary structure which involved RBS and a better positioning of RBS - 7 nt upstream AUG start codon. The modified 5’UTR results in about twice higher expression upon melibiose addition to the M9 or 2xLB medium. The promer is still weaker than araBAD or rhaBAD, so can be a promoter of choice if lower expression level is necessary for efficient folding or secretion of a recombinant protein.

You can find this part's sequence with more information in registry: BBa_K1741004.

Rhamnose induced promoters

sfGFP under rhamnose promoter with removed EcoRI site - BBa_K1741005

rhaBAD promoter has been copied from E. coli genome: ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgaattcaggcgctttttagactggtcgtaatgaaattcagcaggatcacatt,
then Eco RI site was removed by PCR to obtain Rha1 in a biobrick standard: ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgaatttaggcgctttttagactggtcgtaatgaaattcagcaggatcacatt.
The only one point mutation makes the promoter slightly stronger and more sensitive to rhamnose.

You can find this part's sequence with more information in registry: BBa_K1741005.

sfGFP under short rhamnose promoter (very weak) - BBa_K1741006

From rhaBAD1 promoter we removed both CRP binding sites. It seems likely thatt RhaS binding site has been also affected, so however the resulting promoter is still induced by rhamnose, the induction is very weak.

You can find this part's sequence with more information in registry: BBa_K1741006.

Xylose induced promoters

sfGFP under xylose promoter xylA (xylWT) - BBa_K1741007

SfGFP under xylose promoter xylA (wild type).

You can find this part's sequence with more information in registry: BBa_K1741007.

sfGFP under xylose promoter xylA1 with improved 5'UTR - BBa_K1741008

Xylose induced promoter xylA is weaker than arabinose and rhamnose promoters. To enhance the efficiency of xylA driven transcription/translation we have transplanted 5'UTR from the strong constitutive promoter proD. In some experiments it seems to be slightly stronger than original xylA promoter from part BBa_K1741007.

You can find this part's sequence with more information in registry: BBa_K1741008.

sfGFP under shortened xylose promoter xylA1 with improved 5'UTR BBa_K1741009

Short version of xylA promoter with known functional elements is stronger than two other versions.

You can find this part's sequence with more information in registry: BBa_K1741009.

sfGFP under xylose promoter xylF (very weak) - BBa_K1741010

We also tested the xylF promoter from the same double sided regulatory element, and xylF appears to be a very weak promoter slightly induced by xylose.

You can find this part's sequence with more information in registry: BBa_K1741010.

Other promoters

sfGFP under T7 promoter - BBa_K1741011

This part imitates the most popular IPTG/lactose dependent T7 driven expression systems. To express sfGFP or another sequence with which one can substitute sfGFP ORF using Gibson or CPEC assembly, host strain of choice expressing T7 RNA polymerase is necessary, not only DE3.

You can find this part's sequence with more information in registry: BBa_K1741011.

sfGFP under proC promoter - BBa_K1741012

proC - moderately strong constitutive promoter seems to reflect growth rate of E. coli bacterial strains on different media, and potentially can be a measure of protein biosynthesis rate, to be determined in future. Expression is higher than of inducible promoters.

You can find this part's sequence with more information in registry: BBa_K1741012.

sfGFP under proC promoter with a hairpin in 5'UTR BBa_K1741013

A weak hairpin introduced to 5’UTR slightly lowers transcription/translation. Will be extended to a thermometer, actually we see no temp. dependence.

You can find this part's sequence with more information in registry: BBa_K1741013.

sfGFP under proD promoter - BBa_K1741014

A strong insulated constitutive promoter proD is stronger than proC. Expression profiles of proC and proD are similar on different media = both seem to be really constitutive and the expression level does depend on E. coli growth rate.

You can find this part's sequence with more information in registry: BBa_K1741014.