Difference between revisions of "Team:UAM Poznan/Parts"
| Line 94: | Line 94: | ||
transition: background 0.3s, transform 0.3s; | transition: background 0.3s, transform 0.3s; | ||
} | } | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
nav.cmn-tile-nav li.colour-1 { | nav.cmn-tile-nav li.colour-1 { | ||
background-color: #28aadc; | background-color: #28aadc; | ||
| Line 175: | Line 169: | ||
/* smoother transitions */ | /* smoother transitions */ | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
/* media queries */ | /* media queries */ | ||
| Line 201: | Line 187: | ||
text-align: center; | text-align: center; | ||
padding: 60px 20px 20px 20px; | padding: 60px 20px 20px 20px; | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
} | } | ||
} | } | ||
| Line 223: | Line 197: | ||
padding: 80px 20px 20px 20px; | padding: 80px 20px 20px 20px; | ||
} | } | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
} | } | ||
/* ============================================================ | /* ============================================================ | ||
Revision as of 15:21, 18 September 2015
Toggle Navigation
All promoter fragments derive from Escherichia coli K12, strain DH5 alpha, some elements are synthetic. Chromosomal DNA of E. coli was isolated as described in the methods section.
Arabinose induced promoters
sfGFP under arabinose promoter s1 without AraC (Arashort1) - BBa_K1741000
In commercially available expression vectors arabinose promoter araBAD is usually used together with a gene for AraC transcription activator / repressor to make the system independent of chromosomal copy of AraC gene. We fused the araBAD promoter without AraC reading frame, as other sugar induced promoters to sfGFP. The shorter version of the popular promoter is still functional i.e. induced by arabinose. Arabinose induced (0,4%) in a a short time (1-8h) expression is a bit lower than driven by AraC-araBAD but after a longer time like 18h the GFP level is higher than from AraC-araBAD promoter. New shorter versions of arabinose induced promoters, all originating from E. coli genome were compared to the biobrick BBa_K1481002, provided last year by Poznan_Bioinf team.
The sequence of this promoter starts from O2 region the left part of the binding site of AraC in absence of arabinose.
You can find this part's sequence with more information in registry: BBa_K1741000.
sfGFP under a short arabinose promoter s2 without O1 and O2 - BBa_K1741002
This shortened version of araBAD promoter does not contain O1 and O2 regions, but still contains the CRP binding site. We can expect than this version of araBAD will be still repressed by CRP but not by AraC without arabinose. From our preliminary experiments it appears that the promoter is more strongly induced by arabinose than AraC-AraBAD but is weaker than arashort1. All three arabinose pomoters are repressed by glucose.
You can find this part's sequence with more information in registry: BBa_K1741002.
Melibiose induced promoters
sfGFP under melibiose promoter - BBa_K1741003
MelR chromosomal copy of MelR is sufficient to activate the melibiose melAB promoter copied from E. coli K12 chromosome when melibiose is added to M9 minimal medium or to a rich medium 2xLB (0,4%). In both media induction is much weaker than of arabinose or rhamnose induced promoters.
You can find this part's sequence with more information in registry: BBa_K1741003.
sfGFP under melibiose promoter, with improved 5'UTR - BBa_K1741004
Twice higher expression has been obtained by 5’UTR editing – removal of potential secondary structure which involved RBS and a better positioning of RBS - 7 nt upstream AUG start codon. The modified 5’UTR results in about twice higher expression upon melibiose addition to the M9 or 2xLB medium. The promer is still weaker than araBAD or rhaBAD, so can be a promoter of choice if lower expression level is necessary for efficient folding or secretion of a recombinant protein.
You can find this part's sequence with more information in registry: BBa_K1741004.
Rhamnose induced promoters
sfGFP under rhamnose promoter with removed EcoRI site - BBa_K1741005
rhaBAD promoter has been copied from E. coli genome: ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgaattcaggcgctttttagactggtcgtaatgaaattcagcaggatcacatt,
then Eco RI site was removed by PCR to obtain Rha1 in a biobrick standard:
ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgaatttaggcgctttttagactggtcgtaatgaaattcagcaggatcacatt.
The only one point mutation makes the promoter slightly stronger and more sensitive to rhamnose.
You can find this part's sequence with more information in registry: BBa_K1741005.
sfGFP under short rhamnose promoter (very weak) - BBa_K1741006
From rhaBAD1 promoter we removed both CRP binding sites. It seems likely thatt RhaS binding site has been also affected, so however the resulting promoter is still induced by rhamnose, the induction is very weak.
You can find this part's sequence with more information in registry: BBa_K1741006.
Xylose induced promoters
sfGFP under xylose promoter xylA (xylWT) - BBa_K1741007
SfGFP under xylose promoter xylA (wild type).
You can find this part's sequence with more information in registry: BBa_K1741007.
sfGFP under xylose promoter xylA1 with improved 5'UTR - BBa_K1741008
Xylose induced promoter xylA is weaker than arabinose and rhamnose promoters. To enhance the efficiency of xylA driven transcription/translation we have transplanted 5'UTR from the strong constitutive promoter proD. In some experiments it seems to be slightly stronger than original xylA promoter from part BBa_K1741007.
You can find this part's sequence with more information in registry: BBa_K1741008.
sfGFP under shortened xylose promoter xylA1 with improved 5'UTR BBa_K1741009
Short version of xylA promoter with known functional elements is stronger than two other versions.
You can find this part's sequence with more information in registry: BBa_K1741009.
sfGFP under xylose promoter xylF (very weak) - BBa_K1741010
We also tested the xylF promoter from the same double sided regulatory element, and xylF appears to be a very weak promoter slightly induced by xylose.
You can find this part's sequence with more information in registry: BBa_K1741010.
Other promoters
sfGFP under T7 promoter - BBa_K1741011
This part imitates the most popular IPTG/lactose dependent T7 driven expression systems. To express sfGFP or another sequence with which one can substitute sfGFP ORF using Gibson or CPEC assembly, host strain of choice expressing T7 RNA polymerase is necessary, not only DE3.
You can find this part's sequence with more information in registry: BBa_K1741011.
sfGFP under proC promoter - BBa_K1741012
proC - moderately strong constitutive promoter seems to reflect growth rate of E. coli bacterial strains on different media, and potentially can be a measure of protein biosynthesis rate, to be determined in future. Expression is higher than of inducible promoters.
You can find this part's sequence with more information in registry: BBa_K1741012.
sfGFP under proC promoter with a hairpin in 5'UTR BBa_K1741013
A weak hairpin introduced to 5’UTR slightly lowers transcription/translation. Will be extended to a thermometer, actually we see no temp. dependence.
You can find this part's sequence with more information in registry: BBa_K1741013.
sfGFP under proD promoter - BBa_K1741014
A strong insulated constitutive promoter proD is stronger than proC. Expression profiles of proC and proD are similar on different media = both seem to be really constitutive and the expression level does depend on E. coli growth rate.
You can find this part's sequence with more information in registry: BBa_K1741014.