Difference between revisions of "Team:Mingdao/Parts"
(82 intermediate revisions by 2 users not shown) | |||
Line 3: | Line 3: | ||
<style> | <style> | ||
.firstHeading { | .firstHeading { | ||
− | + | display: none; | |
− | + | } | |
#globalWrapper, #content{ | #globalWrapper, #content{ | ||
− | + | background-color: transparent; | |
− | + | border: 0px; | |
− | + | float: left; | |
− | margin:0px; | + | margin:0px; |
− | + | padding: 0px; | |
− | width:100%; | + | width:100%; |
− | + | } | |
− | + | ||
</style> | </style> | ||
− | |||
<script type="text/javascript"> | <script type="text/javascript"> | ||
Line 26: | Line 24: | ||
<!-- CSS --> | <!-- CSS --> | ||
<link rel="stylesheet" type="text/css" href="https://2015.igem.org/Team:Mingdao/CSS-site_global?action=raw&ctype=text/css"/> | <link rel="stylesheet" type="text/css" href="https://2015.igem.org/Team:Mingdao/CSS-site_global?action=raw&ctype=text/css"/> | ||
− | + | <style> | |
− | + | #u4110 | |
+ | { | ||
+ | border-color: #000000; | ||
+ | background: transparent url("https://static.igem.org/mediawiki/2015/9/96/Mingdao-marmod2.png") no-repeat center top; | ||
+ | background-size: cover; | ||
+ | } | ||
+ | |||
+ | #u99 | ||
+ | { | ||
+ | border-color: #000000; | ||
+ | background-color: #E7E0D9; | ||
+ | background-color: rgba(117, 76, 36, 0.17); | ||
+ | -pie-background: rgba(117, 76, 36, 0.17); | ||
+ | } | ||
+ | |||
+ | #u5104 | ||
+ | { | ||
+ | background-color: transparent; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u5104:hover | ||
+ | { | ||
+ | background-color: #DDDDDD; | ||
+ | background-color: rgba(153, 153, 153, 0.33); | ||
+ | -pie-background: rgba(153, 153, 153, 0.33); | ||
+ | } | ||
+ | |||
+ | #u5104:active | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u5104.MuseMenuActive | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1135 | ||
+ | { | ||
+ | background-color: transparent; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u1135:hover | ||
+ | { | ||
+ | background-color: #DDDDDD; | ||
+ | background-color: rgba(153, 153, 153, 0.33); | ||
+ | -pie-background: rgba(153, 153, 153, 0.33); | ||
+ | } | ||
+ | |||
+ | #u1135:active | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1135.MuseMenuActive | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1184 | ||
+ | { | ||
+ | background-color: transparent; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u1184:hover | ||
+ | { | ||
+ | background-color: #DDDDDD; | ||
+ | background-color: rgba(153, 153, 153, 0.33); | ||
+ | -pie-background: rgba(153, 153, 153, 0.33); | ||
+ | } | ||
+ | |||
+ | #u1184:active | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1184.MuseMenuActive | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1179 | ||
+ | { | ||
+ | background-color: transparent; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u1179:hover | ||
+ | { | ||
+ | background-color: #DDDDDD; | ||
+ | background-color: rgba(153, 153, 153, 0.33); | ||
+ | -pie-background: rgba(153, 153, 153, 0.33); | ||
+ | } | ||
+ | |||
+ | #u1179:active | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1179.MuseMenuActive | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1240 | ||
+ | { | ||
+ | background-color: transparent; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u1240:hover | ||
+ | { | ||
+ | background-color: #DDDDDD; | ||
+ | background-color: rgba(153, 153, 153, 0.33); | ||
+ | -pie-background: rgba(153, 153, 153, 0.33); | ||
+ | } | ||
+ | |||
+ | #u1240:active | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1240.MuseMenuActive | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1142 | ||
+ | { | ||
+ | background-color: transparent; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u1142:hover | ||
+ | { | ||
+ | background-color: #DDDDDD; | ||
+ | background-color: rgba(153, 153, 153, 0.33); | ||
+ | -pie-background: rgba(153, 153, 153, 0.33); | ||
+ | } | ||
+ | |||
+ | #u1142:active | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u1142.MuseMenuActive | ||
+ | { | ||
+ | background-color: #AE7566; | ||
+ | background-color: rgba(121, 26, 0, 0.6); | ||
+ | -pie-background: rgba(121, 26, 0, 0.6); | ||
+ | } | ||
+ | |||
+ | #u5107-4_clip,#u1137-4_clip,#u1185-4_clip,#u1181-6_clip,#u1242-6_clip,#u1145-6_clip | ||
+ | { | ||
+ | overflow: hidden; | ||
+ | vertical-align: top; | ||
+ | } | ||
+ | |||
+ | #u5107-4_img,#u1137-4_img,#u1185-4_img,#u1181-6_img,#u1242-6_img,#u1145-6_img | ||
+ | { | ||
+ | display: block; | ||
+ | } | ||
+ | |||
+ | .MenuItem /* unifiedNavBar */ | ||
+ | { | ||
+ | cursor: pointer; | ||
+ | } | ||
+ | |||
+ | #u100 | ||
+ | { | ||
+ | border-color: #000000; | ||
+ | background-color: #E9D9C7; | ||
+ | background-color: rgba(0,0,0,0); | ||
+ | position: relative; | ||
+ | -pie-background: rgba(0,0,0,0); | ||
+ | } | ||
+ | |||
+ | #u4110_align_to_page,#u99_align_to_page,#menuu1133,#u5103,#u5107-4,#u1134,#u1137-4,#u1183,#u1185-4,#u1148,#u1181-6,#u1239,#u1242-6,#u1141,#u1145-6,#u8651 | ||
+ | { | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u1246,#u1247,#u1248,#u1249,#u5113 | ||
+ | { | ||
+ | border-style: solid; | ||
+ | border-color: #7F3400; | ||
+ | background-color: transparent; | ||
+ | position: relative; | ||
+ | border-width: 0px 0px 0px 2px; | ||
+ | } | ||
+ | .version.parts /* version checker */ | ||
+ | { | ||
+ | color: #0000EB; | ||
+ | background-color: #1F158E; | ||
+ | } | ||
+ | |||
+ | .html | ||
+ | { | ||
+ | background: #7F7F7F url("https://static.igem.org/mediawiki/2015/8/8f/Mingdao-bg.gif") repeat left top scroll; | ||
+ | } | ||
+ | #all{ | ||
+ | width:100%; | ||
+ | background: #FFFFFF url("https://static.igem.org/mediawiki/2015/8/8f/Mingdao-bg.gif") repeat-y center top; | ||
+ | } | ||
+ | |||
+ | #page | ||
+ | { | ||
+ | z-index: 1; | ||
+ | width: 1280px; | ||
+ | min-height: 12242.750000000005px; | ||
+ | border-style: none; | ||
+ | border-color: #000000; | ||
+ | padding-bottom: 0px; | ||
+ | margin-left: auto; | ||
+ | margin-right: auto; | ||
+ | background: #FFFFFF url("https://static.igem.org/mediawiki/2015/8/8f/Mingdao-bg.gif") repeat-y center top; | ||
+ | } | ||
+ | |||
+ | #page_position_content | ||
+ | { | ||
+ | padding-bottom: 48px; | ||
+ | } | ||
+ | |||
+ | #pu4110 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: -100px; | ||
+ | } | ||
+ | |||
+ | #u4110 | ||
+ | { | ||
+ | z-index: 2; | ||
+ | padding-bottom: 0px; | ||
+ | } | ||
+ | |||
+ | #u4110_align_to_page | ||
+ | { | ||
+ | margin-left: auto; | ||
+ | margin-right: auto; | ||
+ | width: 1280px; | ||
+ | left: -100px; | ||
+ | padding-top: 640px; | ||
+ | padding-bottom: 5px; | ||
+ | } | ||
+ | |||
+ | #u4202 | ||
+ | { | ||
+ | z-index: 55; | ||
+ | width: 696px; | ||
+ | left: 392px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4204-4 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4204-4 | ||
+ | { | ||
+ | z-index: 56; | ||
+ | display: block; | ||
+ | vertical-align: top; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | left: 46px; | ||
+ | } | ||
+ | |||
+ | #u4205-4 | ||
+ | { | ||
+ | z-index: 60; | ||
+ | width: 70px; | ||
+ | min-height: 29px; | ||
+ | font-size: 72px; | ||
+ | line-height: 86px; | ||
+ | color: #F15A24; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 44px; | ||
+ | } | ||
+ | |||
+ | #u4203-4 | ||
+ | { | ||
+ | z-index: 64; | ||
+ | width: 24px; | ||
+ | min-height: 29px; | ||
+ | font-size: 72px; | ||
+ | line-height: 86px; | ||
+ | color: #F15A24; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 44px; | ||
+ | left: 672px; | ||
+ | } | ||
+ | |||
+ | #u4206-4 | ||
+ | { | ||
+ | z-index: 68; | ||
+ | width: 977px; | ||
+ | font-size: 20px; | ||
+ | line-height: 32px; | ||
+ | color: #FFFFFF; | ||
+ | left: 261px; | ||
+ | margin-top: 276px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4207-4 | ||
+ | { | ||
+ | z-index: 72; | ||
+ | display: block; | ||
+ | vertical-align: top; | ||
+ | left: 541px; | ||
+ | margin-top: 48px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4208-10 | ||
+ | { | ||
+ | z-index: 76; | ||
+ | width: 1079px; | ||
+ | left: 215px; | ||
+ | top: -12px; | ||
+ | margin-bottom: -12px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4110-bw | ||
+ | { | ||
+ | z-index: 2; | ||
+ | height: 1645px; | ||
+ | } | ||
+ | |||
+ | #u99 | ||
+ | { | ||
+ | z-index: 3; | ||
+ | padding-bottom: 14px; | ||
+ | } | ||
+ | |||
+ | #u99_align_to_page | ||
+ | { | ||
+ | margin-left: auto; | ||
+ | margin-right: auto; | ||
+ | width: 1280px; | ||
+ | left: -100px; | ||
+ | } | ||
+ | |||
+ | #menuu1133 | ||
+ | { | ||
+ | z-index: 5; | ||
+ | width: 829px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 14px; | ||
+ | left: 531px; | ||
+ | } | ||
+ | |||
+ | #u5103 | ||
+ | { | ||
+ | width: 136px; | ||
+ | min-height: 72px; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u5104 | ||
+ | { | ||
+ | width: 136px; | ||
+ | padding-bottom: 40px; | ||
+ | } | ||
+ | |||
+ | #u5104:hover | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u5104:active | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1134 | ||
+ | { | ||
+ | width: 136px; | ||
+ | min-height: 72px; | ||
+ | margin-right: -10000px; | ||
+ | left: 138px; | ||
+ | } | ||
+ | |||
+ | #u1135 | ||
+ | { | ||
+ | width: 136px; | ||
+ | padding-bottom: 40px; | ||
+ | } | ||
+ | |||
+ | #u5104.MuseMenuActive,#u1135:hover | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1135:active | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1183 | ||
+ | { | ||
+ | width: 136px; | ||
+ | min-height: 72px; | ||
+ | margin-right: -10000px; | ||
+ | left: 276px; | ||
+ | } | ||
+ | |||
+ | #u1184 | ||
+ | { | ||
+ | width: 136px; | ||
+ | padding-bottom: 40px; | ||
+ | } | ||
+ | |||
+ | #u1135.MuseMenuActive,#u1184:hover | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1184:active | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u5107-4_clip,#u1137-4_clip,#u1185-4_clip | ||
+ | { | ||
+ | width: 136px; | ||
+ | height: 32px; | ||
+ | } | ||
+ | |||
+ | #u5107-4,#u1137-4,#u1185-4 | ||
+ | { | ||
+ | margin-right: -10000px; | ||
+ | top: 20px; | ||
+ | } | ||
+ | |||
+ | #u1148 | ||
+ | { | ||
+ | width: 137px; | ||
+ | min-height: 72px; | ||
+ | margin-right: -10000px; | ||
+ | left: 414px; | ||
+ | } | ||
+ | |||
+ | #u1179 | ||
+ | { | ||
+ | width: 137px; | ||
+ | padding-bottom: 8px; | ||
+ | } | ||
+ | |||
+ | #u1184.MuseMenuActive,#u1179:hover | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1179:active | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1239 | ||
+ | { | ||
+ | width: 137px; | ||
+ | min-height: 72px; | ||
+ | margin-right: -10000px; | ||
+ | left: 553px; | ||
+ | } | ||
+ | |||
+ | #u1240 | ||
+ | { | ||
+ | width: 137px; | ||
+ | padding-bottom: 8px; | ||
+ | } | ||
+ | |||
+ | #u1179.MuseMenuActive,#u1240:hover | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1240:active | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1141 | ||
+ | { | ||
+ | width: 137px; | ||
+ | min-height: 72px; | ||
+ | margin-right: -10000px; | ||
+ | left: 692px; | ||
+ | } | ||
+ | |||
+ | #u1142 | ||
+ | { | ||
+ | width: 137px; | ||
+ | padding-bottom: 8px; | ||
+ | } | ||
+ | |||
+ | #u1240.MuseMenuActive,#u1142:hover | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1142:active | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1142.MuseMenuActive | ||
+ | { | ||
+ | margin: 0px; | ||
+ | } | ||
+ | |||
+ | #u1181-6_clip,#u1242-6_clip,#u1145-6_clip | ||
+ | { | ||
+ | width: 137px; | ||
+ | height: 64px; | ||
+ | } | ||
+ | |||
+ | #u1181-6,#u1242-6,#u1145-6 | ||
+ | { | ||
+ | margin-right: -10000px; | ||
+ | top: 4px; | ||
+ | } | ||
+ | |||
+ | #u99-bw | ||
+ | { | ||
+ | z-index: 3; | ||
+ | margin-top: 208px; | ||
+ | height: 86px; | ||
+ | } | ||
+ | |||
+ | #u100 | ||
+ | { | ||
+ | z-index: 4; | ||
+ | width: 333px; | ||
+ | padding-bottom: 8px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 142px; | ||
+ | left: 186px; | ||
+ | } | ||
+ | |||
+ | #u8651 | ||
+ | { | ||
+ | z-index: 53; | ||
+ | width: 317px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: -19px; | ||
+ | left: 12px; | ||
+ | } | ||
+ | |||
+ | #u1246 | ||
+ | { | ||
+ | z-index: 48; | ||
+ | width: 23px; | ||
+ | height: 58px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 232px; | ||
+ | left: 668px; | ||
+ | } | ||
+ | |||
+ | #u1247 | ||
+ | { | ||
+ | z-index: 49; | ||
+ | width: 23px; | ||
+ | height: 58px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 232px; | ||
+ | left: 805px; | ||
+ | } | ||
+ | |||
+ | #u1248 | ||
+ | { | ||
+ | z-index: 50; | ||
+ | width: 23px; | ||
+ | height: 58px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 232px; | ||
+ | left: 1082px; | ||
+ | } | ||
+ | |||
+ | #u1249 | ||
+ | { | ||
+ | z-index: 51; | ||
+ | width: 23px; | ||
+ | height: 58px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 232px; | ||
+ | left: 1221px; | ||
+ | } | ||
+ | |||
+ | #u5113 | ||
+ | { | ||
+ | z-index: 52; | ||
+ | width: 24px; | ||
+ | height: 58px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 232px; | ||
+ | left: 943px; | ||
+ | } | ||
+ | |||
+ | #gene | ||
+ | { | ||
+ | position: relative; | ||
+ | width: 22px; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 1259px; | ||
+ | left: 646px; | ||
+ | } | ||
+ | |||
+ | #menuu6069 | ||
+ | { | ||
+ | z-index: 494; | ||
+ | width: 186px; | ||
+ | position: fixed; | ||
+ | top: 133px; | ||
+ | left: -163px; | ||
+ | } | ||
+ | |||
+ | #u6140 | ||
+ | { | ||
+ | width: 186px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u6143 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 22px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 24px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6143:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6143:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6143.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6087 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 22px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 24px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6087:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6087:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6087.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6197 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 29px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6197:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6197:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6197.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6108 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 29px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6108:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6108:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6108.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6236 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 29px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6236:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6236:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6236.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6229 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 29px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6229:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6229:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6229.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6222 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 29px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6222:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6222:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6222.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6136 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 22px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 24px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6136:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6136:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6136.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6144-4,#u6090-4,#u6139-4 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 22px; | ||
+ | color: #FFFFFF; | ||
+ | font-size: 18px; | ||
+ | line-height: 22px; | ||
+ | text-align: right; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | top: 12px; | ||
+ | } | ||
+ | |||
+ | #u6169 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 29px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6169:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6169:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6169.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6199-4,#u6110-4,#u6239-4,#u6232-4,#u6225-4,#u6172-4 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | color: #FFFFFF; | ||
+ | font-size: 14px; | ||
+ | text-align: right; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | top: 14px; | ||
+ | } | ||
+ | |||
+ | #u6176 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 30px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6176:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6176:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6176.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6084,#u6196,#u6105,#u6235,#u6228,#u6221,#u6133,#u6168,#u6175,#u6154 | ||
+ | { | ||
+ | width: 186px; | ||
+ | margin-top: 2px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u6157 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | background-color: #FFE7B5; | ||
+ | background-color: rgba(255, 213, 121, 0.55); | ||
+ | padding-bottom: 30px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | -pie-background: rgba(255, 213, 121, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6157:hover | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6157:active | ||
+ | { | ||
+ | background-color: #ADADAD; | ||
+ | background-color: rgba(107, 107, 107, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(107, 107, 107, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6157.MuseMenuActive | ||
+ | { | ||
+ | background-color: #C6C6C6; | ||
+ | background-color: rgba(153, 153, 153, 0.55); | ||
+ | margin: 0px -10000px 0px 0px; | ||
+ | -pie-background: rgba(153, 153, 153, 0.55); | ||
+ | } | ||
+ | |||
+ | #u6179-4,#u6158-4 | ||
+ | { | ||
+ | width: 186px; | ||
+ | min-height: 17px; | ||
+ | color: #FFFFFF; | ||
+ | font-size: 14px; | ||
+ | text-align: right; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | top: 15px; | ||
+ | } | ||
+ | |||
+ | #u6144-2,#u6090-2,#u6199-2,#u6110-2,#u6239-2,#u6232-2,#u6225-2,#u6139-2,#u6172-2,#u6179-2,#u6158-2 | ||
+ | { | ||
+ | padding-right: 8px; | ||
+ | } | ||
+ | |||
+ | .MenuItem /* unifiedNavBar */ | ||
+ | { | ||
+ | cursor: pointer; | ||
+ | } | ||
+ | |||
+ | #biobrick | ||
+ | { | ||
+ | margin-left: 496px; | ||
+ | margin-top: 12px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4209-4 | ||
+ | { | ||
+ | z-index: 86; | ||
+ | display: block; | ||
+ | vertical-align: top; | ||
+ | margin-left: 441px; | ||
+ | top: -3px; | ||
+ | margin-bottom: -3px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4210-4 | ||
+ | { | ||
+ | z-index: 90; | ||
+ | width: 1116px; | ||
+ | font-size: 20px; | ||
+ | line-height: 24px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 98px; | ||
+ | margin-top: 16px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #sr-psb1c3 | ||
+ | { | ||
+ | margin-left: 557px; | ||
+ | margin-top: 49px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4211-21 | ||
+ | { | ||
+ | z-index: 94; | ||
+ | width: 1097px; | ||
+ | margin-left: 106px; | ||
+ | margin-top: 9px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4254 | ||
+ | { | ||
+ | z-index: 268; | ||
+ | width: 1105px; | ||
+ | margin-left: 88px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #srpk-psb1c3 | ||
+ | { | ||
+ | margin-left: 530px; | ||
+ | margin-top: 48px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4230-24 | ||
+ | { | ||
+ | z-index: 115; | ||
+ | width: 1097px; | ||
+ | margin-left: 84px; | ||
+ | margin-top: 7px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4260 | ||
+ | { | ||
+ | z-index: 270; | ||
+ | width: 1026px; | ||
+ | margin-left: 127px; | ||
+ | margin-top: 7px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4243-4 | ||
+ | { | ||
+ | z-index: 190; | ||
+ | width: 1168px; | ||
+ | min-height: 20px; | ||
+ | font-size: 20px; | ||
+ | line-height: 24px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 56px; | ||
+ | margin-top: 25px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #gst-sr-psb1c3 | ||
+ | { | ||
+ | margin-left: 485px; | ||
+ | margin-top: 105px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4234-24 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 74px; | ||
+ | margin-top: 23px; | ||
+ | } | ||
+ | |||
+ | #u4234-24 | ||
+ | { | ||
+ | z-index: 139; | ||
+ | width: 1097px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4266 | ||
+ | { | ||
+ | z-index: 272; | ||
+ | width: 996px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 279px; | ||
+ | left: 68px; | ||
+ | } | ||
+ | |||
+ | #u4242-4 | ||
+ | { | ||
+ | z-index: 186; | ||
+ | width: 1165px; | ||
+ | color: #FFFFFF; | ||
+ | font-size: 20px; | ||
+ | line-height: 24px; | ||
+ | font-family: Arial, Helvetica Neue, Helvetica, sans-serif; | ||
+ | margin-left: 57px; | ||
+ | margin-top: 21px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #srpk-his-psb1c3 | ||
+ | { | ||
+ | margin-left: 512px; | ||
+ | margin-top: 20px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4238-23 | ||
+ | { | ||
+ | z-index: 163; | ||
+ | width: 1097px; | ||
+ | margin-left: 91px; | ||
+ | margin-top: 11px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4211-2,#u4230-2,#u4234-2,#u4238-2 | ||
+ | { | ||
+ | font-size: 28px; | ||
+ | text-align: center; | ||
+ | line-height: 34px; | ||
+ | color: #FBB03B; | ||
+ | } | ||
+ | |||
+ | #u4208,#u4208-5,#u4211-3,#u4211-10,#u4211-16,#u4230-3,#u4230-17,#u4234-3,#u4234-17,#u4238-3,#u4238-17 | ||
+ | { | ||
+ | color: #FBB03B; | ||
+ | } | ||
+ | |||
+ | #u4230-12,#u4230-21,#u4234-12,#u4234-21,#u4238-12,#u4238-21 | ||
+ | { | ||
+ | font-size: 20px; | ||
+ | line-height: 24px; | ||
+ | color: #FBB03B; | ||
+ | } | ||
+ | |||
+ | #u4272 | ||
+ | { | ||
+ | z-index: 274; | ||
+ | width: 903px; | ||
+ | margin-left: 189px; | ||
+ | margin-top: 13px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #data | ||
+ | { | ||
+ | margin-left: 574px; | ||
+ | margin-top: 43px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4244-4 | ||
+ | { | ||
+ | z-index: 194; | ||
+ | display: block; | ||
+ | vertical-align: top; | ||
+ | margin-left: 456px; | ||
+ | margin-top: 8px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4245-4 | ||
+ | { | ||
+ | z-index: 198; | ||
+ | width: 634px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 323px; | ||
+ | margin-top: 9px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4278 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 415px; | ||
+ | margin-top: 43px; | ||
+ | } | ||
+ | |||
+ | #u4278 | ||
+ | { | ||
+ | z-index: 276; | ||
+ | width: 200px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4278_clip | ||
+ | { | ||
+ | overflow: hidden; | ||
+ | width: 200px; | ||
+ | height: 232px; | ||
+ | } | ||
+ | |||
+ | #u4278_img | ||
+ | { | ||
+ | margin: -6px -5px; | ||
+ | } | ||
+ | |||
+ | #u4246-14 | ||
+ | { | ||
+ | z-index: 202; | ||
+ | width: 309px; | ||
+ | font-size: 20px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 26px; | ||
+ | left: 245px; | ||
+ | } | ||
+ | |||
+ | #u4247-4 | ||
+ | { | ||
+ | z-index: 216; | ||
+ | width: 616px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 326px; | ||
+ | margin-top: 42px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4284 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 294px; | ||
+ | margin-top: 51px; | ||
+ | } | ||
+ | |||
+ | #u4284 | ||
+ | { | ||
+ | z-index: 278; | ||
+ | width: 342px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4284_clip | ||
+ | { | ||
+ | overflow: hidden; | ||
+ | width: 342px; | ||
+ | height: 237px; | ||
+ | } | ||
+ | |||
+ | #u4284_img | ||
+ | { | ||
+ | margin: -10px -9px -14px -11px; | ||
+ | } | ||
+ | |||
+ | #u4248-19 | ||
+ | { | ||
+ | z-index: 220; | ||
+ | width: 548px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | left: 367px; | ||
+ | } | ||
+ | |||
+ | #u4249-4 | ||
+ | { | ||
+ | z-index: 239; | ||
+ | width: 1021px; | ||
+ | font-size: 20px; | ||
+ | line-height: 24px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 149px; | ||
+ | margin-top: 7px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4250-4 | ||
+ | { | ||
+ | z-index: 243; | ||
+ | width: 612px; | ||
+ | font-size: 25px; | ||
+ | line-height: 38px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 334px; | ||
+ | margin-top: 61px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4290 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 235px; | ||
+ | margin-top: 52px; | ||
+ | } | ||
+ | |||
+ | #u4290 | ||
+ | { | ||
+ | z-index: 280; | ||
+ | width: 143px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4290_clip | ||
+ | { | ||
+ | overflow: hidden; | ||
+ | width: 143px; | ||
+ | height: 263px; | ||
+ | } | ||
+ | |||
+ | #u4290_img | ||
+ | { | ||
+ | margin: -10px -9px; | ||
+ | } | ||
+ | |||
+ | #u4296 | ||
+ | { | ||
+ | z-index: 282; | ||
+ | width: 242px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | left: 192px; | ||
+ | } | ||
+ | |||
+ | #u4296_clip | ||
+ | { | ||
+ | overflow: hidden; | ||
+ | width: 242px; | ||
+ | height: 263px; | ||
+ | } | ||
+ | |||
+ | #u4296_img | ||
+ | { | ||
+ | margin: -12px -10px -13px -9px; | ||
+ | } | ||
+ | |||
+ | #u4251-8 | ||
+ | { | ||
+ | z-index: 247; | ||
+ | width: 429px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 33px; | ||
+ | left: 478px; | ||
+ | } | ||
+ | |||
+ | #u4252-4 | ||
+ | { | ||
+ | z-index: 255; | ||
+ | width: 788px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 246px; | ||
+ | margin-top: 32px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4305 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 125px; | ||
+ | margin-top: 31px; | ||
+ | } | ||
+ | |||
+ | #u4305 | ||
+ | { | ||
+ | z-index: 284; | ||
+ | width: 538px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4305_clip | ||
+ | { | ||
+ | overflow: hidden; | ||
+ | width: 538px; | ||
+ | height: 266px; | ||
+ | } | ||
+ | |||
+ | #u4305_img | ||
+ | { | ||
+ | margin: -7px -7px -9px; | ||
+ | } | ||
+ | |||
+ | #u4253-9 | ||
+ | { | ||
+ | z-index: 259; | ||
+ | width: 365px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 13px; | ||
+ | left: 588px; | ||
+ | } | ||
+ | |||
+ | #u4311-4 | ||
+ | { | ||
+ | z-index: 286; | ||
+ | width: 1015px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 133px; | ||
+ | margin-top: 61px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4313 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 158px; | ||
+ | margin-top: 66px; | ||
+ | } | ||
+ | |||
+ | #u4313 | ||
+ | { | ||
+ | z-index: 313; | ||
+ | width: 244px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 11px; | ||
+ | } | ||
+ | |||
+ | #u4319 | ||
+ | { | ||
+ | z-index: 315; | ||
+ | width: 146px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 11px; | ||
+ | left: 294px; | ||
+ | } | ||
+ | |||
+ | #u4312-23 | ||
+ | { | ||
+ | z-index: 290; | ||
+ | width: 494px; | ||
+ | font-size: 20px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | left: 472px; | ||
+ | } | ||
+ | |||
+ | #u4325-4 | ||
+ | { | ||
+ | z-index: 317; | ||
+ | width: 631px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 325px; | ||
+ | margin-top: 78px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4327 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 325px; | ||
+ | margin-top: 38px; | ||
+ | } | ||
+ | |||
+ | #u4327 | ||
+ | { | ||
+ | z-index: 333; | ||
+ | width: 193px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4326-12 | ||
+ | { | ||
+ | z-index: 321; | ||
+ | width: 534px; | ||
+ | font-size: 20px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 41px; | ||
+ | left: 225px; | ||
+ | } | ||
+ | |||
+ | #u4333-4 | ||
+ | { | ||
+ | z-index: 335; | ||
+ | width: 548px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 366px; | ||
+ | margin-top: 52px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4334-16 | ||
+ | { | ||
+ | z-index: 339; | ||
+ | width: 351px; | ||
+ | margin-left: 466px; | ||
+ | margin-top: 43px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4334-13 | ||
+ | { | ||
+ | font-size: 20px; | ||
+ | text-align: center; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | } | ||
+ | |||
+ | #vector | ||
+ | { | ||
+ | margin-left: 508px; | ||
+ | margin-top: 10px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4335-4 | ||
+ | { | ||
+ | z-index: 355; | ||
+ | display: block; | ||
+ | vertical-align: top; | ||
+ | margin-left: 441px; | ||
+ | top: -1px; | ||
+ | margin-bottom: -1px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4336-4 | ||
+ | { | ||
+ | z-index: 359; | ||
+ | width: 839px; | ||
+ | font-size: 20px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | margin-left: 220px; | ||
+ | margin-top: 14px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #sr-pgex-2t | ||
+ | { | ||
+ | margin-left: 552px; | ||
+ | margin-top: 10px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4337-9 | ||
+ | { | ||
+ | z-index: 363; | ||
+ | width: 971px; | ||
+ | margin-left: 156px; | ||
+ | margin-top: 9px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4338 | ||
+ | { | ||
+ | z-index: 372; | ||
+ | width: 490px; | ||
+ | margin-left: 386px; | ||
+ | top: -6px; | ||
+ | margin-bottom: -6px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4254_img,#u4338_img | ||
+ | { | ||
+ | padding-right: 1px; | ||
+ | } | ||
+ | |||
+ | #srpk-pet-29b | ||
+ | { | ||
+ | margin-left: 532px; | ||
+ | margin-top: 30px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4344-8 | ||
+ | { | ||
+ | z-index: 374; | ||
+ | width: 971px; | ||
+ | margin-left: 145px; | ||
+ | margin-top: 11px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4337-2,#u4344-2 | ||
+ | { | ||
+ | font-size: 25px; | ||
+ | text-align: center; | ||
+ | line-height: 38px; | ||
+ | color: #FBB03B; | ||
+ | } | ||
+ | |||
+ | #u4345 | ||
+ | { | ||
+ | z-index: 382; | ||
+ | width: 498px; | ||
+ | margin-left: 382px; | ||
+ | margin-top: 12px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #data2 | ||
+ | { | ||
+ | margin-left: 554px; | ||
+ | margin-top: 10px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4351-5 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 184px; | ||
+ | margin-top: 12px; | ||
+ | } | ||
+ | |||
+ | #u4351-5 | ||
+ | { | ||
+ | z-index: 384; | ||
+ | width: 159px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | left: 376px; | ||
+ | } | ||
+ | |||
+ | #u4351-2 | ||
+ | { | ||
+ | font-size: 30px; | ||
+ | text-align: center; | ||
+ | line-height: 45px; | ||
+ | letter-spacing: 3px; | ||
+ | color: #FBB03B; | ||
+ | } | ||
+ | |||
+ | #u4352-6 | ||
+ | { | ||
+ | z-index: 389; | ||
+ | width: 893px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 46px; | ||
+ | } | ||
+ | |||
+ | #u4352-2 | ||
+ | { | ||
+ | font-size: 25px; | ||
+ | text-align: center; | ||
+ | line-height: 38px; | ||
+ | color: #B0DCFF; | ||
+ | } | ||
+ | |||
+ | #u4208-3,#u4208-4,#u4208-7,#u4248-2,#u4248-4,#u4248-6,#u4248-8,#u4248-10,#u4248-12,#u4248-14,#u4248-16,#u4251-2,#u4251-3,#u4251-5,#u4253-2,#u4253-4,#u4253-6,#u4334-2,#u4334-4,#u4334-6,#u4334-8,#u4334-9,#u4337-4,#u4337-6,#u4344-4,#u4344-6,#u4352-4 | ||
+ | { | ||
+ | font-size: 20px; | ||
+ | line-height: 30px; | ||
+ | color: #FFFFFF; | ||
+ | } | ||
+ | |||
+ | #u4353-4 | ||
+ | { | ||
+ | z-index: 395; | ||
+ | width: 287px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #91DDFF; | ||
+ | margin-left: 487px; | ||
+ | margin-top: 31px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4354 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 221px; | ||
+ | margin-top: 31px; | ||
+ | } | ||
+ | |||
+ | #u4354 | ||
+ | { | ||
+ | z-index: 399; | ||
+ | width: 266px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4360-16 | ||
+ | { | ||
+ | z-index: 401; | ||
+ | width: 615px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 50px; | ||
+ | left: 299px; | ||
+ | } | ||
+ | |||
+ | #u4360-2,#u4360-11 | ||
+ | { | ||
+ | font-size: 23px; | ||
+ | line-height: 28px; | ||
+ | color: #91DDFF; | ||
+ | } | ||
+ | |||
+ | #u4362-4 | ||
+ | { | ||
+ | z-index: 417; | ||
+ | width: 188px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #91DDFF; | ||
+ | margin-left: 537px; | ||
+ | margin-top: 48px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4363-4 | ||
+ | { | ||
+ | z-index: 421; | ||
+ | width: 383px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #F4FF97; | ||
+ | margin-left: 439px; | ||
+ | margin-top: 30px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4366 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 262px; | ||
+ | margin-top: 49px; | ||
+ | } | ||
+ | |||
+ | #u4366 | ||
+ | { | ||
+ | z-index: 452; | ||
+ | width: 325px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4364-27 | ||
+ | { | ||
+ | z-index: 425; | ||
+ | display: block; | ||
+ | vertical-align: top; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 6px; | ||
+ | left: 369px; | ||
+ | } | ||
+ | |||
+ | #u4372-4 | ||
+ | { | ||
+ | z-index: 454; | ||
+ | width: 347px; | ||
+ | font-size: 25px; | ||
+ | line-height: 30px; | ||
+ | color: #F4FF97; | ||
+ | margin-left: 457px; | ||
+ | margin-top: 50px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #pu4374 | ||
+ | { | ||
+ | width: 0.01px; | ||
+ | margin-left: 268px; | ||
+ | margin-top: 26px; | ||
+ | } | ||
+ | |||
+ | #u4374 | ||
+ | { | ||
+ | z-index: 480; | ||
+ | width: 325px; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | } | ||
+ | |||
+ | #u4373-22 | ||
+ | { | ||
+ | z-index: 458; | ||
+ | display: block; | ||
+ | vertical-align: top; | ||
+ | position: relative; | ||
+ | margin-right: -10000px; | ||
+ | margin-top: 60px; | ||
+ | left: 369px; | ||
+ | } | ||
+ | |||
+ | #u4377-12 | ||
+ | { | ||
+ | z-index: 482; | ||
+ | width: 830px; | ||
+ | margin-left: 216px; | ||
+ | margin-top: 31px; | ||
+ | position: relative; | ||
+ | } | ||
+ | |||
+ | #u4377-2,#u4377-7 | ||
+ | { | ||
+ | font-size: 25px; | ||
+ | text-align: center; | ||
+ | line-height: 30px; | ||
+ | color: #91DDFF; | ||
+ | } | ||
+ | |||
+ | #u4211-7,#u4211-9,#u4211-11,#u4211-13,#u4211-15,#u4211-18,#u4230-8,#u4230-10,#u4230-14,#u4230-16,#u4230-19,#u4234-8,#u4234-10,#u4234-14,#u4234-16,#u4234-19,#u4238-8,#u4238-10,#u4238-14,#u4238-16,#u4238-19,#u4360-4,#u4360-6,#u4360-8,#u4360-9,#u4360-13,#u4377-4,#u4377-5,#u4377-9 | ||
+ | { | ||
+ | font-size: 20px; | ||
+ | line-height: 24px; | ||
+ | color: #FFFFFF; | ||
+ | } | ||
+ | |||
+ | body | ||
+ | { | ||
+ | position: relative; | ||
+ | min-width: 1280px; | ||
+ | } | ||
+ | |||
+ | #page .verticalspacer | ||
+ | { | ||
+ | clear: both; | ||
+ | } | ||
+ | </style> | ||
<!-- Other scripts --> | <!-- Other scripts --> | ||
<script type="text/javascript"> | <script type="text/javascript"> | ||
Line 34: | Line 2,001: | ||
<!-- JS includes --> | <!-- JS includes --> | ||
<!--[if lt IE 9]> | <!--[if lt IE 9]> | ||
− | <script src=" | + | <script src="https://2015.igem.org/Team:Mingdao/Javascript-html5shiv? |
+ | action=raw&ctype=text/javascript" type="text/javascript"></script> | ||
<![endif]--> | <![endif]--> | ||
<!--custom head HTML--> | <!--custom head HTML--> | ||
Line 54: | Line 2,022: | ||
</head> | </head> | ||
<body> | <body> | ||
− | + | <div id="all"> | |
<div class="clearfix" id="page"><!-- column --> | <div class="clearfix" id="page"><!-- column --> | ||
<div class="position_content" id="page_position_content"> | <div class="position_content" id="page_position_content"> | ||
Line 63: | Line 2,031: | ||
<div class="clearfix colelem" id="u4202"><!-- group --> | <div class="clearfix colelem" id="u4202"><!-- group --> | ||
<div class="clearfix grpelem" id="pu4204-4"><!-- group --> | <div class="clearfix grpelem" id="pu4204-4"><!-- group --> | ||
− | <img class="grpelem" id="u4204-4" alt="Gene Block" width="618" height="121" src= | + | <img class="grpelem" id="u4204-4" alt="Gene Block" width="618" height="121" src="https://static.igem.org/mediawiki/2015/6/60/Mingdao-u4204-4.png"/><!-- rasterized frame --> |
<div class="clearfix grpelem" id="u4205-4"><!-- content --> | <div class="clearfix grpelem" id="u4205-4"><!-- content --> | ||
<p>*</p> | <p>*</p> | ||
Line 75: | Line 2,043: | ||
<p>In our project, we cloned two genes, SR and SRPK from the materials kindly gave by Dr. Woan-Yuh Tarn at Academia Sinica in Taiwan. Phosphoserine and arginine (highest nitrogen contents among 20 amino acids) play important roles in fire retardance. We found a novel fire retardant protein, SR protein, through protein database mining. SR proteins are post-translationally phosphorylated by SR protein kinase (SRPK). We co-transformed E. coli BL21 with two vectors simultaneously to express phosphorylated SR proteins.</p> | <p>In our project, we cloned two genes, SR and SRPK from the materials kindly gave by Dr. Woan-Yuh Tarn at Academia Sinica in Taiwan. Phosphoserine and arginine (highest nitrogen contents among 20 amino acids) play important roles in fire retardance. We found a novel fire retardant protein, SR protein, through protein database mining. SR proteins are post-translationally phosphorylated by SR protein kinase (SRPK). We co-transformed E. coli BL21 with two vectors simultaneously to express phosphorylated SR proteins.</p> | ||
</div> | </div> | ||
− | <img class="colelem" id="u4207-4" alt="Gene" width="398" height="110" src="https://static.igem.org/mediawiki/2015/ | + | <img class="colelem" id="u4207-4" alt="Gene" width="398" height="110" src="https://static.igem.org/mediawiki/2015/5/53/Mingdao-u4207-4.png"/><!-- rasterized frame --> |
<div class="clearfix colelem" id="u4208-10"><!-- content --> | <div class="clearfix colelem" id="u4208-10"><!-- content --> | ||
<p id="u4208-3"><span id="u4208">Serine/arginine-rich splicing factor 1 (SRSF1) </span>is a protein found on chromosome 17 in humans. SRSF1 is also known as alternative splicing factor 1 (ASF1), pre-mRNA-splicing factor SF2 (SF2), which is involved in alternative splicing, mRNA nuclear export and translation. It contains two functional domains. One in the N-terminus is RNA recognition motifs which interact with RNA and splicing factors. The other in the C-terminus is rich in serine and arginine residues (SR domain) and regulate the protein activity through phosphorylation by SR protein kinase.</p> | <p id="u4208-3"><span id="u4208">Serine/arginine-rich splicing factor 1 (SRSF1) </span>is a protein found on chromosome 17 in humans. SRSF1 is also known as alternative splicing factor 1 (ASF1), pre-mRNA-splicing factor SF2 (SF2), which is involved in alternative splicing, mRNA nuclear export and translation. It contains two functional domains. One in the N-terminus is RNA recognition motifs which interact with RNA and splicing factors. The other in the C-terminus is rich in serine and arginine residues (SR domain) and regulate the protein activity through phosphorylation by SR protein kinase.</p> | ||
Line 90: | Line 2,058: | ||
<nav class="MenuBar clearfix grpelem" id="menuu1133"><!-- horizontal box --> | <nav class="MenuBar clearfix grpelem" id="menuu1133"><!-- horizontal box --> | ||
<div class="MenuItemContainer clearfix grpelem" id="u5103"><!-- vertical box --> | <div class="MenuItemContainer clearfix grpelem" id="u5103"><!-- vertical box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu clearfix colelem" id="u5104" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu rgba-background clearfix colelem" id="u5104" href="https://2015.igem.org/Team:Mingdao"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u5107-4"><!-- rasterized frame --><div id="u5107-4_clip"><img id="u5107-4_img" alt="Home" width="136" height="32" src="https://static.igem.org/mediawiki/2015/9/9d/Mingdao-u5107-4.png"/></div></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix grpelem" id="u1134"><!-- vertical box --> | <div class="MenuItemContainer clearfix grpelem" id="u1134"><!-- vertical box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu clearfix colelem" id="u1135" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu rgba-background clearfix colelem" id="u1135" href="https://2015.igem.org/Team:Mingdao/Team"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u1137-4"><!-- rasterized frame --><div id="u1137-4_clip"><img id="u1137-4_img" alt="Team" width="136" height="32" src="https://static.igem.org/mediawiki/2015/1/16/Mingdao-u1137-4.png"/></div></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix grpelem" id="u1183"><!-- vertical box --> | <div class="MenuItemContainer clearfix grpelem" id="u1183"><!-- vertical box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu clearfix colelem" id="u1184" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu rgba-background clearfix colelem" id="u1184" href="https://2015.igem.org/Team:Mingdao/Project"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u1185-4"><!-- rasterized frame --><div id="u1185-4_clip"><img id="u1185-4_img" alt="Project" width="136" height="32" src="https://static.igem.org/mediawiki/2015/2/2d/Mingdao-u1185-4.png"/></div></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix grpelem" id="u1148"><!-- vertical box --> | <div class="MenuItemContainer clearfix grpelem" id="u1148"><!-- vertical box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu MuseMenuActive clearfix colelem" id="u1179" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu MuseMenuActive rgba-background clearfix colelem" id="u1179" href="https://2015.igem.org/Team:Mingdao/Parts"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u1181-6"><!-- rasterized frame --><div id="u1181-6_clip"><img id="u1181-6_img" alt="Gene |
− | Block" width="137" height="64" src="https://static.igem.org/mediawiki/2015/0/ | + | Block" width="137" height="64" src="https://static.igem.org/mediawiki/2015/0/06/Mingdao-u1181-6.png"/></div></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix grpelem" id="u1239"><!-- vertical box --> | <div class="MenuItemContainer clearfix grpelem" id="u1239"><!-- vertical box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu clearfix colelem" id="u1240" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu rgba-background clearfix colelem" id="u1240" href="https://2015.igem.org/Team:Mingdao/Practices"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u1242-6"><!-- rasterized frame --><div id="u1242-6_clip"><img id="u1242-6_img" alt="Human |
− | Practice" width="137" height="64" src="https://static.igem.org/mediawiki/2015/ | + | Practice" width="137" height="64" src="https://static.igem.org/mediawiki/2015/d/d2/Mingdao-u1242-6.png"/></div></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix grpelem" id="u1141"><!-- vertical box --> | <div class="MenuItemContainer clearfix grpelem" id="u1141"><!-- vertical box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu clearfix colelem" id="u1142" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu rgba-background clearfix colelem" id="u1142" href="https://2015.igem.org/Team:Mingdao/Lab"><!-- horizontal box --><div class="MenuItemLabel NoWrap grpelem" id="u1145-6"><!-- rasterized frame --><div id="u1145-6_clip"><img id="u1145-6_img" alt="Lab |
− | Stuff" width="137" height="64" src="https://static.igem.org/mediawiki/2015/ | + | Stuff" width="137" height="64" src="https://static.igem.org/mediawiki/2015/8/84/Mingdao-u1145-6.png"/></div></div></a> |
</div> | </div> | ||
</nav> | </nav> | ||
Line 116: | Line 2,084: | ||
<div class="clearfix grpelem" id="u100"><!-- group --> | <div class="clearfix grpelem" id="u100"><!-- group --> | ||
<div class="clip_frame grpelem" id="u8651"><!-- image --> | <div class="clip_frame grpelem" id="u8651"><!-- image --> | ||
− | < | + | <object type="application/x-shockwave-flash" height=300 width=400 data="https://static.igem.org/mediawiki/2015/6/6b/Mingdao-alllogo.swf" style="position:relative; left:-60px; top:-20px;"> |
+ | <param name="movie" value="https://static.igem.org/mediawiki/2015/6/6b/Mingdao-alllogo.swf" /> | ||
+ | <param name="quality" value="high" /> | ||
+ | <param name="" value="Exactfit"/> | ||
+ | <param name="wmode" value="transparent"> | ||
+ | </object> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 128: | Line 2,101: | ||
<nav class="MenuBar clearfix pinned-colelem" id="menuu6069"><!-- vertical box --> | <nav class="MenuBar clearfix pinned-colelem" id="menuu6069"><!-- vertical box --> | ||
<div class="MenuItemContainer clearfix colelem" id="u6140"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6140"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6143" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6143" href="Parts#gene"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6144-4"><!-- content --><p id="u6144-2">Gene 1</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6084"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6084"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6087" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6087" href="Parts#biobrick"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6090-4"><!-- content --><p id="u6090-2">BioBrick 2</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6196"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6196"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6197" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6197" href="Parts#sr-psb1c3"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6199-4"><!-- content --><p id="u6199-2">SR/pSB1C3 ●</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6105"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6105"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6108" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6108" href="Parts#srpk-psb1c3"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6110-4"><!-- content --><p id="u6110-2"> SRPK/pSB1C3 ●</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6235"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6235"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6236" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6236" href="Parts#gst-sr-psb1c3"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6239-4"><!-- content --><p id="u6239-2"> GST-SR/pSB1C3 ●</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6228"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6228"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6229" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6229" href="Parts#srpk-his-psb1c3"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6232-4"><!-- content --><p id="u6232-2"> SRPK-His/pSB1C3 ●</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6221"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6221"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6222" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6222" href="Parts#data"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6225-4"><!-- content --><p id="u6225-2"> DATA ●</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6133"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6133"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6136" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6136" href="Parts#vector"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6139-4"><!-- content --><p id="u6139-2">Vector 3</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6168"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6168"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6169" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6169" href="Parts#sr-pgex-2t"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6172-4"><!-- content --><p id="u6172-2">SR/pGEX-2T ●</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6175"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6175"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6176" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6176" href="Parts#srpk-pet-29b"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6179-4"><!-- content --><p id="u6179-2">SRPK/pET-29b ●</p></div></a> |
</div> | </div> | ||
<div class="MenuItemContainer clearfix colelem" id="u6154"><!-- horizontal box --> | <div class="MenuItemContainer clearfix colelem" id="u6154"><!-- horizontal box --> | ||
− | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6157" href=" | + | <a class="nonblock nontext MenuItem MenuItemWithSubMenu anim_swing rgba-background clearfix grpelem" id="u6157" href="Parts#data2"><!-- horizontal box --><div class="MenuItemLabel clearfix grpelem" id="u6158-4"><!-- content --><p id="u6158-2">DATA ●</p></div></a> |
− | </div> | + | </div> </nav> |
− | + | ||
<a class="anchor_item colelem" id="biobrick"></a> | <a class="anchor_item colelem" id="biobrick"></a> | ||
− | <img class="colelem" id="u4209-4" alt="BioBrick" width="398" height="110" src="https://static.igem.org/mediawiki/2015/ | + | <img class="colelem" id="u4209-4" alt="BioBrick" width="398" height="110" src="https://static.igem.org/mediawiki/2015/2/23/Mingdao-u4209-4.png"/><!-- rasterized frame --> |
<div class="clearfix colelem" id="u4210-4"><!-- content --> | <div class="clearfix colelem" id="u4210-4"><!-- content --> | ||
<p>We cloned the genes of SR and SRPK as well as the composite DNA fragments of Ptac-GST-SR and Pt7-SRPK-His onto the standard backbone of pSB1C3 biobrick.</p> | <p>We cloned the genes of SR and SRPK as well as the composite DNA fragments of Ptac-GST-SR and Pt7-SRPK-His onto the standard backbone of pSB1C3 biobrick.</p> | ||
Line 178: | Line 2,150: | ||
</div> | </div> | ||
<div class="clip_frame colelem" id="u4254"><!-- image --> | <div class="clip_frame colelem" id="u4254"><!-- image --> | ||
− | <img class="block" id="u4254_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4254_img" src="https://static.igem.org/mediawiki/2015/f/fe/Mingdao-t1-1.jpeg" alt="" width="1104" height="500"/> |
</div> | </div> | ||
<a class="anchor_item colelem" id="srpk-psb1c3"></a> | <a class="anchor_item colelem" id="srpk-psb1c3"></a> | ||
Line 193: | Line 2,165: | ||
</div> | </div> | ||
<div class="clip_frame colelem" id="u4260"><!-- image --> | <div class="clip_frame colelem" id="u4260"><!-- image --> | ||
− | <img class="block" id="u4260_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4260_img" src="https://static.igem.org/mediawiki/2015/6/6d/Mingdao-t1-2.jpeg" alt="" width="1026" height="651"/> |
</div> | </div> | ||
<div class="clearfix colelem" id="u4243-4"><!-- content --> | <div class="clearfix colelem" id="u4243-4"><!-- content --> | ||
Line 212: | Line 2,184: | ||
</div> | </div> | ||
<div class="clip_frame grpelem" id="u4266"><!-- image --> | <div class="clip_frame grpelem" id="u4266"><!-- image --> | ||
− | <img class="block" id="u4266_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4266_img" src="https://static.igem.org/mediawiki/2015/e/e9/Mingdao-t1-3.jpeg" alt="" width="996" height="617"/> |
</div> | </div> | ||
</div> | </div> | ||
Line 230: | Line 2,202: | ||
</div> | </div> | ||
<div class="clip_frame colelem" id="u4272"><!-- image --> | <div class="clip_frame colelem" id="u4272"><!-- image --> | ||
− | <img class="block" id="u4272_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4272_img" src="https://static.igem.org/mediawiki/2015/4/45/Mingdao-t1-4.jpeg" alt="" width="903" height="571"/> |
</div> | </div> | ||
<a class="anchor_item colelem" id="data"></a> | <a class="anchor_item colelem" id="data"></a> | ||
− | <img class="colelem" id="u4244-4" alt="Data" width="368" height="80" src="https://static.igem.org/mediawiki/2015/0/ | + | <img class="colelem" id="u4244-4" alt="Data" width="368" height="80" src="https://static.igem.org/mediawiki/2015/0/0f/Mingdao-u4244-4.png"/><!-- rasterized frame --> |
<div class="clearfix colelem" id="u4245-4"><!-- content --> | <div class="clearfix colelem" id="u4245-4"><!-- content --> | ||
<p>(1) PCR of SR, SRPK, Ptac-GST-SR and Pt7-SRPK-His</p> | <p>(1) PCR of SR, SRPK, Ptac-GST-SR and Pt7-SRPK-His</p> | ||
Line 240: | Line 2,212: | ||
<div class="clip_frame clearfix grpelem" id="u4278"><!-- image --> | <div class="clip_frame clearfix grpelem" id="u4278"><!-- image --> | ||
<div id="u4278_clip"> | <div id="u4278_clip"> | ||
− | <img class="position_content" id="u4278_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="position_content" id="u4278_img" src="https://static.igem.org/mediawiki/2015/f/f1/Mingdao-t1-5.jpeg" alt="" width="209" height="244"/> |
</div> | </div> | ||
</div> | </div> | ||
Line 258: | Line 2,230: | ||
<div class="clip_frame clearfix grpelem" id="u4284"><!-- image --> | <div class="clip_frame clearfix grpelem" id="u4284"><!-- image --> | ||
<div id="u4284_clip"> | <div id="u4284_clip"> | ||
− | <img class="position_content" id="u4284_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="position_content" id="u4284_img" src="https://static.igem.org/mediawiki/2015/1/12/Mingdao-t1-6.png" alt="" width="362" height="261"/> |
</div> | </div> | ||
</div> | </div> | ||
Line 282: | Line 2,254: | ||
<div class="clip_frame clearfix grpelem" id="u4290"><!-- image --> | <div class="clip_frame clearfix grpelem" id="u4290"><!-- image --> | ||
<div id="u4290_clip"> | <div id="u4290_clip"> | ||
− | <img class="position_content" id="u4290_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="position_content" id="u4290_img" src="https://static.igem.org/mediawiki/2015/8/87/Mingdao-t1-7.jpeg" alt="" width="161" height="283"/> |
</div> | </div> | ||
</div> | </div> | ||
<div class="clip_frame clearfix grpelem" id="u4296"><!-- image --> | <div class="clip_frame clearfix grpelem" id="u4296"><!-- image --> | ||
<div id="u4296_clip"> | <div id="u4296_clip"> | ||
− | <img class="position_content" id="u4296_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="position_content" id="u4296_img" src="https://static.igem.org/mediawiki/2015/c/c5/Mingdao-t1-8.jpeg" alt="" width="261" height="288"/> |
</div> | </div> | ||
</div> | </div> | ||
Line 303: | Line 2,275: | ||
<div class="clip_frame clearfix grpelem" id="u4305"><!-- image --> | <div class="clip_frame clearfix grpelem" id="u4305"><!-- image --> | ||
<div id="u4305_clip"> | <div id="u4305_clip"> | ||
− | <img class="position_content" id="u4305_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="position_content" id="u4305_img" src="https://static.igem.org/mediawiki/2015/a/a7/Mingdao-t1-9.jpeg" alt="" width="552" height="282"/> |
</div> | </div> | ||
</div> | </div> | ||
Line 318: | Line 2,290: | ||
<div class="clearfix colelem" id="pu4313"><!-- group --> | <div class="clearfix colelem" id="pu4313"><!-- group --> | ||
<div class="clip_frame grpelem" id="u4313"><!-- image --> | <div class="clip_frame grpelem" id="u4313"><!-- image --> | ||
− | <img class="block" id="u4313_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4313_img" src="https://static.igem.org/mediawiki/2015/f/fb/Mingdao-t1-10-crop-u4313.png" alt="" width="244" height="307"/> |
</div> | </div> | ||
<div class="clip_frame grpelem" id="u4319"><!-- image --> | <div class="clip_frame grpelem" id="u4319"><!-- image --> | ||
− | <img class="block" id="u4319_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4319_img" src="https://static.igem.org/mediawiki/2015/7/70/Mingdao-t1-11-crop-u4319.png" alt="" width="146" height="308"/> |
</div> | </div> | ||
<div class="clearfix grpelem" id="u4312-23"><!-- content --> | <div class="clearfix grpelem" id="u4312-23"><!-- content --> | ||
Line 342: | Line 2,314: | ||
<div class="clearfix colelem" id="pu4327"><!-- group --> | <div class="clearfix colelem" id="pu4327"><!-- group --> | ||
<div class="clip_frame grpelem" id="u4327"><!-- image --> | <div class="clip_frame grpelem" id="u4327"><!-- image --> | ||
− | <img class="block" id="u4327_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4327_img" src="https://static.igem.org/mediawiki/2015/7/75/Mingdao-t1-12-crop-u4327.png" alt="" width="193" height="254"/> |
</div> | </div> | ||
<div class="clearfix grpelem" id="u4326-12"><!-- content --> | <div class="clearfix grpelem" id="u4326-12"><!-- content --> | ||
Line 365: | Line 2,337: | ||
</div> | </div> | ||
<a class="anchor_item colelem" id="vector"></a> | <a class="anchor_item colelem" id="vector"></a> | ||
− | <img class="colelem" id="u4335-4" alt="Vector" width="398" height="110" src="https://static.igem.org/mediawiki/2015/ | + | <img class="colelem" id="u4335-4" alt="Vector" width="398" height="110" src="https://static.igem.org/mediawiki/2015/1/13/Mingdao-u4335-4.png"/><!-- rasterized frame --> |
<div class="clearfix colelem" id="u4336-4"><!-- content --> | <div class="clearfix colelem" id="u4336-4"><!-- content --> | ||
<p>In order to express proteins abundantly and efficiently, we transferred the genes of SR and SRPK into two commercial expression vectors of pGEX-2T and pET-29b, respectively.</p> | <p>In order to express proteins abundantly and efficiently, we transferred the genes of SR and SRPK into two commercial expression vectors of pGEX-2T and pET-29b, respectively.</p> | ||
Line 377: | Line 2,349: | ||
</div> | </div> | ||
<div class="clip_frame colelem" id="u4338"><!-- image --> | <div class="clip_frame colelem" id="u4338"><!-- image --> | ||
− | <img class="block" id="u4338_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4338_img" src="https://static.igem.org/mediawiki/2015/2/24/Mingdao-t1-13.jpeg" alt="" width="489" height="395"/> |
</div> | </div> | ||
<a class="anchor_item colelem" id="srpk-pet-29b"></a> | <a class="anchor_item colelem" id="srpk-pet-29b"></a> | ||
Line 386: | Line 2,358: | ||
</div> | </div> | ||
<div class="clip_frame colelem" id="u4345"><!-- image --> | <div class="clip_frame colelem" id="u4345"><!-- image --> | ||
− | <img class="block" id="u4345_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4345_img" src="https://static.igem.org/mediawiki/2015/7/7b/Mingdao-t1-14.jpeg" alt="" width="498" height="395"/> |
</div> | </div> | ||
<a class="anchor_item colelem" id="data2"></a> | <a class="anchor_item colelem" id="data2"></a> | ||
Line 404: | Line 2,376: | ||
<div class="clearfix colelem" id="pu4354"><!-- group --> | <div class="clearfix colelem" id="pu4354"><!-- group --> | ||
<div class="clip_frame grpelem" id="u4354"><!-- image --> | <div class="clip_frame grpelem" id="u4354"><!-- image --> | ||
− | <img class="block" id="u4354_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4354_img" src="https://static.igem.org/mediawiki/2015/8/8c/Mingdao-t1-15.jpeg" alt="" width="266" height="364"/> |
</div> | </div> | ||
<div class="clearfix grpelem" id="u4360-16"><!-- content --> | <div class="clearfix grpelem" id="u4360-16"><!-- content --> | ||
Line 425: | Line 2,397: | ||
<div class="clearfix colelem" id="pu4366"><!-- group --> | <div class="clearfix colelem" id="pu4366"><!-- group --> | ||
<div class="clip_frame grpelem" id="u4366"><!-- image --> | <div class="clip_frame grpelem" id="u4366"><!-- image --> | ||
− | <img class="block" id="u4366_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4366_img" src="https://static.igem.org/mediawiki/2015/2/2f/Mingdao-t1-16.png" alt="" width="325" height="365"/> |
</div> | </div> | ||
<img class="grpelem" id="u4364-27" alt="Procedure: | <img class="grpelem" id="u4364-27" alt="Procedure: | ||
Line 435: | Line 2,407: | ||
4. P-SR: SR/pGEX-2T & SRPK1/pET-29b Result: | 4. P-SR: SR/pGEX-2T & SRPK1/pET-29b Result: | ||
SRPK-His was detected by anti-His antibody at the expected size of 93 kDa, as shown in the lanes 3 & 4. | SRPK-His was detected by anti-His antibody at the expected size of 93 kDa, as shown in the lanes 3 & 4. | ||
− | " width="481" height="353" src="https://static.igem.org/mediawiki/2015/ | + | " width="481" height="353" src="https://static.igem.org/mediawiki/2015/7/71/Mingdao-u4364-27.png"/><!-- rasterized frame --> |
</div> | </div> | ||
<div class="clearfix colelem" id="u4372-4"><!-- content --> | <div class="clearfix colelem" id="u4372-4"><!-- content --> | ||
Line 442: | Line 2,414: | ||
<div class="clearfix colelem" id="pu4374"><!-- group --> | <div class="clearfix colelem" id="pu4374"><!-- group --> | ||
<div class="clip_frame grpelem" id="u4374"><!-- image --> | <div class="clip_frame grpelem" id="u4374"><!-- image --> | ||
− | <img class="block" id="u4374_img" src="https://static.igem.org/mediawiki/2015/ | + | <img class="block" id="u4374_img" src="https://static.igem.org/mediawiki/2015/2/2f/Mingdao-t1-16.png" alt="" width="325" height="365"/> |
</div> | </div> | ||
<img class="grpelem" id="u4373-22" alt="Procedure: | <img class="grpelem" id="u4373-22" alt="Procedure: | ||
Line 451: | Line 2,423: | ||
2. SR: SR/pGEX-2T & pET-29b 3. SRPK: pGEX-2T & SRPK1/pET-29b | 2. SR: SR/pGEX-2T & pET-29b 3. SRPK: pGEX-2T & SRPK1/pET-29b | ||
4. P-SR: SR/pGEX-2T & SRPK1/pET-29b | 4. P-SR: SR/pGEX-2T & SRPK1/pET-29b | ||
− | " width="481" height="257" src="https://static.igem.org/mediawiki/2015/ | + | " width="481" height="257" src="https://static.igem.org/mediawiki/2015/4/4d/Mingdao-u4373-22.png"/><!-- rasterized frame --> |
</div> | </div> | ||
<div class="clearfix colelem" id="u4377-12"><!-- content --> | <div class="clearfix colelem" id="u4377-12"><!-- content --> | ||
Line 464: | Line 2,436: | ||
</div> | </div> | ||
</div> | </div> | ||
+ | </div> | ||
<!-- JS includes --> | <!-- JS includes --> | ||
− | + | <script type="text/javascript"> | |
if (document.location.protocol != 'https:') document.write('\x3Cscript src="http://musecdn.businesscatalyst.com/scripts/4.0/jquery-1.8.3.min.js" type="text/javascript">\x3C/script>'); | if (document.location.protocol != 'https:') document.write('\x3Cscript src="http://musecdn.businesscatalyst.com/scripts/4.0/jquery-1.8.3.min.js" type="text/javascript">\x3C/script>'); | ||
+ | </script> | ||
+ | <script> | ||
+ | /*! jQuery v1.8.3 jquery.com | jquery.org/license */ | ||
+ | (function(e,t){function _(e){var t=M[e]={};return v.each(e.split(y),function(e,n){t[n]=!0}),t}function H(e,n,r){if(r===t&&e.nodeType===1){var i="data-"+n.replace(P,"-$1").toLowerCase();r=e.getAttribute(i);if(typeof r=="string"){try{r=r==="true"?!0:r==="false"?!1:r==="null"?null:+r+""===r?+r:D.test(r)?v.parseJSON(r):r}catch(s){}v.data(e,n,r)}else r=t}return r}function B(e){var t;for(t in e){if(t==="data"&&v.isEmptyObject(e[t]))continue;if(t!=="toJSON")return!1}return!0}function et(){return!1}function tt(){return!0}function ut(e){return!e||!e.parentNode||e.parentNode.nodeType===11}function at(e,t){do e=e[t];while(e&&e.nodeType!==1);return e}function ft(e,t,n){t=t||0;if(v.isFunction(t))return v.grep(e,function(e,r){var i=!!t.call(e,r,e);return i===n});if(t.nodeType)return v.grep(e,function(e,r){return e===t===n});if(typeof t=="string"){var r=v.grep(e,function(e){return e.nodeType===1});if(it.test(t))return v.filter(t,r,!n);t=v.filter(t,r)}return v.grep(e,function(e,r){return v.inArray(e,t)>=0===n})}function lt(e){var t=ct.split("|"),n=e.createDocumentFragment();if(n.createElement)while(t.length)n.createElement(t.pop());return n}function Lt(e,t){return e.getElementsByTagName(t)[0]||e.appendChild(e.ownerDocument.createElement(t))}function At(e,t){if(t.nodeType!==1||!v.hasData(e))return;var n,r,i,s=v._data(e),o=v._data(t,s),u=s.events;if(u){delete o.handle,o.events={};for(n in u)for(r=0,i=u[n].length;r<i;r++)v.event.add(t,n,u[n][r])}o.data&&(o.data=v.extend({},o.data))}function Ot(e,t){var n;if(t.nodeType!==1)return;t.clearAttributes&&t.clearAttributes(),t.mergeAttributes&&t.mergeAttributes(e),n=t.nodeName.toLowerCase(),n==="object"?(t.parentNode&&(t.outerHTML=e.outerHTML),v.support.html5Clone&&e.innerHTML&&!v.trim(t.innerHTML)&&(t.innerHTML=e.innerHTML)):n==="input"&&Et.test(e.type)?(t.defaultChecked=t.checked=e.checked,t.value!==e.value&&(t.value=e.value)):n==="option"?t.selected=e.defaultSelected:n==="input"||n==="textarea"?t.defaultValue=e.defaultValue:n==="script"&&t.text!==e.text&&(t.text=e.text),t.removeAttribute(v.expando)}function Mt(e){return typeof e.getElementsByTagName!="undefined"?e.getElementsByTagName("*"):typeof e.querySelectorAll!="undefined"?e.querySelectorAll("*"):[]}function _t(e){Et.test(e.type)&&(e.defaultChecked=e.checked)}function Qt(e,t){if(t in e)return t;var n=t.charAt(0).toUpperCase()+t.slice(1),r=t,i=Jt.length;while(i--){t=Jt[i]+n;if(t in e)return t}return r}function Gt(e,t){return e=t||e,v.css(e,"display")==="none"||!v.contains(e.ownerDocument,e)}function Yt(e,t){var n,r,i=[],s=0,o=e.length;for(;s<o;s++){n=e[s];if(!n.style)continue;i[s]=v._data(n,"olddisplay"),t?(!i[s]&&n.style.display==="none"&&(n.style.display=""),n.style.display===""&&Gt(n)&&(i[s]=v._data(n,"olddisplay",nn(n.nodeName)))):(r=Dt(n,"display"),!i[s]&&r!=="none"&&v._data(n,"olddisplay",r))}for(s=0;s<o;s++){n=e[s];if(!n.style)continue;if(!t||n.style.display==="none"||n.style.display==="")n.style.display=t?i[s]||"":"none"}return e}function Zt(e,t,n){var r=Rt.exec(t);return r?Math.max(0,r[1]-(n||0))+(r[2]||"px"):t}function en(e,t,n,r){var i=n===(r?"border":"content")?4:t==="width"?1:0,s=0;for(;i<4;i+=2)n==="margin"&&(s+=v.css(e,n+$t[i],!0)),r?(n==="content"&&(s-=parseFloat(Dt(e,"padding"+$t[i]))||0),n!=="margin"&&(s-=parseFloat(Dt(e,"border"+$t[i]+"Width"))||0)):(s+=parseFloat(Dt(e,"padding"+$t[i]))||0,n!=="padding"&&(s+=parseFloat(Dt(e,"border"+$t[i]+"Width"))||0));return s}function tn(e,t,n){var r=t==="width"?e.offsetWidth:e.offsetHeight,i=!0,s=v.support.boxSizing&&v.css(e,"boxSizing")==="border-box";if(r<=0||r==null){r=Dt(e,t);if(r<0||r==null)r=e.style[t];if(Ut.test(r))return r;i=s&&(v.support.boxSizingReliable||r===e.style[t]),r=parseFloat(r)||0}return r+en(e,t,n||(s?"border":"content"),i)+"px"}function nn(e){if(Wt[e])return Wt[e];var t=v("<"+e+">").appendTo(i.body),n=t.css("display");t.remove();if(n==="none"||n===""){Pt=i.body.appendChild(Pt||v.extend(i.createElement("iframe"),{frameBorder:0,width:0,height:0}));if(!Ht||!Pt.createElement)Ht=(Pt.contentWindow||Pt.contentDocument).document,Ht.write("<!doctype html><html><body>"),Ht.close();t=Ht.body.appendChild(Ht.createElement(e)),n=Dt(t,"display"),i.body.removeChild(Pt)}return Wt[e]=n,n}function fn(e,t,n,r){var i;if(v.isArray(t))v.each(t,function(t,i){n||sn.test(e)?r(e,i):fn(e+"["+(typeof i=="object"?t:"")+"]",i,n,r)});else if(!n&&v.type(t)==="object")for(i in t)fn(e+"["+i+"]",t[i],n,r);else r(e,t)}function Cn(e){return function(t,n){typeof t!="string"&&(n=t,t="*");var r,i,s,o=t.toLowerCase().split(y),u=0,a=o.length;if(v.isFunction(n))for(;u<a;u++)r=o[u],s=/^\+/.test(r),s&&(r=r.substr(1)||"*"),i=e[r]=e[r]||[],i[s?"unshift":"push"](n)}}function kn(e,n,r,i,s,o){s=s||n.dataTypes[0],o=o||{},o[s]=!0;var u,a=e[s],f=0,l=a?a.length:0,c=e===Sn;for(;f<l&&(c||!u);f++)u=a[f](n,r,i),typeof u=="string"&&(!c||o[u]?u=t:(n.dataTypes.unshift(u),u=kn(e,n,r,i,u,o)));return(c||!u)&&!o["*"]&&(u=kn(e,n,r,i,"*",o)),u}function Ln(e,n){var r,i,s=v.ajaxSettings.flatOptions||{};for(r in n)n[r]!==t&&((s[r]?e:i||(i={}))[r]=n[r]);i&&v.extend(!0,e,i)}function An(e,n,r){var i,s,o,u,a=e.contents,f=e.dataTypes,l=e.responseFields;for(s in l)s in r&&(n[l[s]]=r[s]);while(f[0]==="*")f.shift(),i===t&&(i=e.mimeType||n.getResponseHeader("content-type"));if(i)for(s in a)if(a[s]&&a[s].test(i)){f.unshift(s);break}if(f[0]in r)o=f[0];else{for(s in r){if(!f[0]||e.converters[s+" "+f[0]]){o=s;break}u||(u=s)}o=o||u}if(o)return o!==f[0]&&f.unshift(o),r[o]}function On(e,t){var n,r,i,s,o=e.dataTypes.slice(),u=o[0],a={},f=0;e.dataFilter&&(t=e.dataFilter(t,e.dataType));if(o[1])for(n in e.converters)a[n.toLowerCase()]=e.converters[n];for(;i=o[++f];)if(i!=="*"){if(u!=="*"&&u!==i){n=a[u+" "+i]||a["* "+i];if(!n)for(r in a){s=r.split(" ");if(s[1]===i){n=a[u+" "+s[0]]||a["* "+s[0]];if(n){n===!0?n=a[r]:a[r]!==!0&&(i=s[0],o.splice(f--,0,i));break}}}if(n!==!0)if(n&&e["throws"])t=n(t);else try{t=n(t)}catch(l){return{state:"parsererror",error:n?l:"No conversion from "+u+" to "+i}}}u=i}return{state:"success",data:t}}function Fn(){try{return new e.XMLHttpRequest}catch(t){}}function In(){try{return new e.ActiveXObject("Microsoft.XMLHTTP")}catch(t){}}function $n(){return setTimeout(function(){qn=t},0),qn=v.now()}function Jn(e,t){v.each(t,function(t,n){var r=(Vn[t]||[]).concat(Vn["*"]),i=0,s=r.length;for(;i<s;i++)if(r[i].call(e,t,n))return})}function Kn(e,t,n){var r,i=0,s=0,o=Xn.length,u=v.Deferred().always(function(){delete a.elem}),a=function(){var t=qn||$n(),n=Math.max(0,f.startTime+f.duration-t),r=n/f.duration||0,i=1-r,s=0,o=f.tweens.length;for(;s<o;s++)f.tweens[s].run(i);return u.notifyWith(e,[f,i,n]),i<1&&o?n:(u.resolveWith(e,[f]),!1)},f=u.promise({elem:e,props:v.extend({},t),opts:v.extend(!0,{specialEasing:{}},n),originalProperties:t,originalOptions:n,startTime:qn||$n(),duration:n.duration,tweens:[],createTween:function(t,n,r){var i=v.Tween(e,f.opts,t,n,f.opts.specialEasing[t]||f.opts.easing);return f.tweens.push(i),i},stop:function(t){var n=0,r=t?f.tweens.length:0;for(;n<r;n++)f.tweens[n].run(1);return t?u.resolveWith(e,[f,t]):u.rejectWith(e,[f,t]),this}}),l=f.props;Qn(l,f.opts.specialEasing);for(;i<o;i++){r=Xn[i].call(f,e,l,f.opts);if(r)return r}return Jn(f,l),v.isFunction(f.opts.start)&&f.opts.start.call(e,f),v.fx.timer(v.extend(a,{anim:f,queue:f.opts.queue,elem:e})),f.progress(f.opts.progress).done(f.opts.done,f.opts.complete).fail(f.opts.fail).always(f.opts.always)}function Qn(e,t){var n,r,i,s,o;for(n in e){r=v.camelCase(n),i=t[r],s=e[n],v.isArray(s)&&(i=s[1],s=e[n]=s[0]),n!==r&&(e[r]=s,delete e[n]),o=v.cssHooks[r];if(o&&"expand"in o){s=o.expand(s),delete e[r];for(n in s)n in e||(e[n]=s[n],t[n]=i)}else t[r]=i}}function Gn(e,t,n){var r,i,s,o,u,a,f,l,c,h=this,p=e.style,d={},m=[],g=e.nodeType&&Gt(e);n.queue||(l=v._queueHooks(e,"fx"),l.unqueued==null&&(l.unqueued=0,c=l.empty.fire,l.empty.fire=function(){l.unqueued||c()}),l.unqueued++,h.always(function(){h.always(function(){l.unqueued--,v.queue(e,"fx").length||l.empty.fire()})})),e.nodeType===1&&("height"in t||"width"in t)&&(n.overflow=[p.overflow,p.overflowX,p.overflowY],v.css(e,"display")==="inline"&&v.css(e,"float")==="none"&&(!v.support.inlineBlockNeedsLayout||nn(e.nodeName)==="inline"?p.display="inline-block":p.zoom=1)),n.overflow&&(p.overflow="hidden",v.support.shrinkWrapBlocks||h.done(function(){p.overflow=n.overflow[0],p.overflowX=n.overflow[1],p.overflowY=n.overflow[2]}));for(r in t){s=t[r];if(Un.exec(s)){delete t[r],a=a||s==="toggle";if(s===(g?"hide":"show"))continue;m.push(r)}}o=m.length;if(o){u=v._data(e,"fxshow")||v._data(e,"fxshow",{}),"hidden"in u&&(g=u.hidden),a&&(u.hidden=!g),g?v(e).show():h.done(function(){v(e).hide()}),h.done(function(){var t;v.removeData(e,"fxshow",!0);for(t in d)v.style(e,t,d[t])});for(r=0;r<o;r++)i=m[r],f=h.createTween(i,g?u[i]:0),d[i]=u[i]||v.style(e,i),i in u||(u[i]=f.start,g&&(f.end=f.start,f.start=i==="width"||i==="height"?1:0))}}function Yn(e,t,n,r,i){return new Yn.prototype.init(e,t,n,r,i)}function Zn(e,t){var n,r={height:e},i=0;t=t?1:0;for(;i<4;i+=2-t)n=$t[i],r["margin"+n]=r["padding"+n]=e;return t&&(r.opacity=r.width=e),r}function tr(e){return v.isWindow(e)?e:e.nodeType===9?e.defaultView||e.parentWindow:!1}var n,r,i=e.document,s=e.location,o=e.navigator,u=e.jQuery,a=e.$,f=Array.prototype.push,l=Array.prototype.slice,c=Array.prototype.indexOf,h=Object.prototype.toString,p=Object.prototype.hasOwnProperty,d=String.prototype.trim,v=function(e,t){return new v.fn.init(e,t,n)},m=/[\-+]?(?:\d*\.|)\d+(?:[eE][\-+]?\d+|)/.source,g=/\S/,y=/\s+/,b=/^[\s\uFEFF\xA0]+|[\s\uFEFF\xA0]+$/g,w=/^(?:[^#<]*(<[\w\W]+>)[^>]*$|#([\w\-]*)$)/,E=/^<(\w+)\s*\/?>(?:<\/\1>|)$/,S=/^[\],:{}\s]*$/,x=/(?:^|:|,)(?:\s*\[)+/g,T=/\\(?:["\\\/bfnrt]|u[\da-fA-F]{4})/g,N=/"[^"\\\r\n]*"|true|false|null|-?(?:\d\d*\.|)\d+(?:[eE][\-+]?\d+|)/g,C=/^-ms-/,k=/-([\da-z])/gi,L=function(e,t){return(t+"").toUpperCase()},A=function(){i.addEventListener?(i.removeEventListener("DOMContentLoaded",A,!1),v.ready()):i.readyState==="complete"&&(i.detachEvent("onreadystatechange",A),v.ready())},O={};v.fn=v.prototype={constructor:v,init:function(e,n,r){var s,o,u,a;if(!e)return this;if(e.nodeType)return this.context=this[0]=e,this.length=1,this;if(typeof e=="string"){e.charAt(0)==="<"&&e.charAt(e.length-1)===">"&&e.length>=3?s=[null,e,null]:s=w.exec(e);if(s&&(s[1]||!n)){if(s[1])return n=n instanceof v?n[0]:n,a=n&&n.nodeType?n.ownerDocument||n:i,e=v.parseHTML(s[1],a,!0),E.test(s[1])&&v.isPlainObject(n)&&this.attr.call(e,n,!0),v.merge(this,e);o=i.getElementById(s[2]);if(o&&o.parentNode){if(o.id!==s[2])return r.find(e);this.length=1,this[0]=o}return this.context=i,this.selector=e,this}return!n||n.jquery?(n||r).find(e):this.constructor(n).find(e)}return v.isFunction(e)?r.ready(e):(e.selector!==t&&(this.selector=e.selector,this.context=e.context),v.makeArray(e,this))},selector:"",jquery:"1.8.3",length:0,size:function(){return this.length},toArray:function(){return l.call(this)},get:function(e){return e==null?this.toArray():e<0?this[this.length+e]:this[e]},pushStack:function(e,t,n){var r=v.merge(this.constructor(),e);return r.prevObject=this,r.context=this.context,t==="find"?r.selector=this.selector+(this.selector?" ":"")+n:t&&(r.selector=this.selector+"."+t+"("+n+")"),r},each:function(e,t){return v.each(this,e,t)},ready:function(e){return v.ready.promise().done(e),this},eq:function(e){return e=+e,e===-1?this.slice(e):this.slice(e,e+1)},first:function(){return this.eq(0)},last:function(){return this.eq(-1)},slice:function(){return this.pushStack(l.apply(this,arguments),"slice",l.call(arguments).join(","))},map:function(e){return this.pushStack(v.map(this,function(t,n){return e.call(t,n,t)}))},end:function(){return this.prevObject||this.constructor(null)},push:f,sort:[].sort,splice:[].splice},v.fn.init.prototype=v.fn,v.extend=v.fn.extend=function(){var e,n,r,i,s,o,u=arguments[0]||{},a=1,f=arguments.length,l=!1;typeof u=="boolean"&&(l=u,u=arguments[1]||{},a=2),typeof u!="object"&&!v.isFunction(u)&&(u={}),f===a&&(u=this,--a);for(;a<f;a++)if((e=arguments[a])!=null)for(n in e){r=u[n],i=e[n];if(u===i)continue;l&&i&&(v.isPlainObject(i)||(s=v.isArray(i)))?(s?(s=!1,o=r&&v.isArray(r)?r:[]):o=r&&v.isPlainObject(r)?r:{},u[n]=v.extend(l,o,i)):i!==t&&(u[n]=i)}return u},v.extend({noConflict:function(t){return e.$===v&&(e.$=a),t&&e.jQuery===v&&(e.jQuery=u),v},isReady:!1,readyWait:1,holdReady:function(e){e?v.readyWait++:v.ready(!0)},ready:function(e){if(e===!0?--v.readyWait:v.isReady)return;if(!i.body)return setTimeout(v.ready,1);v.isReady=!0;if(e!==!0&&--v.readyWait>0)return;r.resolveWith(i,[v]),v.fn.trigger&&v(i).trigger("ready").off("ready")},isFunction:function(e){return v.type(e)==="function"},isArray:Array.isArray||function(e){return v.type(e)==="array"},isWindow:function(e){return e!=null&&e==e.window},isNumeric:function(e){return!isNaN(parseFloat(e))&&isFinite(e)},type:function(e){return e==null?String(e):O[h.call(e)]||"object"},isPlainObject:function(e){if(!e||v.type(e)!=="object"||e.nodeType||v.isWindow(e))return!1;try{if(e.constructor&&!p.call(e,"constructor")&&!p.call(e.constructor.prototype,"isPrototypeOf"))return!1}catch(n){return!1}var r;for(r in e);return r===t||p.call(e,r)},isEmptyObject:function(e){var t;for(t in e)return!1;return!0},error:function(e){throw new Error(e)},parseHTML:function(e,t,n){var r;return!e||typeof e!="string"?null:(typeof t=="boolean"&&(n=t,t=0),t=t||i,(r=E.exec(e))?[t.createElement(r[1])]:(r=v.buildFragment([e],t,n?null:[]),v.merge([],(r.cacheable?v.clone(r.fragment):r.fragment).childNodes)))},parseJSON:function(t){if(!t||typeof t!="string")return null;t=v.trim(t);if(e.JSON&&e.JSON.parse)return e.JSON.parse(t);if(S.test(t.replace(T,"@").replace(N,"]").replace(x,"")))return(new Function("return "+t))();v.error("Invalid JSON: "+t)},parseXML:function(n){var r,i;if(!n||typeof n!="string")return null;try{e.DOMParser?(i=new DOMParser,r=i.parseFromString(n,"text/xml")):(r=new ActiveXObject("Microsoft.XMLDOM"),r.async="false",r.loadXML(n))}catch(s){r=t}return(!r||!r.documentElement||r.getElementsByTagName("parsererror").length)&&v.error("Invalid XML: "+n),r},noop:function(){},globalEval:function(t){t&&g.test(t)&&(e.execScript||function(t){e.eval.call(e,t)})(t)},camelCase:function(e){return e.replace(C,"ms-").replace(k,L)},nodeName:function(e,t){return e.nodeName&&e.nodeName.toLowerCase()===t.toLowerCase()},each:function(e,n,r){var i,s=0,o=e.length,u=o===t||v.isFunction(e);if(r){if(u){for(i in e)if(n.apply(e[i],r)===!1)break}else for(;s<o;)if(n.apply(e[s++],r)===!1)break}else if(u){for(i in e)if(n.call(e[i],i,e[i])===!1)break}else for(;s<o;)if(n.call(e[s],s,e[s++])===!1)break;return e},trim:d&&!d.call("\ufeff\u00a0")?function(e){return e==null?"":d.call(e)}:function(e){return e==null?"":(e+"").replace(b,"")},makeArray:function(e,t){var n,r=t||[];return e!=null&&(n=v.type(e),e.length==null||n==="string"||n==="function"||n==="regexp"||v.isWindow(e)?f.call(r,e):v.merge(r,e)),r},inArray:function(e,t,n){var r;if(t){if(c)return c.call(t,e,n);r=t.length,n=n?n<0?Math.max(0,r+n):n:0;for(;n<r;n++)if(n in t&&t[n]===e)return n}return-1},merge:function(e,n){var r=n.length,i=e.length,s=0;if(typeof r=="number")for(;s<r;s++)e[i++]=n[s];else while(n[s]!==t)e[i++]=n[s++];return e.length=i,e},grep:function(e,t,n){var r,i=[],s=0,o=e.length;n=!!n;for(;s<o;s++)r=!!t(e[s],s),n!==r&&i.push(e[s]);return i},map:function(e,n,r){var i,s,o=[],u=0,a=e.length,f=e instanceof v||a!==t&&typeof a=="number"&&(a>0&&e[0]&&e[a-1]||a===0||v.isArray(e));if(f)for(;u<a;u++)i=n(e[u],u,r),i!=null&&(o[o.length]=i);else for(s in e)i=n(e[s],s,r),i!=null&&(o[o.length]=i);return o.concat.apply([],o)},guid:1,proxy:function(e,n){var r,i,s;return typeof n=="string"&&(r=e[n],n=e,e=r),v.isFunction(e)?(i=l.call(arguments,2),s=function(){return e.apply(n,i.concat(l.call(arguments)))},s.guid=e.guid=e.guid||v.guid++,s):t},access:function(e,n,r,i,s,o,u){var a,f=r==null,l=0,c=e.length;if(r&&typeof r=="object"){for(l in r)v.access(e,n,l,r[l],1,o,i);s=1}else if(i!==t){a=u===t&&v.isFunction(i),f&&(a?(a=n,n=function(e,t,n){return a.call(v(e),n)}):(n.call(e,i),n=null));if(n)for(;l<c;l++)n(e[l],r,a?i.call(e[l],l,n(e[l],r)):i,u);s=1}return s?e:f?n.call(e):c?n(e[0],r):o},now:function(){return(new Date).getTime()}}),v.ready.promise=function(t){if(!r){r=v.Deferred();if(i.readyState==="complete")setTimeout(v.ready,1);else if(i.addEventListener)i.addEventListener("DOMContentLoaded",A,!1),e.addEventListener("load",v.ready,!1);else{i.attachEvent("onreadystatechange",A),e.attachEvent("onload",v.ready);var n=!1;try{n=e.frameElement==null&&i.documentElement}catch(s){}n&&n.doScroll&&function o(){if(!v.isReady){try{n.doScroll("left")}catch(e){return setTimeout(o,50)}v.ready()}}()}}return r.promise(t)},v.each("Boolean Number String Function Array Date RegExp Object".split(" "),function(e,t){O["[object "+t+"]"]=t.toLowerCase()}),n=v(i);var M={};v.Callbacks=function(e){e=typeof e=="string"?M[e]||_(e):v.extend({},e);var n,r,i,s,o,u,a=[],f=!e.once&&[],l=function(t){n=e.memory&&t,r=!0,u=s||0,s=0,o=a.length,i=!0;for(;a&&u<o;u++)if(a[u].apply(t[0],t[1])===!1&&e.stopOnFalse){n=!1;break}i=!1,a&&(f?f.length&&l(f.shift()):n?a=[]:c.disable())},c={add:function(){if(a){var t=a.length;(function r(t){v.each(t,function(t,n){var i=v.type(n);i==="function"?(!e.unique||!c.has(n))&&a.push(n):n&&n.length&&i!=="string"&&r(n)})})(arguments),i?o=a.length:n&&(s=t,l(n))}return this},remove:function(){return a&&v.each(arguments,function(e,t){var n;while((n=v.inArray(t,a,n))>-1)a.splice(n,1),i&&(n<=o&&o--,n<=u&&u--)}),this},has:function(e){return v.inArray(e,a)>-1},empty:function(){return a=[],this},disable:function(){return a=f=n=t,this},disabled:function(){return!a},lock:function(){return f=t,n||c.disable(),this},locked:function(){return!f},fireWith:function(e,t){return t=t||[],t=[e,t.slice?t.slice():t],a&&(!r||f)&&(i?f.push(t):l(t)),this},fire:function(){return c.fireWith(this,arguments),this},fired:function(){return!!r}};return c},v.extend({Deferred:function(e){var t=[["resolve","done",v.Callbacks("once memory"),"resolved"],["reject","fail",v.Callbacks("once memory"),"rejected"],["notify","progress",v.Callbacks("memory")]],n="pending",r={state:function(){return n},always:function(){return i.done(arguments).fail(arguments),this},then:function(){var e=arguments;return v.Deferred(function(n){v.each(t,function(t,r){var s=r[0],o=e[t];i[r[1]](v.isFunction(o)?function(){var e=o.apply(this,arguments);e&&v.isFunction(e.promise)?e.promise().done(n.resolve).fail(n.reject).progress(n.notify):n[s+"With"](this===i?n:this,[e])}:n[s])}),e=null}).promise()},promise:function(e){return e!=null?v.extend(e,r):r}},i={};return r.pipe=r.then,v.each(t,function(e,s){var o=s[2],u=s[3];r[s[1]]=o.add,u&&o.add(function(){n=u},t[e^1][2].disable,t[2][2].lock),i[s[0]]=o.fire,i[s[0]+"With"]=o.fireWith}),r.promise(i),e&&e.call(i,i),i},when:function(e){var t=0,n=l.call(arguments),r=n.length,i=r!==1||e&&v.isFunction(e.promise)?r:0,s=i===1?e:v.Deferred(),o=function(e,t,n){return function(r){t[e]=this,n[e]=arguments.length>1?l.call(arguments):r,n===u?s.notifyWith(t,n):--i||s.resolveWith(t,n)}},u,a,f;if(r>1){u=new Array(r),a=new Array(r),f=new Array(r);for(;t<r;t++)n[t]&&v.isFunction(n[t].promise)?n[t].promise().done(o(t,f,n)).fail(s.reject).progress(o(t,a,u)):--i}return i||s.resolveWith(f,n),s.promise()}}),v.support=function(){var t,n,r,s,o,u,a,f,l,c,h,p=i.createElement("div");p.setAttribute("className","t"),p.innerHTML=" <link/><table></table><a href='/a'>a</a><input type='checkbox'/>",n=p.getElementsByTagName("*"),r=p.getElementsByTagName("a")[0];if(!n||!r||!n.length)return{};s=i.createElement("select"),o=s.appendChild(i.createElement("option")),u=p.getElementsByTagName("input")[0],r.style.cssText="top:1px;float:left;opacity:.5",t={leadingWhitespace:p.firstChild.nodeType===3,tbody:!p.getElementsByTagName("tbody").length,htmlSerialize:!!p.getElementsByTagName("link").length,style:/top/.test(r.getAttribute("style")),hrefNormalized:r.getAttribute("href")==="/a",opacity:/^0.5/.test(r.style.opacity),cssFloat:!!r.style.cssFloat,checkOn:u.value==="on",optSelected:o.selected,getSetAttribute:p.className!=="t",enctype:!!i.createElement("form").enctype,html5Clone:i.createElement("nav").cloneNode(!0).outerHTML!=="<:nav></:nav>",boxModel:i.compatMode==="CSS1Compat",submitBubbles:!0,changeBubbles:!0,focusinBubbles:!1,deleteExpando:!0,noCloneEvent:!0,inlineBlockNeedsLayout:!1,shrinkWrapBlocks:!1,reliableMarginRight:!0,boxSizingReliable:!0,pixelPosition:!1},u.checked=!0,t.noCloneChecked=u.cloneNode(!0).checked,s.disabled=!0,t.optDisabled=!o.disabled;try{delete p.test}catch(d){t.deleteExpando=!1}!p.addEventListener&&p.attachEvent&&p.fireEvent&&(p.attachEvent("onclick",h=function(){t.noCloneEvent=!1}),p.cloneNode(!0).fireEvent("onclick"),p.detachEvent("onclick",h)),u=i.createElement("input"),u.value="t",u.setAttribute("type","radio"),t.radioValue=u.value==="t",u.setAttribute("checked","checked"),u.setAttribute("name","t"),p.appendChild(u),a=i.createDocumentFragment(),a.appendChild(p.lastChild),t.checkClone=a.cloneNode(!0).cloneNode(!0).lastChild.checked,t.appendChecked=u.checked,a.removeChild(u),a.appendChild(p);if(p.attachEvent)for(l in{submit:!0,change:!0,focusin:!0})f="on"+l,c=f in p,c||(p.setAttribute(f,"return;"),c=typeof p[f]=="function"),t[l+"Bubbles"]=c;return v(function(){var n,r,s,o,u="padding:0;margin:0;border:0;display:block;overflow:hidden;",a=i.getElementsByTagName("body")[0];if(!a)return;n=i.createElement("div"),n.style.cssText="visibility:hidden;border:0;width:0;height:0;position:static;top:0;margin-top:1px",a.insertBefore(n,a.firstChild),r=i.createElement("div"),n.appendChild(r),r.innerHTML="<table><tr><td></td><td>t</td></tr></table>",s=r.getElementsByTagName("td"),s[0].style.cssText="padding:0;margin:0;border:0;display:none",c=s[0].offsetHeight===0,s[0].style.display="",s[1].style.display="none",t.reliableHiddenOffsets=c&&s[0].offsetHeight===0,r.innerHTML="",r.style.cssText="box-sizing:border-box;-moz-box-sizing:border-box;-webkit-box-sizing:border-box;padding:1px;border:1px;display:block;width:4px;margin-top:1%;position:absolute;top:1%;",t.boxSizing=r.offsetWidth===4,t.doesNotIncludeMarginInBodyOffset=a.offsetTop!==1,e.getComputedStyle&&(t.pixelPosition=(e.getComputedStyle(r,null)||{}).top!=="1%",t.boxSizingReliable=(e.getComputedStyle(r,null)||{width:"4px"}).width==="4px",o=i.createElement("div"),o.style.cssText=r.style.cssText=u,o.style.marginRight=o.style.width="0",r.style.width="1px",r.appendChild(o),t.reliableMarginRight=!parseFloat((e.getComputedStyle(o,null)||{}).marginRight)),typeof r.style.zoom!="undefined"&&(r.innerHTML="",r.style.cssText=u+"width:1px;padding:1px;display:inline;zoom:1",t.inlineBlockNeedsLayout=r.offsetWidth===3,r.style.display="block",r.style.overflow="visible",r.innerHTML="<div></div>",r.firstChild.style.width="5px",t.shrinkWrapBlocks=r.offsetWidth!==3,n.style.zoom=1),a.removeChild(n),n=r=s=o=null}),a.removeChild(p),n=r=s=o=u=a=p=null,t}();var D=/(?:\{[\s\S]*\}|\[[\s\S]*\])$/,P=/([A-Z])/g;v.extend({cache:{},deletedIds:[],uuid:0,expando:"jQuery"+(v.fn.jquery+Math.random()).replace(/\D/g,""),noData:{embed:!0,object:"clsid:D27CDB6E-AE6D-11cf-96B8-444553540000",applet:!0},hasData:function(e){return e=e.nodeType?v.cache[e[v.expando]]:e[v.expando],!!e&&!B(e)},data:function(e,n,r,i){if(!v.acceptData(e))return;var s,o,u=v.expando,a=typeof n=="string",f=e.nodeType,l=f?v.cache:e,c=f?e[u]:e[u]&&u;if((!c||!l[c]||!i&&!l[c].data)&&a&&r===t)return;c||(f?e[u]=c=v.deletedIds.pop()||v.guid++:c=u),l[c]||(l[c]={},f||(l[c].toJSON=v.noop));if(typeof n=="object"||typeof n=="function")i?l[c]=v.extend(l[c],n):l[c].data=v.extend(l[c].data,n);return s=l[c],i||(s.data||(s.data={}),s=s.data),r!==t&&(s[v.camelCase(n)]=r),a?(o=s[n],o==null&&(o=s[v.camelCase(n)])):o=s,o},removeData:function(e,t,n){if(!v.acceptData(e))return;var r,i,s,o=e.nodeType,u=o?v.cache:e,a=o?e[v.expando]:v.expando;if(!u[a])return;if(t){r=n?u[a]:u[a].data;if(r){v.isArray(t)||(t in r?t=[t]:(t=v.camelCase(t),t in r?t=[t]:t=t.split(" ")));for(i=0,s=t.length;i<s;i++)delete r[t[i]];if(!(n?B:v.isEmptyObject)(r))return}}if(!n){delete u[a].data;if(!B(u[a]))return}o?v.cleanData([e],!0):v.support.deleteExpando||u!=u.window?delete u[a]:u[a]=null},_data:function(e,t,n){return v.data(e,t,n,!0)},acceptData:function(e){var t=e.nodeName&&v.noData[e.nodeName.toLowerCase()];return!t||t!==!0&&e.getAttribute("classid")===t}}),v.fn.extend({data:function(e,n){var r,i,s,o,u,a=this[0],f=0,l=null;if(e===t){if(this.length){l=v.data(a);if(a.nodeType===1&&!v._data(a,"parsedAttrs")){s=a.attributes;for(u=s.length;f<u;f++)o=s[f].name,o.indexOf("data-")||(o=v.camelCase(o.substring(5)),H(a,o,l[o]));v._data(a,"parsedAttrs",!0)}}return l}return typeof e=="object"?this.each(function(){v.data(this,e)}):(r=e.split(".",2),r[1]=r[1]?"."+r[1]:"",i=r[1]+"!",v.access(this,function(n){if(n===t)return l=this.triggerHandler("getData"+i,[r[0]]),l===t&&a&&(l=v.data(a,e),l=H(a,e,l)),l===t&&r[1]?this.data(r[0]):l;r[1]=n,this.each(function(){var t=v(this);t.triggerHandler("setData"+i,r),v.data(this,e,n),t.triggerHandler("changeData"+i,r)})},null,n,arguments.length>1,null,!1))},removeData:function(e){return this.each(function(){v.removeData(this,e)})}}),v.extend({queue:function(e,t,n){var r;if(e)return t=(t||"fx")+"queue",r=v._data(e,t),n&&(!r||v.isArray(n)?r=v._data(e,t,v.makeArray(n)):r.push(n)),r||[]},dequeue:function(e,t){t=t||"fx";var n=v.queue(e,t),r=n.length,i=n.shift(),s=v._queueHooks(e,t),o=function(){v.dequeue(e,t)};i==="inprogress"&&(i=n.shift(),r--),i&&(t==="fx"&&n.unshift("inprogress"),delete s.stop,i.call(e,o,s)),!r&&s&&s.empty.fire()},_queueHooks:function(e,t){var n=t+"queueHooks";return v._data(e,n)||v._data(e,n,{empty:v.Callbacks("once memory").add(function(){v.removeData(e,t+"queue",!0),v.removeData(e,n,!0)})})}}),v.fn.extend({queue:function(e,n){var r=2;return typeof e!="string"&&(n=e,e="fx",r--),arguments.length<r?v.queue(this[0],e):n===t?this:this.each(function(){var t=v.queue(this,e,n);v._queueHooks(this,e),e==="fx"&&t[0]!=="inprogress"&&v.dequeue(this,e)})},dequeue:function(e){return this.each(function(){v.dequeue(this,e)})},delay:function(e,t){return e=v.fx?v.fx.speeds[e]||e:e,t=t||"fx",this.queue(t,function(t,n){var r=setTimeout(t,e);n.stop=function(){clearTimeout(r)}})},clearQueue:function(e){return this.queue(e||"fx",[])},promise:function(e,n){var r,i=1,s=v.Deferred(),o=this,u=this.length,a=function(){--i||s.resolveWith(o,[o])};typeof e!="string"&&(n=e,e=t),e=e||"fx";while(u--)r=v._data(o[u],e+"queueHooks"),r&&r.empty&&(i++,r.empty.add(a));return a(),s.promise(n)}});var j,F,I,q=/[\t\r\n]/g,R=/\r/g,U=/^(?:button|input)$/i,z=/^(?:button|input|object|select|textarea)$/i,W=/^a(?:rea|)$/i,X=/^(?:autofocus|autoplay|async|checked|controls|defer|disabled|hidden|loop|multiple|open|readonly|required|scoped|selected)$/i,V=v.support.getSetAttribute;v.fn.extend({attr:function(e,t){return v.access(this,v.attr,e,t,arguments.length>1)},removeAttr:function(e){return this.each(function(){v.removeAttr(this,e)})},prop:function(e,t){return v.access(this,v.prop,e,t,arguments.length>1)},removeProp:function(e){return e=v.propFix[e]||e,this.each(function(){try{this[e]=t,delete this[e]}catch(n){}})},addClass:function(e){var t,n,r,i,s,o,u;if(v.isFunction(e))return this.each(function(t){v(this).addClass(e.call(this,t,this.className))});if(e&&typeof e=="string"){t=e.split(y);for(n=0,r=this.length;n<r;n++){i=this[n];if(i.nodeType===1)if(!i.className&&t.length===1)i.className=e;else{s=" "+i.className+" ";for(o=0,u=t.length;o<u;o++)s.indexOf(" "+t[o]+" ")<0&&(s+=t[o]+" ");i.className=v.trim(s)}}}return this},removeClass:function(e){var n,r,i,s,o,u,a;if(v.isFunction(e))return this.each(function(t){v(this).removeClass(e.call(this,t,this.className))});if(e&&typeof e=="string"||e===t){n=(e||"").split(y);for(u=0,a=this.length;u<a;u++){i=this[u];if(i.nodeType===1&&i.className){r=(" "+i.className+" ").replace(q," ");for(s=0,o=n.length;s<o;s++)while(r.indexOf(" "+n[s]+" ")>=0)r=r.replace(" "+n[s]+" "," ");i.className=e?v.trim(r):""}}}return this},toggleClass:function(e,t){var n=typeof e,r=typeof t=="boolean";return v.isFunction(e)?this.each(function(n){v(this).toggleClass(e.call(this,n,this.className,t),t)}):this.each(function(){if(n==="string"){var i,s=0,o=v(this),u=t,a=e.split(y);while(i=a[s++])u=r?u:!o.hasClass(i),o[u?"addClass":"removeClass"](i)}else if(n==="undefined"||n==="boolean")this.className&&v._data(this,"__className__",this.className),this.className=this.className||e===!1?"":v._data(this,"__className__")||""})},hasClass:function(e){var t=" "+e+" ",n=0,r=this.length;for(;n<r;n++)if(this[n].nodeType===1&&(" "+this[n].className+" ").replace(q," ").indexOf(t)>=0)return!0;return!1},val:function(e){var n,r,i,s=this[0];if(!arguments.length){if(s)return n=v.valHooks[s.type]||v.valHooks[s.nodeName.toLowerCase()],n&&"get"in n&&(r=n.get(s,"value"))!==t?r:(r=s.value,typeof r=="string"?r.replace(R,""):r==null?"":r);return}return i=v.isFunction(e),this.each(function(r){var s,o=v(this);if(this.nodeType!==1)return;i?s=e.call(this,r,o.val()):s=e,s==null?s="":typeof s=="number"?s+="":v.isArray(s)&&(s=v.map(s,function(e){return e==null?"":e+""})),n=v.valHooks[this.type]||v.valHooks[this.nodeName.toLowerCase()];if(!n||!("set"in n)||n.set(this,s,"value")===t)this.value=s})}}),v.extend({valHooks:{option:{get:function(e){var t=e.attributes.value;return!t||t.specified?e.value:e.text}},select:{get:function(e){var t,n,r=e.options,i=e.selectedIndex,s=e.type==="select-one"||i<0,o=s?null:[],u=s?i+1:r.length,a=i<0?u:s?i:0;for(;a<u;a++){n=r[a];if((n.selected||a===i)&&(v.support.optDisabled?!n.disabled:n.getAttribute("disabled")===null)&&(!n.parentNode.disabled||!v.nodeName(n.parentNode,"optgroup"))){t=v(n).val();if(s)return t;o.push(t)}}return o},set:function(e,t){var n=v.makeArray(t);return v(e).find("option").each(function(){this.selected=v.inArray(v(this).val(),n)>=0}),n.length||(e.selectedIndex=-1),n}}},attrFn:{},attr:function(e,n,r,i){var s,o,u,a=e.nodeType;if(!e||a===3||a===8||a===2)return;if(i&&v.isFunction(v.fn[n]))return v(e)[n](r);if(typeof e.getAttribute=="undefined")return v.prop(e,n,r);u=a!==1||!v.isXMLDoc(e),u&&(n=n.toLowerCase(),o=v.attrHooks[n]||(X.test(n)?F:j));if(r!==t){if(r===null){v.removeAttr(e,n);return}return o&&"set"in o&&u&&(s=o.set(e,r,n))!==t?s:(e.setAttribute(n,r+""),r)}return o&&"get"in o&&u&&(s=o.get(e,n))!==null?s:(s=e.getAttribute(n),s===null?t:s)},removeAttr:function(e,t){var n,r,i,s,o=0;if(t&&e.nodeType===1){r=t.split(y);for(;o<r.length;o++)i=r[o],i&&(n=v.propFix[i]||i,s=X.test(i),s||v.attr(e,i,""),e.removeAttribute(V?i:n),s&&n in e&&(e[n]=!1))}},attrHooks:{type:{set:function(e,t){if(U.test(e.nodeName)&&e.parentNode)v.error("type property can't be changed");else if(!v.support.radioValue&&t==="radio"&&v.nodeName(e,"input")){var n=e.value;return e.setAttribute("type",t),n&&(e.value=n),t}}},value:{get:function(e,t){return j&&v.nodeName(e,"button")?j.get(e,t):t in e?e.value:null},set:function(e,t,n){if(j&&v.nodeName(e,"button"))return j.set(e,t,n);e.value=t}}},propFix:{tabindex:"tabIndex",readonly:"readOnly","for":"htmlFor","class":"className",maxlength:"maxLength",cellspacing:"cellSpacing",cellpadding:"cellPadding",rowspan:"rowSpan",colspan:"colSpan",usemap:"useMap",frameborder:"frameBorder",contenteditable:"contentEditable"},prop:function(e,n,r){var i,s,o,u=e.nodeType;if(!e||u===3||u===8||u===2)return;return o=u!==1||!v.isXMLDoc(e),o&&(n=v.propFix[n]||n,s=v.propHooks[n]),r!==t?s&&"set"in s&&(i=s.set(e,r,n))!==t?i:e[n]=r:s&&"get"in s&&(i=s.get(e,n))!==null?i:e[n]},propHooks:{tabIndex:{get:function(e){var n=e.getAttributeNode("tabindex");return n&&n.specified?parseInt(n.value,10):z.test(e.nodeName)||W.test(e.nodeName)&&e.href?0:t}}}}),F={get:function(e,n){var r,i=v.prop(e,n);return i===!0||typeof i!="boolean"&&(r=e.getAttributeNode(n))&&r.nodeValue!==!1?n.toLowerCase():t},set:function(e,t,n){var r;return t===!1?v.removeAttr(e,n):(r=v.propFix[n]||n,r in e&&(e[r]=!0),e.setAttribute(n,n.toLowerCase())),n}},V||(I={name:!0,id:!0,coords:!0},j=v.valHooks.button={get:function(e,n){var r;return r=e.getAttributeNode(n),r&&(I[n]?r.value!=="":r.specified)?r.value:t},set:function(e,t,n){var r=e.getAttributeNode(n);return r||(r=i.createAttribute(n),e.setAttributeNode(r)),r.value=t+""}},v.each(["width","height"],function(e,t){v.attrHooks[t]=v.extend(v.attrHooks[t],{set:function(e,n){if(n==="")return e.setAttribute(t,"auto"),n}})}),v.attrHooks.contenteditable={get:j.get,set:function(e,t,n){t===""&&(t="false"),j.set(e,t,n)}}),v.support.hrefNormalized||v.each(["href","src","width","height"],function(e,n){v.attrHooks[n]=v.extend(v.attrHooks[n],{get:function(e){var r=e.getAttribute(n,2);return r===null?t:r}})}),v.support.style||(v.attrHooks.style={get:function(e){return e.style.cssText.toLowerCase()||t},set:function(e,t){return e.style.cssText=t+""}}),v.support.optSelected||(v.propHooks.selected=v.extend(v.propHooks.selected,{get:function(e){var t=e.parentNode;return t&&(t.selectedIndex,t.parentNode&&t.parentNode.selectedIndex),null}})),v.support.enctype||(v.propFix.enctype="encoding"),v.support.checkOn||v.each(["radio","checkbox"],function(){v.valHooks[this]={get:function(e){return e.getAttribute("value")===null?"on":e.value}}}),v.each(["radio","checkbox"],function(){v.valHooks[this]=v.extend(v.valHooks[this],{set:function(e,t){if(v.isArray(t))return e.checked=v.inArray(v(e).val(),t)>=0}})});var $=/^(?:textarea|input|select)$/i,J=/^([^\.]*|)(?:\.(.+)|)$/,K=/(?:^|\s)hover(\.\S+|)\b/,Q=/^key/,G=/^(?:mouse|contextmenu)|click/,Y=/^(?:focusinfocus|focusoutblur)$/,Z=function(e){return v.event.special.hover?e:e.replace(K,"mouseenter$1 mouseleave$1")};v.event={add:function(e,n,r,i,s){var o,u,a,f,l,c,h,p,d,m,g;if(e.nodeType===3||e.nodeType===8||!n||!r||!(o=v._data(e)))return;r.handler&&(d=r,r=d.handler,s=d.selector),r.guid||(r.guid=v.guid++),a=o.events,a||(o.events=a={}),u=o.handle,u||(o.handle=u=function(e){return typeof v=="undefined"||!!e&&v.event.triggered===e.type?t:v.event.dispatch.apply(u.elem,arguments)},u.elem=e),n=v.trim(Z(n)).split(" ");for(f=0;f<n.length;f++){l=J.exec(n[f])||[],c=l[1],h=(l[2]||"").split(".").sort(),g=v.event.special[c]||{},c=(s?g.delegateType:g.bindType)||c,g=v.event.special[c]||{},p=v.extend({type:c,origType:l[1],data:i,handler:r,guid:r.guid,selector:s,needsContext:s&&v.expr.match.needsContext.test(s),namespace:h.join(".")},d),m=a[c];if(!m){m=a[c]=[],m.delegateCount=0;if(!g.setup||g.setup.call(e,i,h,u)===!1)e.addEventListener?e.addEventListener(c,u,!1):e.attachEvent&&e.attachEvent("on"+c,u)}g.add&&(g.add.call(e,p),p.handler.guid||(p.handler.guid=r.guid)),s?m.splice(m.delegateCount++,0,p):m.push(p),v.event.global[c]=!0}e=null},global:{},remove:function(e,t,n,r,i){var s,o,u,a,f,l,c,h,p,d,m,g=v.hasData(e)&&v._data(e);if(!g||!(h=g.events))return;t=v.trim(Z(t||"")).split(" ");for(s=0;s<t.length;s++){o=J.exec(t[s])||[],u=a=o[1],f=o[2];if(!u){for(u in h)v.event.remove(e,u+t[s],n,r,!0);continue}p=v.event.special[u]||{},u=(r?p.delegateType:p.bindType)||u,d=h[u]||[],l=d.length,f=f?new RegExp("(^|\\.)"+f.split(".").sort().join("\\.(?:.*\\.|)")+"(\\.|$)"):null;for(c=0;c<d.length;c++)m=d[c],(i||a===m.origType)&&(!n||n.guid===m.guid)&&(!f||f.test(m.namespace))&&(!r||r===m.selector||r==="**"&&m.selector)&&(d.splice(c--,1),m.selector&&d.delegateCount--,p.remove&&p.remove.call(e,m));d.length===0&&l!==d.length&&((!p.teardown||p.teardown.call(e,f,g.handle)===!1)&&v.removeEvent(e,u,g.handle),delete h[u])}v.isEmptyObject(h)&&(delete g.handle,v.removeData(e,"events",!0))},customEvent:{getData:!0,setData:!0,changeData:!0},trigger:function(n,r,s,o){if(!s||s.nodeType!==3&&s.nodeType!==8){var u,a,f,l,c,h,p,d,m,g,y=n.type||n,b=[];if(Y.test(y+v.event.triggered))return;y.indexOf("!")>=0&&(y=y.slice(0,-1),a=!0),y.indexOf(".")>=0&&(b=y.split("."),y=b.shift(),b.sort());if((!s||v.event.customEvent[y])&&!v.event.global[y])return;n=typeof n=="object"?n[v.expando]?n:new v.Event(y,n):new v.Event(y),n.type=y,n.isTrigger=!0,n.exclusive=a,n.namespace=b.join("."),n.namespace_re=n.namespace?new RegExp("(^|\\.)"+b.join("\\.(?:.*\\.|)")+"(\\.|$)"):null,h=y.indexOf(":")<0?"on"+y:"";if(!s){u=v.cache;for(f in u)u[f].events&&u[f].events[y]&&v.event.trigger(n,r,u[f].handle.elem,!0);return}n.result=t,n.target||(n.target=s),r=r!=null?v.makeArray(r):[],r.unshift(n),p=v.event.special[y]||{};if(p.trigger&&p.trigger.apply(s,r)===!1)return;m=[[s,p.bindType||y]];if(!o&&!p.noBubble&&!v.isWindow(s)){g=p.delegateType||y,l=Y.test(g+y)?s:s.parentNode;for(c=s;l;l=l.parentNode)m.push([l,g]),c=l;c===(s.ownerDocument||i)&&m.push([c.defaultView||c.parentWindow||e,g])}for(f=0;f<m.length&&!n.isPropagationStopped();f++)l=m[f][0],n.type=m[f][1],d=(v._data(l,"events")||{})[n.type]&&v._data(l,"handle"),d&&d.apply(l,r),d=h&&l[h],d&&v.acceptData(l)&&d.apply&&d.apply(l,r)===!1&&n.preventDefault();return n.type=y,!o&&!n.isDefaultPrevented()&&(!p._default||p._default.apply(s.ownerDocument,r)===!1)&&(y!=="click"||!v.nodeName(s,"a"))&&v.acceptData(s)&&h&&s[y]&&(y!=="focus"&&y!=="blur"||n.target.offsetWidth!==0)&&!v.isWindow(s)&&(c=s[h],c&&(s[h]=null),v.event.triggered=y,s[y](),v.event.triggered=t,c&&(s[h]=c)),n.result}return},dispatch:function(n){n=v.event.fix(n||e.event);var r,i,s,o,u,a,f,c,h,p,d=(v._data(this,"events")||{})[n.type]||[],m=d.delegateCount,g=l.call(arguments),y=!n.exclusive&&!n.namespace,b=v.event.special[n.type]||{},w=[];g[0]=n,n.delegateTarget=this;if(b.preDispatch&&b.preDispatch.call(this,n)===!1)return;if(m&&(!n.button||n.type!=="click"))for(s=n.target;s!=this;s=s.parentNode||this)if(s.disabled!==!0||n.type!=="click"){u={},f=[];for(r=0;r<m;r++)c=d[r],h=c.selector,u[h]===t&&(u[h]=c.needsContext?v(h,this).index(s)>=0:v.find(h,this,null,[s]).length),u[h]&&f.push(c);f.length&&w.push({elem:s,matches:f})}d.length>m&&w.push({elem:this,matches:d.slice(m)});for(r=0;r<w.length&&!n.isPropagationStopped();r++){a=w[r],n.currentTarget=a.elem;for(i=0;i<a.matches.length&&!n.isImmediatePropagationStopped();i++){c=a.matches[i];if(y||!n.namespace&&!c.namespace||n.namespace_re&&n.namespace_re.test(c.namespace))n.data=c.data,n.handleObj=c,o=((v.event.special[c.origType]||{}).handle||c.handler).apply(a.elem,g),o!==t&&(n.result=o,o===!1&&(n.preventDefault(),n.stopPropagation()))}}return b.postDispatch&&b.postDispatch.call(this,n),n.result},props:"attrChange attrName relatedNode srcElement altKey bubbles cancelable ctrlKey currentTarget eventPhase metaKey relatedTarget shiftKey target timeStamp view which".split(" "),fixHooks:{},keyHooks:{props:"char charCode key keyCode".split(" "),filter:function(e,t){return e.which==null&&(e.which=t.charCode!=null?t.charCode:t.keyCode),e}},mouseHooks:{props:"button buttons clientX clientY fromElement offsetX offsetY pageX pageY screenX screenY toElement".split(" "),filter:function(e,n){var r,s,o,u=n.button,a=n.fromElement;return e.pageX==null&&n.clientX!=null&&(r=e.target.ownerDocument||i,s=r.documentElement,o=r.body,e.pageX=n.clientX+(s&&s.scrollLeft||o&&o.scrollLeft||0)-(s&&s.clientLeft||o&&o.clientLeft||0),e.pageY=n.clientY+(s&&s.scrollTop||o&&o.scrollTop||0)-(s&&s.clientTop||o&&o.clientTop||0)),!e.relatedTarget&&a&&(e.relatedTarget=a===e.target?n.toElement:a),!e.which&&u!==t&&(e.which=u&1?1:u&2?3:u&4?2:0),e}},fix:function(e){if(e[v.expando])return e;var t,n,r=e,s=v.event.fixHooks[e.type]||{},o=s.props?this.props.concat(s.props):this.props;e=v.Event(r);for(t=o.length;t;)n=o[--t],e[n]=r[n];return e.target||(e.target=r.srcElement||i),e.target.nodeType===3&&(e.target=e.target.parentNode),e.metaKey=!!e.metaKey,s.filter?s.filter(e,r):e},special:{load:{noBubble:!0},focus:{delegateType:"focusin"},blur:{delegateType:"focusout"},beforeunload:{setup:function(e,t,n){v.isWindow(this)&&(this.onbeforeunload=n)},teardown:function(e,t){this.onbeforeunload===t&&(this.onbeforeunload=null)}}},simulate:function(e,t,n,r){var i=v.extend(new v.Event,n,{type:e,isSimulated:!0,originalEvent:{}});r?v.event.trigger(i,null,t):v.event.dispatch.call(t,i),i.isDefaultPrevented()&&n.preventDefault()}},v.event.handle=v.event.dispatch,v.removeEvent=i.removeEventListener?function(e,t,n){e.removeEventListener&&e.removeEventListener(t,n,!1)}:function(e,t,n){var r="on"+t;e.detachEvent&&(typeof e[r]=="undefined"&&(e[r]=null),e.detachEvent(r,n))},v.Event=function(e,t){if(!(this instanceof v.Event))return new v.Event(e,t);e&&e.type?(this.originalEvent=e,this.type=e.type,this.isDefaultPrevented=e.defaultPrevented||e.returnValue===!1||e.getPreventDefault&&e.getPreventDefault()?tt:et):this.type=e,t&&v.extend(this,t),this.timeStamp=e&&e.timeStamp||v.now(),this[v.expando]=!0},v.Event.prototype={preventDefault:function(){this.isDefaultPrevented=tt;var e=this.originalEvent;if(!e)return;e.preventDefault?e.preventDefault():e.returnValue=!1},stopPropagation:function(){this.isPropagationStopped=tt;var e=this.originalEvent;if(!e)return;e.stopPropagation&&e.stopPropagation(),e.cancelBubble=!0},stopImmediatePropagation:function(){this.isImmediatePropagationStopped=tt,this.stopPropagation()},isDefaultPrevented:et,isPropagationStopped:et,isImmediatePropagationStopped:et},v.each({mouseenter:"mouseover",mouseleave:"mouseout"},function(e,t){v.event.special[e]={delegateType:t,bindType:t,handle:function(e){var n,r=this,i=e.relatedTarget,s=e.handleObj,o=s.selector;if(!i||i!==r&&!v.contains(r,i))e.type=s.origType,n=s.handler.apply(this,arguments),e.type=t;return n}}}),v.support.submitBubbles||(v.event.special.submit={setup:function(){if(v.nodeName(this,"form"))return!1;v.event.add(this,"click._submit keypress._submit",function(e){var n=e.target,r=v.nodeName(n,"input")||v.nodeName(n,"button")?n.form:t;r&&!v._data(r,"_submit_attached")&&(v.event.add(r,"submit._submit",function(e){e._submit_bubble=!0}),v._data(r,"_submit_attached",!0))})},postDispatch:function(e){e._submit_bubble&&(delete e._submit_bubble,this.parentNode&&!e.isTrigger&&v.event.simulate("submit",this.parentNode,e,!0))},teardown:function(){if(v.nodeName(this,"form"))return!1;v.event.remove(this,"._submit")}}),v.support.changeBubbles||(v.event.special.change={setup:function(){if($.test(this.nodeName)){if(this.type==="checkbox"||this.type==="radio")v.event.add(this,"propertychange._change",function(e){e.originalEvent.propertyName==="checked"&&(this._just_changed=!0)}),v.event.add(this,"click._change",function(e){this._just_changed&&!e.isTrigger&&(this._just_changed=!1),v.event.simulate("change",this,e,!0)});return!1}v.event.add(this,"beforeactivate._change",function(e){var t=e.target;$.test(t.nodeName)&&!v._data(t,"_change_attached")&&(v.event.add(t,"change._change",function(e){this.parentNode&&!e.isSimulated&&!e.isTrigger&&v.event.simulate("change",this.parentNode,e,!0)}),v._data(t,"_change_attached",!0))})},handle:function(e){var t=e.target;if(this!==t||e.isSimulated||e.isTrigger||t.type!=="radio"&&t.type!=="checkbox")return e.handleObj.handler.apply(this,arguments)},teardown:function(){return v.event.remove(this,"._change"),!$.test(this.nodeName)}}),v.support.focusinBubbles||v.each({focus:"focusin",blur:"focusout"},function(e,t){var n=0,r=function(e){v.event.simulate(t,e.target,v.event.fix(e),!0)};v.event.special[t]={setup:function(){n++===0&&i.addEventListener(e,r,!0)},teardown:function(){--n===0&&i.removeEventListener(e,r,!0)}}}),v.fn.extend({on:function(e,n,r,i,s){var o,u;if(typeof e=="object"){typeof n!="string"&&(r=r||n,n=t);for(u in e)this.on(u,n,r,e[u],s);return this}r==null&&i==null?(i=n,r=n=t):i==null&&(typeof n=="string"?(i=r,r=t):(i=r,r=n,n=t));if(i===!1)i=et;else if(!i)return this;return s===1&&(o=i,i=function(e){return v().off(e),o.apply(this,arguments)},i.guid=o.guid||(o.guid=v.guid++)),this.each(function(){v.event.add(this,e,i,r,n)})},one:function(e,t,n,r){return this.on(e,t,n,r,1)},off:function(e,n,r){var i,s;if(e&&e.preventDefault&&e.handleObj)return i=e.handleObj,v(e.delegateTarget).off(i.namespace?i.origType+"."+i.namespace:i.origType,i.selector,i.handler),this;if(typeof e=="object"){for(s in e)this.off(s,n,e[s]);return this}if(n===!1||typeof n=="function")r=n,n=t;return r===!1&&(r=et),this.each(function(){v.event.remove(this,e,r,n)})},bind:function(e,t,n){return this.on(e,null,t,n)},unbind:function(e,t){return this.off(e,null,t)},live:function(e,t,n){return v(this.context).on(e,this.selector,t,n),this},die:function(e,t){return v(this.context).off(e,this.selector||"**",t),this},delegate:function(e,t,n,r){return this.on(t,e,n,r)},undelegate:function(e,t,n){return arguments.length===1?this.off(e,"**"):this.off(t,e||"**",n)},trigger:function(e,t){return this.each(function(){v.event.trigger(e,t,this)})},triggerHandler:function(e,t){if(this[0])return v.event.trigger(e,t,this[0],!0)},toggle:function(e){var t=arguments,n=e.guid||v.guid++,r=0,i=function(n){var i=(v._data(this,"lastToggle"+e.guid)||0)%r;return v._data(this,"lastToggle"+e.guid,i+1),n.preventDefault(),t[i].apply(this,arguments)||!1};i.guid=n;while(r<t.length)t[r++].guid=n;return this.click(i)},hover:function(e,t){return this.mouseenter(e).mouseleave(t||e)}}),v.each("blur focus focusin focusout load resize scroll unload click dblclick mousedown mouseup mousemove mouseover mouseout mouseenter mouseleave change select submit keydown keypress keyup error contextmenu".split(" "),function(e,t){v.fn[t]=function(e,n){return n==null&&(n=e,e=null),arguments.length>0?this.on(t,null,e,n):this.trigger(t)},Q.test(t)&&(v.event.fixHooks[t]=v.event.keyHooks),G.test(t)&&(v.event.fixHooks[t]=v.event.mouseHooks)}),function(e,t){function nt(e,t,n,r){n=n||[],t=t||g;var i,s,a,f,l=t.nodeType;if(!e||typeof e!="string")return n;if(l!==1&&l!==9)return[];a=o(t);if(!a&&!r)if(i=R.exec(e))if(f=i[1]){if(l===9){s=t.getElementById(f);if(!s||!s.parentNode)return n;if(s.id===f)return n.push(s),n}else if(t.ownerDocument&&(s=t.ownerDocument.getElementById(f))&&u(t,s)&&s.id===f)return n.push(s),n}else{if(i[2])return S.apply(n,x.call(t.getElementsByTagName(e),0)),n;if((f=i[3])&&Z&&t.getElementsByClassName)return S.apply(n,x.call(t.getElementsByClassName(f),0)),n}return vt(e.replace(j,"$1"),t,n,r,a)}function rt(e){return function(t){var n=t.nodeName.toLowerCase();return n==="input"&&t.type===e}}function it(e){return function(t){var n=t.nodeName.toLowerCase();return(n==="input"||n==="button")&&t.type===e}}function st(e){return N(function(t){return t=+t,N(function(n,r){var i,s=e([],n.length,t),o=s.length;while(o--)n[i=s[o]]&&(n[i]=!(r[i]=n[i]))})})}function ot(e,t,n){if(e===t)return n;var r=e.nextSibling;while(r){if(r===t)return-1;r=r.nextSibling}return 1}function ut(e,t){var n,r,s,o,u,a,f,l=L[d][e+" "];if(l)return t?0:l.slice(0);u=e,a=[],f=i.preFilter;while(u){if(!n||(r=F.exec(u)))r&&(u=u.slice(r[0].length)||u),a.push(s=[]);n=!1;if(r=I.exec(u))s.push(n=new m(r.shift())),u=u.slice(n.length),n.type=r[0].replace(j," ");for(o in i.filter)(r=J[o].exec(u))&&(!f[o]||(r=f[o](r)))&&(s.push(n=new m(r.shift())),u=u.slice(n.length),n.type=o,n.matches=r);if(!n)break}return t?u.length:u?nt.error(e):L(e,a).slice(0)}function at(e,t,r){var i=t.dir,s=r&&t.dir==="parentNode",o=w++;return t.first?function(t,n,r){while(t=t[i])if(s||t.nodeType===1)return e(t,n,r)}:function(t,r,u){if(!u){var a,f=b+" "+o+" ",l=f+n;while(t=t[i])if(s||t.nodeType===1){if((a=t[d])===l)return t.sizset;if(typeof a=="string"&&a.indexOf(f)===0){if(t.sizset)return t}else{t[d]=l;if(e(t,r,u))return t.sizset=!0,t;t.sizset=!1}}}else while(t=t[i])if(s||t.nodeType===1)if(e(t,r,u))return t}}function ft(e){return e.length>1?function(t,n,r){var i=e.length;while(i--)if(!e[i](t,n,r))return!1;return!0}:e[0]}function lt(e,t,n,r,i){var s,o=[],u=0,a=e.length,f=t!=null;for(;u<a;u++)if(s=e[u])if(!n||n(s,r,i))o.push(s),f&&t.push(u);return o}function ct(e,t,n,r,i,s){return r&&!r[d]&&(r=ct(r)),i&&!i[d]&&(i=ct(i,s)),N(function(s,o,u,a){var f,l,c,h=[],p=[],d=o.length,v=s||dt(t||"*",u.nodeType?[u]:u,[]),m=e&&(s||!t)?lt(v,h,e,u,a):v,g=n?i||(s?e:d||r)?[]:o:m;n&&n(m,g,u,a);if(r){f=lt(g,p),r(f,[],u,a),l=f.length;while(l--)if(c=f[l])g[p[l]]=!(m[p[l]]=c)}if(s){if(i||e){if(i){f=[],l=g.length;while(l--)(c=g[l])&&f.push(m[l]=c);i(null,g=[],f,a)}l=g.length;while(l--)(c=g[l])&&(f=i?T.call(s,c):h[l])>-1&&(s[f]=!(o[f]=c))}}else g=lt(g===o?g.splice(d,g.length):g),i?i(null,o,g,a):S.apply(o,g)})}function ht(e){var t,n,r,s=e.length,o=i.relative[e[0].type],u=o||i.relative[" "],a=o?1:0,f=at(function(e){return e===t},u,!0),l=at(function(e){return T.call(t,e)>-1},u,!0),h=[function(e,n,r){return!o&&(r||n!==c)||((t=n).nodeType?f(e,n,r):l(e,n,r))}];for(;a<s;a++)if(n=i.relative[e[a].type])h=[at(ft(h),n)];else{n=i.filter[e[a].type].apply(null,e[a].matches);if(n[d]){r=++a;for(;r<s;r++)if(i.relative[e[r].type])break;return ct(a>1&&ft(h),a>1&&e.slice(0,a-1).join("").replace(j,"$1"),n,a<r&&ht(e.slice(a,r)),r<s&&ht(e=e.slice(r)),r<s&&e.join(""))}h.push(n)}return ft(h)}function pt(e,t){var r=t.length>0,s=e.length>0,o=function(u,a,f,l,h){var p,d,v,m=[],y=0,w="0",x=u&&[],T=h!=null,N=c,C=u||s&&i.find.TAG("*",h&&a.parentNode||a),k=b+=N==null?1:Math.E;T&&(c=a!==g&&a,n=o.el);for(;(p=C[w])!=null;w++){if(s&&p){for(d=0;v=e[d];d++)if(v(p,a,f)){l.push(p);break}T&&(b=k,n=++o.el)}r&&((p=!v&&p)&&y--,u&&x.push(p))}y+=w;if(r&&w!==y){for(d=0;v=t[d];d++)v(x,m,a,f);if(u){if(y>0)while(w--)!x[w]&&!m[w]&&(m[w]=E.call(l));m=lt(m)}S.apply(l,m),T&&!u&&m.length>0&&y+t.length>1&&nt.uniqueSort(l)}return T&&(b=k,c=N),x};return o.el=0,r?N(o):o}function dt(e,t,n){var r=0,i=t.length;for(;r<i;r++)nt(e,t[r],n);return n}function vt(e,t,n,r,s){var o,u,f,l,c,h=ut(e),p=h.length;if(!r&&h.length===1){u=h[0]=h[0].slice(0);if(u.length>2&&(f=u[0]).type==="ID"&&t.nodeType===9&&!s&&i.relative[u[1].type]){t=i.find.ID(f.matches[0].replace($,""),t,s)[0];if(!t)return n;e=e.slice(u.shift().length)}for(o=J.POS.test(e)?-1:u.length-1;o>=0;o--){f=u[o];if(i.relative[l=f.type])break;if(c=i.find[l])if(r=c(f.matches[0].replace($,""),z.test(u[0].type)&&t.parentNode||t,s)){u.splice(o,1),e=r.length&&u.join("");if(!e)return S.apply(n,x.call(r,0)),n;break}}}return a(e,h)(r,t,s,n,z.test(e)),n}function mt(){}var n,r,i,s,o,u,a,f,l,c,h=!0,p="undefined",d=("sizcache"+Math.random()).replace(".",""),m=String,g=e.document,y=g.documentElement,b=0,w=0,E=[].pop,S=[].push,x=[].slice,T=[].indexOf||function(e){var t=0,n=this.length;for(;t<n;t++)if(this[t]===e)return t;return-1},N=function(e,t){return e[d]=t==null||t,e},C=function(){var e={},t=[];return N(function(n,r){return t.push(n)>i.cacheLength&&delete e[t.shift()],e[n+" "]=r},e)},k=C(),L=C(),A=C(),O="[\\x20\\t\\r\\n\\f]",M="(?:\\\\.|[-\\w]|[^\\x00-\\xa0])+",_=M.replace("w","w#"),D="([*^$|!~]?=)",P="\\["+O+"*("+M+")"+O+"*(?:"+D+O+"*(?:(['\"])((?:\\\\.|[^\\\\])*?)\\3|("+_+")|)|)"+O+"*\\]",H=":("+M+")(?:\\((?:(['\"])((?:\\\\.|[^\\\\])*?)\\2|([^()[\\]]*|(?:(?:"+P+")|[^:]|\\\\.)*|.*))\\)|)",B=":(even|odd|eq|gt|lt|nth|first|last)(?:\\("+O+"*((?:-\\d)?\\d*)"+O+"*\\)|)(?=[^-]|$)",j=new RegExp("^"+O+"+|((?:^|[^\\\\])(?:\\\\.)*)"+O+"+$","g"),F=new RegExp("^"+O+"*,"+O+"*"),I=new RegExp("^"+O+"*([\\x20\\t\\r\\n\\f>+~])"+O+"*"),q=new RegExp(H),R=/^(?:#([\w\-]+)|(\w+)|\.([\w\-]+))$/,U=/^:not/,z=/[\x20\t\r\n\f]*[+~]/,W=/:not\($/,X=/h\d/i,V=/input|select|textarea|button/i,$=/\\(?!\\)/g,J={ID:new RegExp("^#("+M+")"),CLASS:new RegExp("^\\.("+M+")"),NAME:new RegExp("^\\[name=['\"]?("+M+")['\"]?\\]"),TAG:new RegExp("^("+M.replace("w","w*")+")"),ATTR:new RegExp("^"+P),PSEUDO:new RegExp("^"+H),POS:new RegExp(B,"i"),CHILD:new RegExp("^:(only|nth|first|last)-child(?:\\("+O+"*(even|odd|(([+-]|)(\\d*)n|)"+O+"*(?:([+-]|)"+O+"*(\\d+)|))"+O+"*\\)|)","i"),needsContext:new RegExp("^"+O+"*[>+~]|"+B,"i")},K=function(e){var t=g.createElement("div");try{return e(t)}catch(n){return!1}finally{t=null}},Q=K(function(e){return e.appendChild(g.createComment("")),!e.getElementsByTagName("*").length}),G=K(function(e){return e.innerHTML="<a href='#'></a>",e.firstChild&&typeof e.firstChild.getAttribute!==p&&e.firstChild.getAttribute("href")==="#"}),Y=K(function(e){e.innerHTML="<select></select>";var t=typeof e.lastChild.getAttribute("multiple");return t!=="boolean"&&t!=="string"}),Z=K(function(e){return e.innerHTML="<div class='hidden e'></div><div class='hidden'></div>",!e.getElementsByClassName||!e.getElementsByClassName("e").length?!1:(e.lastChild.className="e",e.getElementsByClassName("e").length===2)}),et=K(function(e){e.id=d+0,e.innerHTML="<a name='"+d+"'></a><div name='"+d+"'></div>",y.insertBefore(e,y.firstChild);var t=g.getElementsByName&&g.getElementsByName(d).length===2+g.getElementsByName(d+0).length;return r=!g.getElementById(d),y.removeChild(e),t});try{x.call(y.childNodes,0)[0].nodeType}catch(tt){x=function(e){var t,n=[];for(;t=this[e];e++)n.push(t);return n}}nt.matches=function(e,t){return nt(e,null,null,t)},nt.matchesSelector=function(e,t){return nt(t,null,null,[e]).length>0},s=nt.getText=function(e){var t,n="",r=0,i=e.nodeType;if(i){if(i===1||i===9||i===11){if(typeof e.textContent=="string")return e.textContent;for(e=e.firstChild;e;e=e.nextSibling)n+=s(e)}else if(i===3||i===4)return e.nodeValue}else for(;t=e[r];r++)n+=s(t);return n},o=nt.isXML=function(e){var t=e&&(e.ownerDocument||e).documentElement;return t?t.nodeName!=="HTML":!1},u=nt.contains=y.contains?function(e,t){var n=e.nodeType===9?e.documentElement:e,r=t&&t.parentNode;return e===r||!!(r&&r.nodeType===1&&n.contains&&n.contains(r))}:y.compareDocumentPosition?function(e,t){return t&&!!(e.compareDocumentPosition(t)&16)}:function(e,t){while(t=t.parentNode)if(t===e)return!0;return!1},nt.attr=function(e,t){var n,r=o(e);return r||(t=t.toLowerCase()),(n=i.attrHandle[t])?n(e):r||Y?e.getAttribute(t):(n=e.getAttributeNode(t),n?typeof e[t]=="boolean"?e[t]?t:null:n.specified?n.value:null:null)},i=nt.selectors={cacheLength:50,createPseudo:N,match:J,attrHandle:G?{}:{href:function(e){return e.getAttribute("href",2)},type:function(e){return e.getAttribute("type")}},find:{ID:r?function(e,t,n){if(typeof t.getElementById!==p&&!n){var r=t.getElementById(e);return r&&r.parentNode?[r]:[]}}:function(e,n,r){if(typeof n.getElementById!==p&&!r){var i=n.getElementById(e);return i?i.id===e||typeof i.getAttributeNode!==p&&i.getAttributeNode("id").value===e?[i]:t:[]}},TAG:Q?function(e,t){if(typeof t.getElementsByTagName!==p)return t.getElementsByTagName(e)}:function(e,t){var n=t.getElementsByTagName(e);if(e==="*"){var r,i=[],s=0;for(;r=n[s];s++)r.nodeType===1&&i.push(r);return i}return n},NAME:et&&function(e,t){if(typeof t.getElementsByName!==p)return t.getElementsByName(name)},CLASS:Z&&function(e,t,n){if(typeof t.getElementsByClassName!==p&&!n)return t.getElementsByClassName(e)}},relative:{">":{dir:"parentNode",first:!0}," ":{dir:"parentNode"},"+":{dir:"previousSibling",first:!0},"~":{dir:"previousSibling"}},preFilter:{ATTR:function(e){return e[1]=e[1].replace($,""),e[3]=(e[4]||e[5]||"").replace($,""),e[2]==="~="&&(e[3]=" "+e[3]+" "),e.slice(0,4)},CHILD:function(e){return e[1]=e[1].toLowerCase(),e[1]==="nth"?(e[2]||nt.error(e[0]),e[3]=+(e[3]?e[4]+(e[5]||1):2*(e[2]==="even"||e[2]==="odd")),e[4]=+(e[6]+e[7]||e[2]==="odd")):e[2]&&nt.error(e[0]),e},PSEUDO:function(e){var t,n;if(J.CHILD.test(e[0]))return null;if(e[3])e[2]=e[3];else if(t=e[4])q.test(t)&&(n=ut(t,!0))&&(n=t.indexOf(")",t.length-n)-t.length)&&(t=t.slice(0,n),e[0]=e[0].slice(0,n)),e[2]=t;return e.slice(0,3)}},filter:{ID:r?function(e){return e=e.replace($,""),function(t){return t.getAttribute("id")===e}}:function(e){return e=e.replace($,""),function(t){var n=typeof t.getAttributeNode!==p&&t.getAttributeNode("id");return n&&n.value===e}},TAG:function(e){return e==="*"?function(){return!0}:(e=e.replace($,"").toLowerCase(),function(t){return t.nodeName&&t.nodeName.toLowerCase()===e})},CLASS:function(e){var t=k[d][e+" "];return t||(t=new RegExp("(^|"+O+")"+e+"("+O+"|$)"))&&k(e,function(e){return t.test(e.className||typeof e.getAttribute!==p&&e.getAttribute("class")||"")})},ATTR:function(e,t,n){return function(r,i){var s=nt.attr(r,e);return s==null?t==="!=":t?(s+="",t==="="?s===n:t==="!="?s!==n:t==="^="?n&&s.indexOf(n)===0:t==="*="?n&&s.indexOf(n)>-1:t==="$="?n&&s.substr(s.length-n.length)===n:t==="~="?(" "+s+" ").indexOf(n)>-1:t==="|="?s===n||s.substr(0,n.length+1)===n+"-":!1):!0}},CHILD:function(e,t,n,r){return e==="nth"?function(e){var t,i,s=e.parentNode;if(n===1&&r===0)return!0;if(s){i=0;for(t=s.firstChild;t;t=t.nextSibling)if(t.nodeType===1){i++;if(e===t)break}}return i-=r,i===n||i%n===0&&i/n>=0}:function(t){var n=t;switch(e){case"only":case"first":while(n=n.previousSibling)if(n.nodeType===1)return!1;if(e==="first")return!0;n=t;case"last":while(n=n.nextSibling)if(n.nodeType===1)return!1;return!0}}},PSEUDO:function(e,t){var n,r=i.pseudos[e]||i.setFilters[e.toLowerCase()]||nt.error("unsupported pseudo: "+e);return r[d]?r(t):r.length>1?(n=[e,e,"",t],i.setFilters.hasOwnProperty(e.toLowerCase())?N(function(e,n){var i,s=r(e,t),o=s.length;while(o--)i=T.call(e,s[o]),e[i]=!(n[i]=s[o])}):function(e){return r(e,0,n)}):r}},pseudos:{not:N(function(e){var t=[],n=[],r=a(e.replace(j,"$1"));return r[d]?N(function(e,t,n,i){var s,o=r(e,null,i,[]),u=e.length;while(u--)if(s=o[u])e[u]=!(t[u]=s)}):function(e,i,s){return t[0]=e,r(t,null,s,n),!n.pop()}}),has:N(function(e){return function(t){return nt(e,t).length>0}}),contains:N(function(e){return function(t){return(t.textContent||t.innerText||s(t)).indexOf(e)>-1}}),enabled:function(e){return e.disabled===!1},disabled:function(e){return e.disabled===!0},checked:function(e){var t=e.nodeName.toLowerCase();return t==="input"&&!!e.checked||t==="option"&&!!e.selected},selected:function(e){return e.parentNode&&e.parentNode.selectedIndex,e.selected===!0},parent:function(e){return!i.pseudos.empty(e)},empty:function(e){var t;e=e.firstChild;while(e){if(e.nodeName>"@"||(t=e.nodeType)===3||t===4)return!1;e=e.nextSibling}return!0},header:function(e){return X.test(e.nodeName)},text:function(e){var t,n;return e.nodeName.toLowerCase()==="input"&&(t=e.type)==="text"&&((n=e.getAttribute("type"))==null||n.toLowerCase()===t)},radio:rt("radio"),checkbox:rt("checkbox"),file:rt("file"),password:rt("password"),image:rt("image"),submit:it("submit"),reset:it("reset"),button:function(e){var t=e.nodeName.toLowerCase();return t==="input"&&e.type==="button"||t==="button"},input:function(e){return V.test(e.nodeName)},focus:function(e){var t=e.ownerDocument;return e===t.activeElement&&(!t.hasFocus||t.hasFocus())&&!!(e.type||e.href||~e.tabIndex)},active:function(e){return e===e.ownerDocument.activeElement},first:st(function(){return[0]}),last:st(function(e,t){return[t-1]}),eq:st(function(e,t,n){return[n<0?n+t:n]}),even:st(function(e,t){for(var n=0;n<t;n+=2)e.push(n);return e}),odd:st(function(e,t){for(var n=1;n<t;n+=2)e.push(n);return e}),lt:st(function(e,t,n){for(var r=n<0?n+t:n;--r>=0;)e.push(r);return e}),gt:st(function(e,t,n){for(var r=n<0?n+t:n;++r<t;)e.push(r);return e})}},f=y.compareDocumentPosition?function(e,t){return e===t?(l=!0,0):(!e.compareDocumentPosition||!t.compareDocumentPosition?e.compareDocumentPosition:e.compareDocumentPosition(t)&4)?-1:1}:function(e,t){if(e===t)return l=!0,0;if(e.sourceIndex&&t.sourceIndex)return e.sourceIndex-t.sourceIndex;var n,r,i=[],s=[],o=e.parentNode,u=t.parentNode,a=o;if(o===u)return ot(e,t);if(!o)return-1;if(!u)return 1;while(a)i.unshift(a),a=a.parentNode;a=u;while(a)s.unshift(a),a=a.parentNode;n=i.length,r=s.length;for(var f=0;f<n&&f<r;f++)if(i[f]!==s[f])return ot(i[f],s[f]);return f===n?ot(e,s[f],-1):ot(i[f],t,1)},[0,0].sort(f),h=!l,nt.uniqueSort=function(e){var t,n=[],r=1,i=0;l=h,e.sort(f);if(l){for(;t=e[r];r++)t===e[r-1]&&(i=n.push(r));while(i--)e.splice(n[i],1)}return e},nt.error=function(e){throw new Error("Syntax error, unrecognized expression: "+e)},a=nt.compile=function(e,t){var n,r=[],i=[],s=A[d][e+" "];if(!s){t||(t=ut(e)),n=t.length;while(n--)s=ht(t[n]),s[d]?r.push(s):i.push(s);s=A(e,pt(i,r))}return s},g.querySelectorAll&&function(){var e,t=vt,n=/'|\\/g,r=/\=[\x20\t\r\n\f]*([^'"\]]*)[\x20\t\r\n\f]*\]/g,i=[":focus"],s=[":active"],u=y.matchesSelector||y.mozMatchesSelector||y.webkitMatchesSelector||y.oMatchesSelector||y.msMatchesSelector;K(function(e){e.innerHTML="<select><option selected=''></option></select>",e.querySelectorAll("[selected]").length||i.push("\\["+O+"*(?:checked|disabled|ismap|multiple|readonly|selected|value)"),e.querySelectorAll(":checked").length||i.push(":checked")}),K(function(e){e.innerHTML="<p test=''></p>",e.querySelectorAll("[test^='']").length&&i.push("[*^$]="+O+"*(?:\"\"|'')"),e.innerHTML="<input type='hidden'/>",e.querySelectorAll(":enabled").length||i.push(":enabled",":disabled")}),i=new RegExp(i.join("|")),vt=function(e,r,s,o,u){if(!o&&!u&&!i.test(e)){var a,f,l=!0,c=d,h=r,p=r.nodeType===9&&e;if(r.nodeType===1&&r.nodeName.toLowerCase()!=="object"){a=ut(e),(l=r.getAttribute("id"))?c=l.replace(n,"\\$&"):r.setAttribute("id",c),c="[id='"+c+"'] ",f=a.length;while(f--)a[f]=c+a[f].join("");h=z.test(e)&&r.parentNode||r,p=a.join(",")}if(p)try{return S.apply(s,x.call(h.querySelectorAll(p),0)),s}catch(v){}finally{l||r.removeAttribute("id")}}return t(e,r,s,o,u)},u&&(K(function(t){e=u.call(t,"div");try{u.call(t,"[test!='']:sizzle"),s.push("!=",H)}catch(n){}}),s=new RegExp(s.join("|")),nt.matchesSelector=function(t,n){n=n.replace(r,"='$1']");if(!o(t)&&!s.test(n)&&!i.test(n))try{var a=u.call(t,n);if(a||e||t.document&&t.document.nodeType!==11)return a}catch(f){}return nt(n,null,null,[t]).length>0})}(),i.pseudos.nth=i.pseudos.eq,i.filters=mt.prototype=i.pseudos,i.setFilters=new mt,nt.attr=v.attr,v.find=nt,v.expr=nt.selectors,v.expr[":"]=v.expr.pseudos,v.unique=nt.uniqueSort,v.text=nt.getText,v.isXMLDoc=nt.isXML,v.contains=nt.contains}(e);var nt=/Until$/,rt=/^(?:parents|prev(?:Until|All))/,it=/^.[^:#\[\.,]*$/,st=v.expr.match.needsContext,ot={children:!0,contents:!0,next:!0,prev:!0};v.fn.extend({find:function(e){var t,n,r,i,s,o,u=this;if(typeof e!="string")return v(e).filter(function(){for(t=0,n=u.length;t<n;t++)if(v.contains(u[t],this))return!0});o=this.pushStack("","find",e);for(t=0,n=this.length;t<n;t++){r=o.length,v.find(e,this[t],o);if(t>0)for(i=r;i<o.length;i++)for(s=0;s<r;s++)if(o[s]===o[i]){o.splice(i--,1);break}}return o},has:function(e){var t,n=v(e,this),r=n.length;return this.filter(function(){for(t=0;t<r;t++)if(v.contains(this,n[t]))return!0})},not:function(e){return this.pushStack(ft(this,e,!1),"not",e)},filter:function(e){return this.pushStack(ft(this,e,!0),"filter",e)},is:function(e){return!!e&&(typeof e=="string"?st.test(e)?v(e,this.context).index(this[0])>=0:v.filter(e,this).length>0:this.filter(e).length>0)},closest:function(e,t){var n,r=0,i=this.length,s=[],o=st.test(e)||typeof e!="string"?v(e,t||this.context):0;for(;r<i;r++){n=this[r];while(n&&n.ownerDocument&&n!==t&&n.nodeType!==11){if(o?o.index(n)>-1:v.find.matchesSelector(n,e)){s.push(n);break}n=n.parentNode}}return s=s.length>1?v.unique(s):s,this.pushStack(s,"closest",e)},index:function(e){return e?typeof e=="string"?v.inArray(this[0],v(e)):v.inArray(e.jquery?e[0]:e,this):this[0]&&this[0].parentNode?this.prevAll().length:-1},add:function(e,t){var n=typeof e=="string"?v(e,t):v.makeArray(e&&e.nodeType?[e]:e),r=v.merge(this.get(),n);return this.pushStack(ut(n[0])||ut(r[0])?r:v.unique(r))},addBack:function(e){return this.add(e==null?this.prevObject:this.prevObject.filter(e))}}),v.fn.andSelf=v.fn.addBack,v.each({parent:function(e){var t=e.parentNode;return t&&t.nodeType!==11?t:null},parents:function(e){return v.dir(e,"parentNode")},parentsUntil:function(e,t,n){return v.dir(e,"parentNode",n)},next:function(e){return at(e,"nextSibling")},prev:function(e){return at(e,"previousSibling")},nextAll:function(e){return v.dir(e,"nextSibling")},prevAll:function(e){return v.dir(e,"previousSibling")},nextUntil:function(e,t,n){return v.dir(e,"nextSibling",n)},prevUntil:function(e,t,n){return v.dir(e,"previousSibling",n)},siblings:function(e){return v.sibling((e.parentNode||{}).firstChild,e)},children:function(e){return v.sibling(e.firstChild)},contents:function(e){return v.nodeName(e,"iframe")?e.contentDocument||e.contentWindow.document:v.merge([],e.childNodes)}},function(e,t){v.fn[e]=function(n,r){var i=v.map(this,t,n);return nt.test(e)||(r=n),r&&typeof r=="string"&&(i=v.filter(r,i)),i=this.length>1&&!ot[e]?v.unique(i):i,this.length>1&&rt.test(e)&&(i=i.reverse()),this.pushStack(i,e,l.call(arguments).join(","))}}),v.extend({filter:function(e,t,n){return n&&(e=":not("+e+")"),t.length===1?v.find.matchesSelector(t[0],e)?[t[0]]:[]:v.find.matches(e,t)},dir:function(e,n,r){var i=[],s=e[n];while(s&&s.nodeType!==9&&(r===t||s.nodeType!==1||!v(s).is(r)))s.nodeType===1&&i.push(s),s=s[n];return i},sibling:function(e,t){var n=[];for(;e;e=e.nextSibling)e.nodeType===1&&e!==t&&n.push(e);return n}});var ct="abbr|article|aside|audio|bdi|canvas|data|datalist|details|figcaption|figure|footer|header|hgroup|mark|meter|nav|output|progress|section|summary|time|video",ht=/ jQuery\d+="(?:null|\d+)"/g,pt=/^\s+/,dt=/<(?!area|br|col|embed|hr|img|input|link|meta|param)(([\w:]+)[^>]*)\/>/gi,vt=/<([\w:]+)/,mt=/<tbody/i,gt=/<|&#?\w+;/,yt=/<(?:script|style|link)/i,bt=/<(?:script|object|embed|option|style)/i,wt=new RegExp("<(?:"+ct+")[\\s/>]","i"),Et=/^(?:checkbox|radio)$/,St=/checked\s*(?:[^=]|=\s*.checked.)/i,xt=/\/(java|ecma)script/i,Tt=/^\s*<!(?:\[CDATA\[|\-\-)|[\]\-]{2}>\s*$/g,Nt={option:[1,"<select multiple='multiple'>","</select>"],legend:[1,"<fieldset>","</fieldset>"],thead:[1,"<table>","</table>"],tr:[2,"<table><tbody>","</tbody></table>"],td:[3,"<table><tbody><tr>","</tr></tbody></table>"],col:[2,"<table><tbody></tbody><colgroup>","</colgroup></table>"],area:[1,"<map>","</map>"],_default:[0,"",""]},Ct=lt(i),kt=Ct.appendChild(i.createElement("div"));Nt.optgroup=Nt.option,Nt.tbody=Nt.tfoot=Nt.colgroup=Nt.caption=Nt.thead,Nt.th=Nt.td,v.support.htmlSerialize||(Nt._default=[1,"X<div>","</div>"]),v.fn.extend({text:function(e){return v.access(this,function(e){return e===t?v.text(this):this.empty().append((this[0]&&this[0].ownerDocument||i).createTextNode(e))},null,e,arguments.length)},wrapAll:function(e){if(v.isFunction(e))return this.each(function(t){v(this).wrapAll(e.call(this,t))});if(this[0]){var t=v(e,this[0].ownerDocument).eq(0).clone(!0);this[0].parentNode&&t.insertBefore(this[0]),t.map(function(){var e=this;while(e.firstChild&&e.firstChild.nodeType===1)e=e.firstChild;return e}).append(this)}return this},wrapInner:function(e){return v.isFunction(e)?this.each(function(t){v(this).wrapInner(e.call(this,t))}):this.each(function(){var t=v(this),n=t.contents();n.length?n.wrapAll(e):t.append(e)})},wrap:function(e){var t=v.isFunction(e);return this.each(function(n){v(this).wrapAll(t?e.call(this,n):e)})},unwrap:function(){return this.parent().each(function(){v.nodeName(this,"body")||v(this).replaceWith(this.childNodes)}).end()},append:function(){return this.domManip(arguments,!0,function(e){(this.nodeType===1||this.nodeType===11)&&this.appendChild(e)})},prepend:function(){return this.domManip(arguments,!0,function(e){(this.nodeType===1||this.nodeType===11)&&this.insertBefore(e,this.firstChild)})},before:function(){if(!ut(this[0]))return this.domManip(arguments,!1,function(e){this.parentNode.insertBefore(e,this)});if(arguments.length){var e=v.clean(arguments);return this.pushStack(v.merge(e,this),"before",this.selector)}},after:function(){if(!ut(this[0]))return this.domManip(arguments,!1,function(e){this.parentNode.insertBefore(e,this.nextSibling)});if(arguments.length){var e=v.clean(arguments);return this.pushStack(v.merge(this,e),"after",this.selector)}},remove:function(e,t){var n,r=0;for(;(n=this[r])!=null;r++)if(!e||v.filter(e,[n]).length)!t&&n.nodeType===1&&(v.cleanData(n.getElementsByTagName("*")),v.cleanData([n])),n.parentNode&&n.parentNode.removeChild(n);return this},empty:function(){var e,t=0;for(;(e=this[t])!=null;t++){e.nodeType===1&&v.cleanData(e.getElementsByTagName("*"));while(e.firstChild)e.removeChild(e.firstChild)}return this},clone:function(e,t){return e=e==null?!1:e,t=t==null?e:t,this.map(function(){return v.clone(this,e,t)})},html:function(e){return v.access(this,function(e){var n=this[0]||{},r=0,i=this.length;if(e===t)return n.nodeType===1?n.innerHTML.replace(ht,""):t;if(typeof e=="string"&&!yt.test(e)&&(v.support.htmlSerialize||!wt.test(e))&&(v.support.leadingWhitespace||!pt.test(e))&&!Nt[(vt.exec(e)||["",""])[1].toLowerCase()]){e=e.replace(dt,"<$1></$2>");try{for(;r<i;r++)n=this[r]||{},n.nodeType===1&&(v.cleanData(n.getElementsByTagName("*")),n.innerHTML=e);n=0}catch(s){}}n&&this.empty().append(e)},null,e,arguments.length)},replaceWith:function(e){return ut(this[0])?this.length?this.pushStack(v(v.isFunction(e)?e():e),"replaceWith",e):this:v.isFunction(e)?this.each(function(t){var n=v(this),r=n.html();n.replaceWith(e.call(this,t,r))}):(typeof e!="string"&&(e=v(e).detach()),this.each(function(){var t=this.nextSibling,n=this.parentNode;v(this).remove(),t?v(t).before(e):v(n).append(e)}))},detach:function(e){return this.remove(e,!0)},domManip:function(e,n,r){e=[].concat.apply([],e);var i,s,o,u,a=0,f=e[0],l=[],c=this.length;if(!v.support.checkClone&&c>1&&typeof f=="string"&&St.test(f))return this.each(function(){v(this).domManip(e,n,r)});if(v.isFunction(f))return this.each(function(i){var s=v(this);e[0]=f.call(this,i,n?s.html():t),s.domManip(e,n,r)});if(this[0]){i=v.buildFragment(e,this,l),o=i.fragment,s=o.firstChild,o.childNodes.length===1&&(o=s);if(s){n=n&&v.nodeName(s,"tr");for(u=i.cacheable||c-1;a<c;a++)r.call(n&&v.nodeName(this[a],"table")?Lt(this[a],"tbody"):this[a],a===u?o:v.clone(o,!0,!0))}o=s=null,l.length&&v.each(l,function(e,t){t.src?v.ajax?v.ajax({url:t.src,type:"GET",dataType:"script",async:!1,global:!1,"throws":!0}):v.error("no ajax"):v.globalEval((t.text||t.textContent||t.innerHTML||"").replace(Tt,"")),t.parentNode&&t.parentNode.removeChild(t)})}return this}}),v.buildFragment=function(e,n,r){var s,o,u,a=e[0];return n=n||i,n=!n.nodeType&&n[0]||n,n=n.ownerDocument||n,e.length===1&&typeof a=="string"&&a.length<512&&n===i&&a.charAt(0)==="<"&&!bt.test(a)&&(v.support.checkClone||!St.test(a))&&(v.support.html5Clone||!wt.test(a))&&(o=!0,s=v.fragments[a],u=s!==t),s||(s=n.createDocumentFragment(),v.clean(e,n,s,r),o&&(v.fragments[a]=u&&s)),{fragment:s,cacheable:o}},v.fragments={},v.each({appendTo:"append",prependTo:"prepend",insertBefore:"before",insertAfter:"after",replaceAll:"replaceWith"},function(e,t){v.fn[e]=function(n){var r,i=0,s=[],o=v(n),u=o.length,a=this.length===1&&this[0].parentNode;if((a==null||a&&a.nodeType===11&&a.childNodes.length===1)&&u===1)return o[t](this[0]),this;for(;i<u;i++)r=(i>0?this.clone(!0):this).get(),v(o[i])[t](r),s=s.concat(r);return this.pushStack(s,e,o.selector)}}),v.extend({clone:function(e,t,n){var r,i,s,o;v.support.html5Clone||v.isXMLDoc(e)||!wt.test("<"+e.nodeName+">")?o=e.cloneNode(!0):(kt.innerHTML=e.outerHTML,kt.removeChild(o=kt.firstChild));if((!v.support.noCloneEvent||!v.support.noCloneChecked)&&(e.nodeType===1||e.nodeType===11)&&!v.isXMLDoc(e)){Ot(e,o),r=Mt(e),i=Mt(o);for(s=0;r[s];++s)i[s]&&Ot(r[s],i[s])}if(t){At(e,o);if(n){r=Mt(e),i=Mt(o);for(s=0;r[s];++s)At(r[s],i[s])}}return r=i=null,o},clean:function(e,t,n,r){var s,o,u,a,f,l,c,h,p,d,m,g,y=t===i&&Ct,b=[];if(!t||typeof t.createDocumentFragment=="undefined")t=i;for(s=0;(u=e[s])!=null;s++){typeof u=="number"&&(u+="");if(!u)continue;if(typeof u=="string")if(!gt.test(u))u=t.createTextNode(u);else{y=y||lt(t),c=t.createElement("div"),y.appendChild(c),u=u.replace(dt,"<$1></$2>"),a=(vt.exec(u)||["",""])[1].toLowerCase(),f=Nt[a]||Nt._default,l=f[0],c.innerHTML=f[1]+u+f[2];while(l--)c=c.lastChild;if(!v.support.tbody){h=mt.test(u),p=a==="table"&&!h?c.firstChild&&c.firstChild.childNodes:f[1]==="<table>"&&!h?c.childNodes:[];for(o=p.length-1;o>=0;--o)v.nodeName(p[o],"tbody")&&!p[o].childNodes.length&&p[o].parentNode.removeChild(p[o])}!v.support.leadingWhitespace&&pt.test(u)&&c.insertBefore(t.createTextNode(pt.exec(u)[0]),c.firstChild),u=c.childNodes,c.parentNode.removeChild(c)}u.nodeType?b.push(u):v.merge(b,u)}c&&(u=c=y=null);if(!v.support.appendChecked)for(s=0;(u=b[s])!=null;s++)v.nodeName(u,"input")?_t(u):typeof u.getElementsByTagName!="undefined"&&v.grep(u.getElementsByTagName("input"),_t);if(n){m=function(e){if(!e.type||xt.test(e.type))return r?r.push(e.parentNode?e.parentNode.removeChild(e):e):n.appendChild(e)};for(s=0;(u=b[s])!=null;s++)if(!v.nodeName(u,"script")||!m(u))n.appendChild(u),typeof u.getElementsByTagName!="undefined"&&(g=v.grep(v.merge([],u.getElementsByTagName("script")),m),b.splice.apply(b,[s+1,0].concat(g)),s+=g.length)}return b},cleanData:function(e,t){var n,r,i,s,o=0,u=v.expando,a=v.cache,f=v.support.deleteExpando,l=v.event.special;for(;(i=e[o])!=null;o++)if(t||v.acceptData(i)){r=i[u],n=r&&a[r];if(n){if(n.events)for(s in n.events)l[s]?v.event.remove(i,s):v.removeEvent(i,s,n.handle);a[r]&&(delete a[r],f?delete i[u]:i.removeAttribute?i.removeAttribute(u):i[u]=null,v.deletedIds.push(r))}}}}),function(){var e,t;v.uaMatch=function(e){e=e.toLowerCase();var t=/(chrome)[ \/]([\w.]+)/.exec(e)||/(webkit)[ \/]([\w.]+)/.exec(e)||/(opera)(?:.*version|)[ \/]([\w.]+)/.exec(e)||/(msie) ([\w.]+)/.exec(e)||e.indexOf("compatible")<0&&/(mozilla)(?:.*? rv:([\w.]+)|)/.exec(e)||[];return{browser:t[1]||"",version:t[2]||"0"}},e=v.uaMatch(o.userAgent),t={},e.browser&&(t[e.browser]=!0,t.version=e.version),t.chrome?t.webkit=!0:t.webkit&&(t.safari=!0),v.browser=t,v.sub=function(){function e(t,n){return new e.fn.init(t,n)}v.extend(!0,e,this),e.superclass=this,e.fn=e.prototype=this(),e.fn.constructor=e,e.sub=this.sub,e.fn.init=function(r,i){return i&&i instanceof v&&!(i instanceof e)&&(i=e(i)),v.fn.init.call(this,r,i,t)},e.fn.init.prototype=e.fn;var t=e(i);return e}}();var Dt,Pt,Ht,Bt=/alpha\([^)]*\)/i,jt=/opacity=([^)]*)/,Ft=/^(top|right|bottom|left)$/,It=/^(none|table(?!-c[ea]).+)/,qt=/^margin/,Rt=new RegExp("^("+m+")(.*)$","i"),Ut=new RegExp("^("+m+")(?!px)[a-z%]+$","i"),zt=new RegExp("^([-+])=("+m+")","i"),Wt={BODY:"block"},Xt={position:"absolute",visibility:"hidden",display:"block"},Vt={letterSpacing:0,fontWeight:400},$t=["Top","Right","Bottom","Left"],Jt=["Webkit","O","Moz","ms"],Kt=v.fn.toggle;v.fn.extend({css:function(e,n){return v.access(this,function(e,n,r){return r!==t?v.style(e,n,r):v.css(e,n)},e,n,arguments.length>1)},show:function(){return Yt(this,!0)},hide:function(){return Yt(this)},toggle:function(e,t){var n=typeof e=="boolean";return v.isFunction(e)&&v.isFunction(t)?Kt.apply(this,arguments):this.each(function(){(n?e:Gt(this))?v(this).show():v(this).hide()})}}),v.extend({cssHooks:{opacity:{get:function(e,t){if(t){var n=Dt(e,"opacity");return n===""?"1":n}}}},cssNumber:{fillOpacity:!0,fontWeight:!0,lineHeight:!0,opacity:!0,orphans:!0,widows:!0,zIndex:!0,zoom:!0},cssProps:{"float":v.support.cssFloat?"cssFloat":"styleFloat"},style:function(e,n,r,i){if(!e||e.nodeType===3||e.nodeType===8||!e.style)return;var s,o,u,a=v.camelCase(n),f=e.style;n=v.cssProps[a]||(v.cssProps[a]=Qt(f,a)),u=v.cssHooks[n]||v.cssHooks[a];if(r===t)return u&&"get"in u&&(s=u.get(e,!1,i))!==t?s:f[n];o=typeof r,o==="string"&&(s=zt.exec(r))&&(r=(s[1]+1)*s[2]+parseFloat(v.css(e,n)),o="number");if(r==null||o==="number"&&isNaN(r))return;o==="number"&&!v.cssNumber[a]&&(r+="px");if(!u||!("set"in u)||(r=u.set(e,r,i))!==t)try{f[n]=r}catch(l){}},css:function(e,n,r,i){var s,o,u,a=v.camelCase(n);return n=v.cssProps[a]||(v.cssProps[a]=Qt(e.style,a)),u=v.cssHooks[n]||v.cssHooks[a],u&&"get"in u&&(s=u.get(e,!0,i)),s===t&&(s=Dt(e,n)),s==="normal"&&n in Vt&&(s=Vt[n]),r||i!==t?(o=parseFloat(s),r||v.isNumeric(o)?o||0:s):s},swap:function(e,t,n){var r,i,s={};for(i in t)s[i]=e.style[i],e.style[i]=t[i];r=n.call(e);for(i in t)e.style[i]=s[i];return r}}),e.getComputedStyle?Dt=function(t,n){var r,i,s,o,u=e.getComputedStyle(t,null),a=t.style;return u&&(r=u.getPropertyValue(n)||u[n],r===""&&!v.contains(t.ownerDocument,t)&&(r=v.style(t,n)),Ut.test(r)&&qt.test(n)&&(i=a.width,s=a.minWidth,o=a.maxWidth,a.minWidth=a.maxWidth=a.width=r,r=u.width,a.width=i,a.minWidth=s,a.maxWidth=o)),r}:i.documentElement.currentStyle&&(Dt=function(e,t){var n,r,i=e.currentStyle&&e.currentStyle[t],s=e.style;return i==null&&s&&s[t]&&(i=s[t]),Ut.test(i)&&!Ft.test(t)&&(n=s.left,r=e.runtimeStyle&&e.runtimeStyle.left,r&&(e.runtimeStyle.left=e.currentStyle.left),s.left=t==="fontSize"?"1em":i,i=s.pixelLeft+"px",s.left=n,r&&(e.runtimeStyle.left=r)),i===""?"auto":i}),v.each(["height","width"],function(e,t){v.cssHooks[t]={get:function(e,n,r){if(n)return e.offsetWidth===0&&It.test(Dt(e,"display"))?v.swap(e,Xt,function(){return tn(e,t,r)}):tn(e,t,r)},set:function(e,n,r){return Zt(e,n,r?en(e,t,r,v.support.boxSizing&&v.css(e,"boxSizing")==="border-box"):0)}}}),v.support.opacity||(v.cssHooks.opacity={get:function(e,t){return jt.test((t&&e.currentStyle?e.currentStyle.filter:e.style.filter)||"")?.01*parseFloat(RegExp.$1)+"":t?"1":""},set:function(e,t){var n=e.style,r=e.currentStyle,i=v.isNumeric(t)?"alpha(opacity="+t*100+")":"",s=r&&r.filter||n.filter||"";n.zoom=1;if(t>=1&&v.trim(s.replace(Bt,""))===""&&n.removeAttribute){n.removeAttribute("filter");if(r&&!r.filter)return}n.filter=Bt.test(s)?s.replace(Bt,i):s+" "+i}}),v(function(){v.support.reliableMarginRight||(v.cssHooks.marginRight={get:function(e,t){return v.swap(e,{display:"inline-block"},function(){if(t)return Dt(e,"marginRight")})}}),!v.support.pixelPosition&&v.fn.position&&v.each(["top","left"],function(e,t){v.cssHooks[t]={get:function(e,n){if(n){var r=Dt(e,t);return Ut.test(r)?v(e).position()[t]+"px":r}}}})}),v.expr&&v.expr.filters&&(v.expr.filters.hidden=function(e){return e.offsetWidth===0&&e.offsetHeight===0||!v.support.reliableHiddenOffsets&&(e.style&&e.style.display||Dt(e,"display"))==="none"},v.expr.filters.visible=function(e){return!v.expr.filters.hidden(e)}),v.each({margin:"",padding:"",border:"Width"},function(e,t){v.cssHooks[e+t]={expand:function(n){var r,i=typeof n=="string"?n.split(" "):[n],s={};for(r=0;r<4;r++)s[e+$t[r]+t]=i[r]||i[r-2]||i[0];return s}},qt.test(e)||(v.cssHooks[e+t].set=Zt)});var rn=/%20/g,sn=/\[\]$/,on=/\r?\n/g,un=/^(?:color|date|datetime|datetime-local|email|hidden|month|number|password|range|search|tel|text|time|url|week)$/i,an=/^(?:select|textarea)/i;v.fn.extend({serialize:function(){return v.param(this.serializeArray())},serializeArray:function(){return this.map(function(){return this.elements?v.makeArray(this.elements):this}).filter(function(){return this.name&&!this.disabled&&(this.checked||an.test(this.nodeName)||un.test(this.type))}).map(function(e,t){var n=v(this).val();return n==null?null:v.isArray(n)?v.map(n,function(e,n){return{name:t.name,value:e.replace(on,"\r\n")}}):{name:t.name,value:n.replace(on,"\r\n")}}).get()}}),v.param=function(e,n){var r,i=[],s=function(e,t){t=v.isFunction(t)?t():t==null?"":t,i[i.length]=encodeURIComponent(e)+"="+encodeURIComponent(t)};n===t&&(n=v.ajaxSettings&&v.ajaxSettings.traditional);if(v.isArray(e)||e.jquery&&!v.isPlainObject(e))v.each(e,function(){s(this.name,this.value)});else for(r in e)fn(r,e[r],n,s);return i.join("&").replace(rn,"+")};var ln,cn,hn=/#.*$/,pn=/^(.*?):[ \t]*([^\r\n]*)\r?$/mg,dn=/^(?:about|app|app\-storage|.+\-extension|file|res|widget):$/,vn=/^(?:GET|HEAD)$/,mn=/^\/\//,gn=/\?/,yn=/<script\b[^<]*(?:(?!<\/script>)<[^<]*)*<\/script>/gi,bn=/([?&])_=[^&]*/,wn=/^([\w\+\.\-]+:)(?:\/\/([^\/?#:]*)(?::(\d+)|)|)/,En=v.fn.load,Sn={},xn={},Tn=["*/"]+["*"];try{cn=s.href}catch(Nn){cn=i.createElement("a"),cn.href="",cn=cn.href}ln=wn.exec(cn.toLowerCase())||[],v.fn.load=function(e,n,r){if(typeof e!="string"&&En)return En.apply(this,arguments);if(!this.length)return this;var i,s,o,u=this,a=e.indexOf(" ");return a>=0&&(i=e.slice(a,e.length),e=e.slice(0,a)),v.isFunction(n)?(r=n,n=t):n&&typeof n=="object"&&(s="POST"),v.ajax({url:e,type:s,dataType:"html",data:n,complete:function(e,t){r&&u.each(r,o||[e.responseText,t,e])}}).done(function(e){o=arguments,u.html(i?v("<div>").append(e.replace(yn,"")).find(i):e)}),this},v.each("ajaxStart ajaxStop ajaxComplete ajaxError ajaxSuccess ajaxSend".split(" "),function(e,t){v.fn[t]=function(e){return this.on(t,e)}}),v.each(["get","post"],function(e,n){v[n]=function(e,r,i,s){return v.isFunction(r)&&(s=s||i,i=r,r=t),v.ajax({type:n,url:e,data:r,success:i,dataType:s})}}),v.extend({getScript:function(e,n){return v.get(e,t,n,"script")},getJSON:function(e,t,n){return v.get(e,t,n,"json")},ajaxSetup:function(e,t){return t?Ln(e,v.ajaxSettings):(t=e,e=v.ajaxSettings),Ln(e,t),e},ajaxSettings:{url:cn,isLocal:dn.test(ln[1]),global:!0,type:"GET",contentType:"application/x-www-form-urlencoded; charset=UTF-8",processData:!0,async:!0,accepts:{xml:"application/xml, text/xml",html:"text/html",text:"text/plain",json:"application/json, text/javascript","*":Tn},contents:{xml:/xml/,html:/html/,json:/json/},responseFields:{xml:"responseXML",text:"responseText"},converters:{"* text":e.String,"text html":!0,"text json":v.parseJSON,"text xml":v.parseXML},flatOptions:{context:!0,url:!0}},ajaxPrefilter:Cn(Sn),ajaxTransport:Cn(xn),ajax:function(e,n){function T(e,n,s,a){var l,y,b,w,S,T=n;if(E===2)return;E=2,u&&clearTimeout(u),o=t,i=a||"",x.readyState=e>0?4:0,s&&(w=An(c,x,s));if(e>=200&&e<300||e===304)c.ifModified&&(S=x.getResponseHeader("Last-Modified"),S&&(v.lastModified[r]=S),S=x.getResponseHeader("Etag"),S&&(v.etag[r]=S)),e===304?(T="notmodified",l=!0):(l=On(c,w),T=l.state,y=l.data,b=l.error,l=!b);else{b=T;if(!T||e)T="error",e<0&&(e=0)}x.status=e,x.statusText=(n||T)+"",l?d.resolveWith(h,[y,T,x]):d.rejectWith(h,[x,T,b]),x.statusCode(g),g=t,f&&p.trigger("ajax"+(l?"Success":"Error"),[x,c,l?y:b]),m.fireWith(h,[x,T]),f&&(p.trigger("ajaxComplete",[x,c]),--v.active||v.event.trigger("ajaxStop"))}typeof e=="object"&&(n=e,e=t),n=n||{};var r,i,s,o,u,a,f,l,c=v.ajaxSetup({},n),h=c.context||c,p=h!==c&&(h.nodeType||h instanceof v)?v(h):v.event,d=v.Deferred(),m=v.Callbacks("once memory"),g=c.statusCode||{},b={},w={},E=0,S="canceled",x={readyState:0,setRequestHeader:function(e,t){if(!E){var n=e.toLowerCase();e=w[n]=w[n]||e,b[e]=t}return this},getAllResponseHeaders:function(){return E===2?i:null},getResponseHeader:function(e){var n;if(E===2){if(!s){s={};while(n=pn.exec(i))s[n[1].toLowerCase()]=n[2]}n=s[e.toLowerCase()]}return n===t?null:n},overrideMimeType:function(e){return E||(c.mimeType=e),this},abort:function(e){return e=e||S,o&&o.abort(e),T(0,e),this}};d.promise(x),x.success=x.done,x.error=x.fail,x.complete=m.add,x.statusCode=function(e){if(e){var t;if(E<2)for(t in e)g[t]=[g[t],e[t]];else t=e[x.status],x.always(t)}return this},c.url=((e||c.url)+"").replace(hn,"").replace(mn,ln[1]+"//"),c.dataTypes=v.trim(c.dataType||"*").toLowerCase().split(y),c.crossDomain==null&&(a=wn.exec(c.url.toLowerCase()),c.crossDomain=!(!a||a[1]===ln[1]&&a[2]===ln[2]&&(a[3]||(a[1]==="http:"?80:443))==(ln[3]||(ln[1]==="http:"?80:443)))),c.data&&c.processData&&typeof c.data!="string"&&(c.data=v.param(c.data,c.traditional)),kn(Sn,c,n,x);if(E===2)return x;f=c.global,c.type=c.type.toUpperCase(),c.hasContent=!vn.test(c.type),f&&v.active++===0&&v.event.trigger("ajaxStart");if(!c.hasContent){c.data&&(c.url+=(gn.test(c.url)?"&":"?")+c.data,delete c.data),r=c.url;if(c.cache===!1){var N=v.now(),C=c.url.replace(bn,"$1_="+N);c.url=C+(C===c.url?(gn.test(c.url)?"&":"?")+"_="+N:"")}}(c.data&&c.hasContent&&c.contentType!==!1||n.contentType)&&x.setRequestHeader("Content-Type",c.contentType),c.ifModified&&(r=r||c.url,v.lastModified[r]&&x.setRequestHeader("If-Modified-Since",v.lastModified[r]),v.etag[r]&&x.setRequestHeader("If-None-Match",v.etag[r])),x.setRequestHeader("Accept",c.dataTypes[0]&&c.accepts[c.dataTypes[0]]?c.accepts[c.dataTypes[0]]+(c.dataTypes[0]!=="*"?", "+Tn+"; q=0.01":""):c.accepts["*"]);for(l in c.headers)x.setRequestHeader(l,c.headers[l]);if(!c.beforeSend||c.beforeSend.call(h,x,c)!==!1&&E!==2){S="abort";for(l in{success:1,error:1,complete:1})x[l](c[l]);o=kn(xn,c,n,x);if(!o)T(-1,"No Transport");else{x.readyState=1,f&&p.trigger("ajaxSend",[x,c]),c.async&&c.timeout>0&&(u=setTimeout(function(){x.abort("timeout")},c.timeout));try{E=1,o.send(b,T)}catch(k){if(!(E<2))throw k;T(-1,k)}}return x}return x.abort()},active:0,lastModified:{},etag:{}});var Mn=[],_n=/\?/,Dn=/(=)\?(?=&|$)|\?\?/,Pn=v.now();v.ajaxSetup({jsonp:"callback",jsonpCallback:function(){var e=Mn.pop()||v.expando+"_"+Pn++;return this[e]=!0,e}}),v.ajaxPrefilter("json jsonp",function(n,r,i){var s,o,u,a=n.data,f=n.url,l=n.jsonp!==!1,c=l&&Dn.test(f),h=l&&!c&&typeof a=="string"&&!(n.contentType||"").indexOf("application/x-www-form-urlencoded")&&Dn.test(a);if(n.dataTypes[0]==="jsonp"||c||h)return s=n.jsonpCallback=v.isFunction(n.jsonpCallback)?n.jsonpCallback():n.jsonpCallback,o=e[s],c?n.url=f.replace(Dn,"$1"+s):h?n.data=a.replace(Dn,"$1"+s):l&&(n.url+=(_n.test(f)?"&":"?")+n.jsonp+"="+s),n.converters["script json"]=function(){return u||v.error(s+" was not called"),u[0]},n.dataTypes[0]="json",e[s]=function(){u=arguments},i.always(function(){e[s]=o,n[s]&&(n.jsonpCallback=r.jsonpCallback,Mn.push(s)),u&&v.isFunction(o)&&o(u[0]),u=o=t}),"script"}),v.ajaxSetup({accepts:{script:"text/javascript, application/javascript, application/ecmascript, application/x-ecmascript"},contents:{script:/javascript|ecmascript/},converters:{"text script":function(e){return v.globalEval(e),e}}}),v.ajaxPrefilter("script",function(e){e.cache===t&&(e.cache=!1),e.crossDomain&&(e.type="GET",e.global=!1)}),v.ajaxTransport("script",function(e){if(e.crossDomain){var n,r=i.head||i.getElementsByTagName("head")[0]||i.documentElement;return{send:function(s,o){n=i.createElement("script"),n.async="async",e.scriptCharset&&(n.charset=e.scriptCharset),n.src=e.url,n.onload=n.onreadystatechange=function(e,i){if(i||!n.readyState||/loaded|complete/.test(n.readyState))n.onload=n.onreadystatechange=null,r&&n.parentNode&&r.removeChild(n),n=t,i||o(200,"success")},r.insertBefore(n,r.firstChild)},abort:function(){n&&n.onload(0,1)}}}});var Hn,Bn=e.ActiveXObject?function(){for(var e in Hn)Hn[e](0,1)}:!1,jn=0;v.ajaxSettings.xhr=e.ActiveXObject?function(){return!this.isLocal&&Fn()||In()}:Fn,function(e){v.extend(v.support,{ajax:!!e,cors:!!e&&"withCredentials"in e})}(v.ajaxSettings.xhr()),v.support.ajax&&v.ajaxTransport(function(n){if(!n.crossDomain||v.support.cors){var r;return{send:function(i,s){var o,u,a=n.xhr();n.username?a.open(n.type,n.url,n.async,n.username,n.password):a.open(n.type,n.url,n.async);if(n.xhrFields)for(u in n.xhrFields)a[u]=n.xhrFields[u];n.mimeType&&a.overrideMimeType&&a.overrideMimeType(n.mimeType),!n.crossDomain&&!i["X-Requested-With"]&&(i["X-Requested-With"]="XMLHttpRequest");try{for(u in i)a.setRequestHeader(u,i[u])}catch(f){}a.send(n.hasContent&&n.data||null),r=function(e,i){var u,f,l,c,h;try{if(r&&(i||a.readyState===4)){r=t,o&&(a.onreadystatechange=v.noop,Bn&&delete Hn[o]);if(i)a.readyState!==4&&a.abort();else{u=a.status,l=a.getAllResponseHeaders(),c={},h=a.responseXML,h&&h.documentElement&&(c.xml=h);try{c.text=a.responseText}catch(p){}try{f=a.statusText}catch(p){f=""}!u&&n.isLocal&&!n.crossDomain?u=c.text?200:404:u===1223&&(u=204)}}}catch(d){i||s(-1,d)}c&&s(u,f,c,l)},n.async?a.readyState===4?setTimeout(r,0):(o=++jn,Bn&&(Hn||(Hn={},v(e).unload(Bn)),Hn[o]=r),a.onreadystatechange=r):r()},abort:function(){r&&r(0,1)}}}});var qn,Rn,Un=/^(?:toggle|show|hide)$/,zn=new RegExp("^(?:([-+])=|)("+m+")([a-z%]*)$","i"),Wn=/queueHooks$/,Xn=[Gn],Vn={"*":[function(e,t){var n,r,i=this.createTween(e,t),s=zn.exec(t),o=i.cur(),u=+o||0,a=1,f=20;if(s){n=+s[2],r=s[3]||(v.cssNumber[e]?"":"px");if(r!=="px"&&u){u=v.css(i.elem,e,!0)||n||1;do a=a||".5",u/=a,v.style(i.elem,e,u+r);while(a!==(a=i.cur()/o)&&a!==1&&--f)}i.unit=r,i.start=u,i.end=s[1]?u+(s[1]+1)*n:n}return i}]};v.Animation=v.extend(Kn,{tweener:function(e,t){v.isFunction(e)?(t=e,e=["*"]):e=e.split(" ");var n,r=0,i=e.length;for(;r<i;r++)n=e[r],Vn[n]=Vn[n]||[],Vn[n].unshift(t)},prefilter:function(e,t){t?Xn.unshift(e):Xn.push(e)}}),v.Tween=Yn,Yn.prototype={constructor:Yn,init:function(e,t,n,r,i,s){this.elem=e,this.prop=n,this.easing=i||"swing",this.options=t,this.start=this.now=this.cur(),this.end=r,this.unit=s||(v.cssNumber[n]?"":"px")},cur:function(){var e=Yn.propHooks[this.prop];return e&&e.get?e.get(this):Yn.propHooks._default.get(this)},run:function(e){var t,n=Yn.propHooks[this.prop];return this.options.duration?this.pos=t=v.easing[this.easing](e,this.options.duration*e,0,1,this.options.duration):this.pos=t=e,this.now=(this.end-this.start)*t+this.start,this.options.step&&this.options.step.call(this.elem,this.now,this),n&&n.set?n.set(this):Yn.propHooks._default.set(this),this}},Yn.prototype.init.prototype=Yn.prototype,Yn.propHooks={_default:{get:function(e){var t;return e.elem[e.prop]==null||!!e.elem.style&&e.elem.style[e.prop]!=null?(t=v.css(e.elem,e.prop,!1,""),!t||t==="auto"?0:t):e.elem[e.prop]},set:function(e){v.fx.step[e.prop]?v.fx.step[e.prop](e):e.elem.style&&(e.elem.style[v.cssProps[e.prop]]!=null||v.cssHooks[e.prop])?v.style(e.elem,e.prop,e.now+e.unit):e.elem[e.prop]=e.now}}},Yn.propHooks.scrollTop=Yn.propHooks.scrollLeft={set:function(e){e.elem.nodeType&&e.elem.parentNode&&(e.elem[e.prop]=e.now)}},v.each(["toggle","show","hide"],function(e,t){var n=v.fn[t];v.fn[t]=function(r,i,s){return r==null||typeof r=="boolean"||!e&&v.isFunction(r)&&v.isFunction(i)?n.apply(this,arguments):this.animate(Zn(t,!0),r,i,s)}}),v.fn.extend({fadeTo:function(e,t,n,r){return this.filter(Gt).css("opacity",0).show().end().animate({opacity:t},e,n,r)},animate:function(e,t,n,r){var i=v.isEmptyObject(e),s=v.speed(t,n,r),o=function(){var t=Kn(this,v.extend({},e),s);i&&t.stop(!0)};return i||s.queue===!1?this.each(o):this.queue(s.queue,o)},stop:function(e,n,r){var i=function(e){var t=e.stop;delete e.stop,t(r)};return typeof e!="string"&&(r=n,n=e,e=t),n&&e!==!1&&this.queue(e||"fx",[]),this.each(function(){var t=!0,n=e!=null&&e+"queueHooks",s=v.timers,o=v._data(this);if(n)o[n]&&o[n].stop&&i(o[n]);else for(n in o)o[n]&&o[n].stop&&Wn.test(n)&&i(o[n]);for(n=s.length;n--;)s[n].elem===this&&(e==null||s[n].queue===e)&&(s[n].anim.stop(r),t=!1,s.splice(n,1));(t||!r)&&v.dequeue(this,e)})}}),v.each({slideDown:Zn("show"),slideUp:Zn("hide"),slideToggle:Zn("toggle"),fadeIn:{opacity:"show"},fadeOut:{opacity:"hide"},fadeToggle:{opacity:"toggle"}},function(e,t){v.fn[e]=function(e,n,r){return this.animate(t,e,n,r)}}),v.speed=function(e,t,n){var r=e&&typeof e=="object"?v.extend({},e):{complete:n||!n&&t||v.isFunction(e)&&e,duration:e,easing:n&&t||t&&!v.isFunction(t)&&t};r.duration=v.fx.off?0:typeof r.duration=="number"?r.duration:r.duration in v.fx.speeds?v.fx.speeds[r.duration]:v.fx.speeds._default;if(r.queue==null||r.queue===!0)r.queue="fx";return r.old=r.complete,r.complete=function(){v.isFunction(r.old)&&r.old.call(this),r.queue&&v.dequeue(this,r.queue)},r},v.easing={linear:function(e){return e},swing:function(e){return.5-Math.cos(e*Math.PI)/2}},v.timers=[],v.fx=Yn.prototype.init,v.fx.tick=function(){var e,n=v.timers,r=0;qn=v.now();for(;r<n.length;r++)e=n[r],!e()&&n[r]===e&&n.splice(r--,1);n.length||v.fx.stop(),qn=t},v.fx.timer=function(e){e()&&v.timers.push(e)&&!Rn&&(Rn=setInterval(v.fx.tick,v.fx.interval))},v.fx.interval=13,v.fx.stop=function(){clearInterval(Rn),Rn=null},v.fx.speeds={slow:600,fast:200,_default:400},v.fx.step={},v.expr&&v.expr.filters&&(v.expr.filters.animated=function(e){return v.grep(v.timers,function(t){return e===t.elem}).length});var er=/^(?:body|html)$/i;v.fn.offset=function(e){if(arguments.length)return e===t?this:this.each(function(t){v.offset.setOffset(this,e,t)});var n,r,i,s,o,u,a,f={top:0,left:0},l=this[0],c=l&&l.ownerDocument;if(!c)return;return(r=c.body)===l?v.offset.bodyOffset(l):(n=c.documentElement,v.contains(n,l)?(typeof l.getBoundingClientRect!="undefined"&&(f=l.getBoundingClientRect()),i=tr(c),s=n.clientTop||r.clientTop||0,o=n.clientLeft||r.clientLeft||0,u=i.pageYOffset||n.scrollTop,a=i.pageXOffset||n.scrollLeft,{top:f.top+u-s,left:f.left+a-o}):f)},v.offset={bodyOffset:function(e){var t=e.offsetTop,n=e.offsetLeft;return v.support.doesNotIncludeMarginInBodyOffset&&(t+=parseFloat(v.css(e,"marginTop"))||0,n+=parseFloat(v.css(e,"marginLeft"))||0),{top:t,left:n}},setOffset:function(e,t,n){var r=v.css(e,"position");r==="static"&&(e.style.position="relative");var i=v(e),s=i.offset(),o=v.css(e,"top"),u=v.css(e,"left"),a=(r==="absolute"||r==="fixed")&&v.inArray("auto",[o,u])>-1,f={},l={},c,h;a?(l=i.position(),c=l.top,h=l.left):(c=parseFloat(o)||0,h=parseFloat(u)||0),v.isFunction(t)&&(t=t.call(e,n,s)),t.top!=null&&(f.top=t.top-s.top+c),t.left!=null&&(f.left=t.left-s.left+h),"using"in t?t.using.call(e,f):i.css(f)}},v.fn.extend({position:function(){if(!this[0])return;var e=this[0],t=this.offsetParent(),n=this.offset(),r=er.test(t[0].nodeName)?{top:0,left:0}:t.offset();return n.top-=parseFloat(v.css(e,"marginTop"))||0,n.left-=parseFloat(v.css(e,"marginLeft"))||0,r.top+=parseFloat(v.css(t[0],"borderTopWidth"))||0,r.left+=parseFloat(v.css(t[0],"borderLeftWidth"))||0,{top:n.top-r.top,left:n.left-r.left}},offsetParent:function(){return this.map(function(){var e=this.offsetParent||i.body;while(e&&!er.test(e.nodeName)&&v.css(e,"position")==="static")e=e.offsetParent;return e||i.body})}}),v.each({scrollLeft:"pageXOffset",scrollTop:"pageYOffset"},function(e,n){var r=/Y/.test(n);v.fn[e]=function(i){return v.access(this,function(e,i,s){var o=tr(e);if(s===t)return o?n in o?o[n]:o.document.documentElement[i]:e[i];o?o.scrollTo(r?v(o).scrollLeft():s,r?s:v(o).scrollTop()):e[i]=s},e,i,arguments.length,null)}}),v.each({Height:"height",Width:"width"},function(e,n){v.each({padding:"inner"+e,content:n,"":"outer"+e},function(r,i){v.fn[i]=function(i,s){var o=arguments.length&&(r||typeof i!="boolean"),u=r||(i===!0||s===!0?"margin":"border");return v.access(this,function(n,r,i){var s;return v.isWindow(n)?n.document.documentElement["client"+e]:n.nodeType===9?(s=n.documentElement,Math.max(n.body["scroll"+e],s["scroll"+e],n.body["offset"+e],s["offset"+e],s["client"+e])):i===t?v.css(n,r,i,u):v.style(n,r,i,u)},n,o?i:t,o,null)}})}),e.jQuery=e.$=v,typeof define=="function"&&define.amd&&define.amd.jQuery&&define("jquery",[],function(){return v})})(window); | ||
</script> | </script> | ||
<script type="text/javascript"> | <script type="text/javascript"> | ||
− | window.jQuery || document.write('\x3Cscript src=" | + | window.jQuery || document.write('\x3Cscript src="https://2015.igem.org/Team:Mingdao/Javascript-jquery-1.8.3? |
+ | action=raw&ctype=text/javascript" type="text/javascript">\x3C/script>'); | ||
</script> | </script> | ||
<script src="https://2015.igem.org/Team:Mingdao/Javascript-museutils? | <script src="https://2015.igem.org/Team:Mingdao/Javascript-museutils? | ||
− | action=raw&ctype=text/javascript" type="text/javascript"></script> | + | action=raw&ctype=text/javascript" type="text/javascript"></script> |
<script src="https://2015.igem.org/Team:Mingdao/Javascript-jquery.watch? | <script src="https://2015.igem.org/Team:Mingdao/Javascript-jquery.watch? | ||
− | action=raw&ctype=text/javascript" type="text/javascript"></script> | + | action=raw&ctype=text/javascript" type="text/javascript"></script> |
<script src="https://2015.igem.org/Team:Mingdao/Javascript-jquery.musemenu? | <script src="https://2015.igem.org/Team:Mingdao/Javascript-jquery.musemenu? | ||
− | action=raw&ctype=text/javascript" type="text/javascript"></script> | + | action=raw&ctype=text/javascript" type="text/javascript"></script> |
+ | <!-- Other scripts --> | ||
+ | <script>if (window.runOnloadHook) runOnloadHook();</script> | ||
+ | <!-- JS includes --> | ||
+ | <script type="text/javascript"> | ||
+ | if (document.location.protocol != 'https:') document.write('\x3Cscript src="http://musecdn.businesscatalyst.com/scripts/4.0/jquery-1.8.3.min.js" type="text/javascript">\x3C/script>'); | ||
+ | </script> | ||
+ | <script type="text/javascript"> | ||
+ | window.jQuery || document.write('\x3Cscript src="scripts/jquery-1.8.3.min.js" type="text/javascript">\x3C/script>'); | ||
+ | </script> | ||
+ | <script src="https://2014hs.igem.org/Mingdao_JS_museutils?action=raw&ctype=text/javascript" type="text/javascript"></script> | ||
+ | <script src="https://2014hs.igem.org/Mingdao_JS_jquery.tobrowserwidth?action=raw&ctype=text/javascript" type="text/javascript"></script> | ||
+ | <script src="https://2014hs.igem.org/Mingdao_JS_jquery.musemenu?action=raw&ctype=text/javascript" type="text/javascript"></script> | ||
+ | <script src="https://2014hs.igem.org/Mingdao_JS_jquery.watch?action=raw&ctype=text/javascript" type="text/javascript"></script> | ||
+ | <script src="https://2014hs.igem.org/Mingdao_JS_jquery.scrolleffects?action=raw&ctype=text/javascript" type="text/javascript"></script> | ||
<!-- Other scripts --> | <!-- Other scripts --> | ||
<script type="text/javascript"> | <script type="text/javascript"> | ||
$(document).ready(function() { try { | $(document).ready(function() { try { | ||
− | |||
− | |||
− | |||
− | |||
Muse.Utils.transformMarkupToFixBrowserProblemsPreInit();/* body */ | Muse.Utils.transformMarkupToFixBrowserProblemsPreInit();/* body */ | ||
+ | $('.browser_width').toBrowserWidth();/* browser width elements */ | ||
Muse.Utils.prepHyperlinks(true);/* body */ | Muse.Utils.prepHyperlinks(true);/* body */ | ||
− | |||
Muse.Utils.initWidget('.MenuBar', function(elem) { return $(elem).museMenu(); });/* unifiedNavBar */ | Muse.Utils.initWidget('.MenuBar', function(elem) { return $(elem).museMenu(); });/* unifiedNavBar */ | ||
+ | $('#u2764').registerPositionScrollEffect([{"speed":[0,1],"in":[-Infinity,36.95]},{"speed":[0,1],"in":[36.95,Infinity]}]);/* scroll effect */ | ||
Muse.Utils.fullPage('#page');/* 100% height page */ | Muse.Utils.fullPage('#page');/* 100% height page */ | ||
Muse.Utils.showWidgetsWhenReady();/* body */ | Muse.Utils.showWidgetsWhenReady();/* body */ | ||
Muse.Utils.transformMarkupToFixBrowserProblems();/* body */ | Muse.Utils.transformMarkupToFixBrowserProblems();/* body */ | ||
− | } catch(e) { | + | } catch(e) { }}); |
</script> | </script> | ||
− | + | ||
+ | </body> | ||
</html> | </html> |
Latest revision as of 15:28, 18 September 2015
![Gene Block](https://static.igem.org/mediawiki/2015/6/60/Mingdao-u4204-4.png)
*
*
In our project, we cloned two genes, SR and SRPK from the materials kindly gave by Dr. Woan-Yuh Tarn at Academia Sinica in Taiwan. Phosphoserine and arginine (highest nitrogen contents among 20 amino acids) play important roles in fire retardance. We found a novel fire retardant protein, SR protein, through protein database mining. SR proteins are post-translationally phosphorylated by SR protein kinase (SRPK). We co-transformed E. coli BL21 with two vectors simultaneously to express phosphorylated SR proteins.
![Gene](https://static.igem.org/mediawiki/2015/5/53/Mingdao-u4207-4.png)
Serine/arginine-rich splicing factor 1 (SRSF1) is a protein found on chromosome 17 in humans. SRSF1 is also known as alternative splicing factor 1 (ASF1), pre-mRNA-splicing factor SF2 (SF2), which is involved in alternative splicing, mRNA nuclear export and translation. It contains two functional domains. One in the N-terminus is RNA recognition motifs which interact with RNA and splicing factors. The other in the C-terminus is rich in serine and arginine residues (SR domain) and regulate the protein activity through phosphorylation by SR protein kinase.
SRSF protein kinase 1 (SRPK1) is a serine/arginine-rich protein specific kinase, which phosphorylates SR proteins on serine residues in SR domain. It plays an important role in the regulation of SR protein activity. Disorders in SRPK1 may be observed in certain cancer cells.
![BioBrick](https://static.igem.org/mediawiki/2015/2/23/Mingdao-u4209-4.png)
We cloned the genes of SR and SRPK as well as the composite DNA fragments of Ptac-GST-SR and Pt7-SRPK-His onto the standard backbone of pSB1C3 biobrick.
SR/pSB1C3
Part No.: BBa_K1608000
We designed two primers to amplify the SR genes by PCR, followed by XbaI and PstI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation.
Primers:
1. SR-XbaI-F: 5'- AAAAGGTCTAGATGTCGGGAGGTGGTGTGATTCGTG -3'
2. SR-SpeI-PstI-R: 5'-AAGAAACTGCAGCGGCCGCTACTAGTATTATGTACGAGAGCGAGA -3'
PCR product size: ~785 bp
![](https://static.igem.org/mediawiki/2015/f/fe/Mingdao-t1-1.jpeg)
SRPK/pSB1C3
Part No.: BBa_K1608001
We designed two primers to amplify SRPK1 gene by PCR, followed by EcoRI and SpeI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. However, there’re two PstI sites on the sequence of SRPK1 gene. We’re trying to mutate them to fit the standard biobrick parts.
Primers:
1. SRPK1-EcoRI-XbaI-F: 5'- AAAAGAATTCGCGGCCGCTTCTAGATGGAGCGGAAAGTGCTTGCGCTCCAG -3'
2. SRPK1-SpeI-R: 5'- GGGGGGACTAGTATTAGGAGTTAAGCCAAGGGTG -3'
PCR product size: ~1995 bp
Plasmid map:
![](https://static.igem.org/mediawiki/2015/6/6d/Mingdao-t1-2.jpeg)
In order to express SR and SRPK gene more conveniently, we made two composite biobricks with promoter, RBS and a fusion tag.
GST-SR/pSB1C3
Part No.: BBa_K1608002
We designed two primers to amplify Ptac-GST-SR DNA fragment by PCR from SR/pGEX-2T, followed by XbaI and PstI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. The SR gene is fused with GST tag and driven by Ptac promoter along with a lac operator downstream.
Primers:
1. Ptac (pGEX)-XbaI-F: 5'- GAGGGGTCTAGAGTTTTTGCGCCGACATCATAAC -3'
2. SR-SpeI-PstI-R: 5'- AAGAAACTGCAGCGGCCGCTACTAGTATTATGTACGAGAGCGAGA -3'
PCR product size: ~1572 bp
Plasmid map:
![](https://static.igem.org/mediawiki/2015/e/e9/Mingdao-t1-3.jpeg)
In order to express SR and SRPK gene more conveniently, we made two composite biobricks with promoter, RBS and a fusion tag.
SRPK-His/pSB1C3
Part No.: BBa_K1608003
We designed two primers to amplify Pt7-SRPK1-His DNA fragment by PCR from SRPK/pET-29b, followed by EcoRI and SpeI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. However, there’re two PstI sites one XbaI site on the amplified sequence. We’re trying to mutate them to fit the standard biobrick parts. The SRPK1 gene is fused with 6XHis tag and driven by Pt7 promoter along with a lac operator downstream.
Primers:
1. Pt7(pET)-EcoRI-XbaI-F: 5'- AAAAAAGAATTCGCGGCCGCTTCTAGAGCACGATGCGTCCGGCGTA -3'
2. His (pET)-SpeI-R: 5'- AGGGAAACTAGTATCAGTGGTGGTGGTGGTGGT -3'
PCR product size: ~2294 bp
Plasmid map:
![](https://static.igem.org/mediawiki/2015/4/45/Mingdao-t1-4.jpeg)
![Data](https://static.igem.org/mediawiki/2015/0/0f/Mingdao-u4244-4.png)
(1) PCR of SR, SRPK, Ptac-GST-SR and Pt7-SRPK-His
![](https://static.igem.org/mediawiki/2015/f/f1/Mingdao-t1-5.jpeg)
Lanes:
1. 1kb DNA marker
2. Pt7-SRPK-His: 2294 bp
3. Ptac-GST-SR: 1572 bp
4. SR: 785 bp
5. SRPK: 1995 bp
(2) Restriction enzyme digestion of inserts and vectors
![](https://static.igem.org/mediawiki/2015/1/12/Mingdao-t1-6.png)
Lanes:
1. 1kb DNA marker
2. Pt7-SRPK-His: EcoRI + SpeI → 2294 bp
3. SRPK: EcoRI + SpeI →1995 bp
4. pSB1C3: EcoRI + SpeI → 2047 + 1092 bp*
5. Ptac-GST-SR: XbaI + PstI→ 1572 bp
6. SR: XbaI + PstI → 785 bp
7. pSB1C3: XbaI + PstI → 2044 + 1095 bp*
*Bands shifted were caused by the fluorescent DNA loading dye. We confirmed with the specialist and sequenced the plasmid. The plasmids were correct but it bothers us for a long time. Just be very careful to use a ready-to-use fluorescent DNA loading dye.
(3)Colony PCR for SRPK/pSB1C3 and SR/pSB1C3
![](https://static.igem.org/mediawiki/2015/8/87/Mingdao-t1-7.jpeg)
![](https://static.igem.org/mediawiki/2015/c/c5/Mingdao-t1-8.jpeg)
Left panel: Colony PCR with primers of SRPK1-EcoRI-XbaI-F and VR to check SRPK/pSB1C3 (2162 bp)
Right panel: Colony PCR with primers of SR-XbaI-F + VR to check SR/pSB1C3 (941 bp)
(4)Colony PCR for Ptac-GST-SR/pSB1C3 and Pt7-SRPK-His/pSB1C3
![](https://static.igem.org/mediawiki/2015/a/a7/Mingdao-t1-9.jpeg)
Lane 1 & 17: 1kb DNA marker
Lane 2-8: Colony PCR with primers of Ptac (pGEX)-XbaI-F and VR to check Ptac-GST-SR/pSB1C3 (1731 bp)
Lane 9-16: Colony PCR with primers of Pt7(pET)-EcoRI-XbaI-F and VR to check Pt7-SRPK-His/pSB1C3 (2452 bp)
(5) Restriction enzyme check for SRPK/pSB1C3, SR/pSB1C3 and Pt7-SRPK-His/pSB1C3
![](https://static.igem.org/mediawiki/2015/f/fb/Mingdao-t1-10-crop-u4313.png)
![](https://static.igem.org/mediawiki/2015/7/70/Mingdao-t1-11-crop-u4319.png)
Left panel:
1. SRPK/pSB1C3: EcoRI → 4036 bp
2. SRPK/pSB1C3: PstI → 2747 + 1238 + 51 bp
3. 1kb DNA marker
4. SR/pSB1C3: XbaI → 2815 bp
5. SR/pSB1C3: EcoRI + PstI → 2029 + 786 bp
Right panel:
1. Pt7-SRPK-His/pSB1C3: EcoRI → 4326 bp
2. Pt7-SRPK-His/pSB1C3: PstI → 2980 + 1295 + 51 bp
3. 1kb DNA marker
(6) Restriction enzyme check for Ptac-GST-SR/pSB1C3
![](https://static.igem.org/mediawiki/2015/7/75/Mingdao-t1-12-crop-u4327.png)
Lanes:
1. 1kb DNA marker
2. Ptac-GST-SR/pSB1C3: uncut
3. Ptac-GST-SR/pSB1C3: BamHI → 3614 bp
4. Ptac-GST-SR/pSB1C3: EcoRI + PstI → 1581 + 2033 bp
(7) Sequencing data with primers of VF2 and VR
a. SR/pSB1C3 (VF2 & VR)
b. SRPK/pSB1C3 (VF2 & VR)
c. Ptac-GST-SR/pSB1C3 (VF2 & VR)
d. Pt7-SRPK-His/pSB1C3 (VF2 & VR)
![Vector](https://static.igem.org/mediawiki/2015/1/13/Mingdao-u4335-4.png)
In order to express proteins abundantly and efficiently, we transferred the genes of SR and SRPK into two commercial expression vectors of pGEX-2T and pET-29b, respectively.
SR/pGEX-2T
We cloned SR gene with BamHI and XbaI onto pGEX-2T, in which the gene expression is fused with GST tag in the 5’ end and driven under Ptac promoter as well as regulated by lac operator. The pGEX-2T backbone contains lacI repressor gene, pBR322 replication origin and ampicillin resistance cassette (AmpR).
Plasmid map:
![](https://static.igem.org/mediawiki/2015/2/24/Mingdao-t1-13.jpeg)
SRPK/pET-29b
We cloned SRPK gene with EcoRV and HindIII onto pET-29b, in which the gene expression is fused with 6XHis tag in the 3’ end and driven under Pt7 promoter as well as regulated by lac operator. The pET-29b backbone contains lacI repressor gene, ColE1 replication origin and kanamycin resistance cassette (KanR).
Plasmid map:
![](https://static.igem.org/mediawiki/2015/7/7b/Mingdao-t1-14.jpeg)
DATA
Protein Induction
We co-transformed SR/pGEX-2T and SRPK/pET-29b into E. coli BL21, which expresses T7 RNA polymerase under LacI repressor regulation. The bacteria were cultured in LB media supplemented with ampicillin and kanamycin. IPTG was added when the bacteria grew to OD600 value at 0.6-1.0. And the protein lysates were collected after 4 hours of IPTG induction. SDS-PAGE, Coomassie Blue Staining and Western Blotting were performed through the manufacturers’ instruction.
Coomassie Blue Staining
![](https://static.igem.org/mediawiki/2015/8/8c/Mingdao-t1-15.jpeg)
Lanes of lysates:
1. Control: pGEX-2T & pET-29b
2. SR: SR/pGEX-2T & pET-29b
3. SRPK: pGEX-2T & SRPK1/pET-29b
Result:
SR was expressed at the expected size of 53 kDa. and SRPK was expressed at the expected size of 93 kDa. In addition, free forms of GST were observed at 27 kDa in the lanes 1 & 3.
Western Blotting
(1) SRPK-His protein expression
![](https://static.igem.org/mediawiki/2015/2/2f/Mingdao-t1-16.png)
![Procedure:
↓ mouse α-His primary Ab
↓ goat α-mouse IgG-AP secondary Ab
↓ BCIP/NBT chromogen Lanes of lysates:
1. Control: pGEX-2T & pET-29b
2. SR: SR/pGEX-2T & pET-29b 3. SRPK: pGEX-2T & SRPK1/pET-29b
4. P-SR: SR/pGEX-2T & SRPK1/pET-29b Result:
SRPK-His was detected by anti-His antibody at the expected size of 93 kDa, as shown in the lanes 3 & 4.](https://static.igem.org/mediawiki/2015/7/71/Mingdao-u4364-27.png)
(2) GST-SR protein expression
![](https://static.igem.org/mediawiki/2015/2/2f/Mingdao-t1-16.png)
![Procedure:
↓ rabbit α-GST primary Ab
↓ goat α-rabbit IgG-HRP secondary Ab
↓ DAB chromogen Lanes of lysates:
1. Control: pGEX-2T & pET-29b
2. SR: SR/pGEX-2T & pET-29b 3. SRPK: pGEX-2T & SRPK1/pET-29b
4. P-SR: SR/pGEX-2T & SRPK1/pET-29b](https://static.igem.org/mediawiki/2015/4/4d/Mingdao-u4373-22.png)
Result
GST-SR was detected by anti-GST antibody at the expected size of 53 kDa, as shown in the lanes 2 & 4. It is worth to note that the bands in lane 4 were shifted around 53 kDa, indicating protein modification of GST-SR possibly by SRPK kinase phosphorylation (SR and SRPK exist in the bacteria all together). Moreover, the free forms of GST around 27 kDa were also observed.
Summary
We cloned the genes encoding SR and SRPK to BioBricks (pSB1C3) and expression vectors (pGEX-2T and pET-29b). After protein induction by IPTG in E. coli BL21, the SR and SRPK as well as phosphorylated SR proteins were detected in SDS-PAGE with Coomassie Blue staining and Western Blotting by anti-His antibody and anti-GST antibody. The results showed that we successfully expressed phosphorylated SR proteins in E. coli bacteria by transformed with SR/pGEX-2T and SRPK/pET-29b.