Difference between revisions of "Team:HUST-China/Collaborations"
Yuzhuxuyang (Talk | contribs) |
|||
(9 intermediate revisions by 5 users not shown) | |||
Line 6: | Line 6: | ||
<title>Team:HUST-China:Collaborations</title> | <title>Team:HUST-China:Collaborations</title> | ||
− | <link | + | <link rel="stylesheet" type="text/css" href="https://2015.igem.org/Team:HUST-China/CSS?action=raw&ctype=text/css" /> |
− | + | ||
− | + | ||
+ | <script type="text/javascript" src="https://2015.igem.org/Team:HUST-China/jquery?action=raw&ctype=text/javascript"></script> | ||
+ | |||
+ | <script type="text/javascript" src="https://2015.igem.org/Team:HUST-China/JS?action=raw&ctype=text/javascript"></script> | ||
<style> | <style> | ||
/*改默认设定*/ | /*改默认设定*/ | ||
Line 86: | Line 87: | ||
z-index:1;} | z-index:1;} | ||
− | + | .first-menu{float: left; | |
− | + | ||
font-size:19px; | font-size:19px; | ||
− | max-width: | + | max-width: 20%; |
padding-top:5px;} | padding-top:5px;} | ||
.other-menu{float: left; | .other-menu{float: left; | ||
− | margin-left:1 | + | margin-left:1%; |
font-size:19px; | font-size:19px; | ||
− | max-width: | + | max-width: 20%; |
padding-top:5px;} | padding-top:5px;} | ||
+ | |||
.navbar .nav > li .dropdown-menu {margin: 0;} | .navbar .nav > li .dropdown-menu {margin: 0;} | ||
Line 123: | Line 124: | ||
− | #pic{ background-image: url(https://static.igem.org/mediawiki/2015/ | + | #pic{ background-image: url(https://static.igem.org/mediawiki/2015/1/14/HUST_OTHERS_1.JPG |
+ | |||
+ | ); | ||
width:1349px; | width:1349px; | ||
height:650px; | height:650px; | ||
Line 139: | Line 142: | ||
} | } | ||
.pic_a{float: left; | .pic_a{float: left; | ||
− | margin-top: | + | margin-top:50px; |
width: 1349px; | width: 1349px; | ||
text-align:center; | text-align:center; | ||
Line 226: | Line 229: | ||
<!--悬浮菜单--> | <!--悬浮菜单--> | ||
+ | <!--悬浮菜单--> | ||
<div class="navbar"> | <div class="navbar"> | ||
<div class="navbar-inner"> | <div class="navbar-inner"> | ||
Line 232: | Line 236: | ||
<li class="first-menu"><a href="https://2015.igem.org/Team:HUST-China">HOME</a> | <li class="first-menu"><a href="https://2015.igem.org/Team:HUST-China">HOME</a> | ||
</li> | </li> | ||
− | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/ | + | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Project">PROJECT<b class="caret"></b></a> |
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
<li><a href="https://2015.igem.org/Team:HUST-China/Background">Background</a></li> | <li><a href="https://2015.igem.org/Team:HUST-China/Background">Background</a></li> | ||
Line 242: | Line 246: | ||
</li> | </li> | ||
− | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/ | + | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Wetlab">WETLAB<b class="caret"></b></a> |
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
<li><a href="https://2015.igem.org/Team:HUST-China/Results">Results</a></li> | <li><a href="https://2015.igem.org/Team:HUST-China/Results">Results</a></li> | ||
Line 254: | Line 258: | ||
</li> | </li> | ||
− | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/ | + | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Parts">PARTS<b class="caret"></b></a> |
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
<li><a href="https://2015.igem.org/Team:HUST-China/Basic_part">Basic Parts</a></li> | <li><a href="https://2015.igem.org/Team:HUST-China/Basic_part">Basic Parts</a></li> | ||
<li class="divider"></li> | <li class="divider"></li> | ||
− | <li><a href="https://2015.igem.org/Team:HUST-China/ | + | <li><a href="https://2015.igem.org/Team:HUST-China/Basic_part#2">Composite Parts</a></li> <li class="divider"></li> |
+ | <li><a href="https://2015.igem.org/Team:HUST-China/Part_Collection">Part Collection</a></li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
Line 264: | Line 269: | ||
<li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Modeling">MODELING<b class="caret"></b></a> | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Modeling">MODELING<b class="caret"></b></a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
+ | <li><a href="https://2015.igem.org/Team:HUST-China/Modeling">Overiew</a></li> | ||
+ | <li class="divider"></li> | ||
<li><a href="https://2015.igem.org/Team:HUST-China/Modeling on Cellular Level">Modeling on Cellular Level</a></li> | <li><a href="https://2015.igem.org/Team:HUST-China/Modeling on Cellular Level">Modeling on Cellular Level</a></li> | ||
<li class="divider"></li> | <li class="divider"></li> | ||
Line 271: | Line 278: | ||
− | + | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Practices">HUMAN PRACTICES</a> | |
− | <li class="dropdown other-menu" id="accountmenu"> | + | |
− | + | ||
− | + | ||
</li> | </li> | ||
− | <li class="dropdown other-menu" id="accountmenu"> | + | <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Safety">OTHERS<b class="caret"></b></a> |
− | + | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
<li><a href="https://2015.igem.org/Team:HUST-China/Safety">Safety</a></li> | <li><a href="https://2015.igem.org/Team:HUST-China/Safety">Safety</a></li> | ||
Line 301: | Line 305: | ||
<!--标题栏--> | <!--标题栏--> | ||
<div id="pic" > | <div id="pic" > | ||
− | <img class="title" src="https://static.igem.org/mediawiki/2015/ | + | <img class="title" src="https://static.igem.org/mediawiki/2015/2/2a/HUST_COLLABORATIONS_1.PNG"/> |
<br> | <br> | ||
<div class="pic_a" > | <div class="pic_a" > | ||
+ | <h4 align="center" style="color:white"><b>click it~</b></h4> | ||
<img style="cursor:pointer;" id="to_des" src="https://static.igem.org/mediawiki/2015/8/80/White.png"/> | <img style="cursor:pointer;" id="to_des" src="https://static.igem.org/mediawiki/2015/8/80/White.png"/> | ||
</div> | </div> | ||
Line 321: | Line 326: | ||
<div align="center" class="description"><a name="2"></a><br> | <div align="center" class="description"><a name="2"></a><br> | ||
<div class="dongxi"></div> | <div class="dongxi"></div> | ||
− | < | + | <h3 align="left"><b>Construction of CI-PSB1C3</b></h3> |
<p>We helped WHU team constructing a standardized plasmid C1-pSB1C3. Owing to the limit of time and the cost of fragment’s synthesis, WHU decided to generate a short C1 fragment through anneal of single-stranded DNA then insert it into the pSB1C3 between the restriction sites of XbaI and PstI. But they met difficulties and failed after several attempts. <br> | <p>We helped WHU team constructing a standardized plasmid C1-pSB1C3. Owing to the limit of time and the cost of fragment’s synthesis, WHU decided to generate a short C1 fragment through anneal of single-stranded DNA then insert it into the pSB1C3 between the restriction sites of XbaI and PstI. But they met difficulties and failed after several attempts. <br> | ||
After discussions and new experiment design, we helped them finish the construction through the following protocol: | After discussions and new experiment design, we helped them finish the construction through the following protocol: | ||
Line 354: | Line 359: | ||
<div align="center" class="description"><a name="3"></a><br> | <div align="center" class="description"><a name="3"></a><br> | ||
<div class="dongxi"></div> | <div class="dongxi"></div> | ||
− | < | + | <h3 align="left"><b>Equipment Sharing</b></h3> |
<p>As this year a 96-well plate is required for parts shipment while the lyophilizer in WHU-China team and HZAU-China team was not working, they ask us for assistance on the lyophilization of samples before shipment. In order to share experimental resources and promote work efficiency, we undertook the job to help them submiting all the samples. | <p>As this year a 96-well plate is required for parts shipment while the lyophilizer in WHU-China team and HZAU-China team was not working, they ask us for assistance on the lyophilization of samples before shipment. In order to share experimental resources and promote work efficiency, we undertook the job to help them submiting all the samples. | ||
</p> | </p> | ||
Line 362: | Line 367: | ||
<div align="center" class="description"><a name="4"></a><br> | <div align="center" class="description"><a name="4"></a><br> | ||
<div class="dongxi"></div> | <div class="dongxi"></div> | ||
− | < | + | <h3 align="left"><b>Help from HZAU</b></h3> |
<p>We met difficulties when amplifying the reporter BBa_E0040 because of certain unknown factors. Considering the limited time, we turned to HZAU-China iGEM team for help. Finally, with the construction of RBS+GFP-pSB1C3 plasmid generously offered from HZAU, they succeeded inserting the reporter gene GFP with RBS respectively to the downstream of the three ptrp mutants. | <p>We met difficulties when amplifying the reporter BBa_E0040 because of certain unknown factors. Considering the limited time, we turned to HZAU-China iGEM team for help. Finally, with the construction of RBS+GFP-pSB1C3 plasmid generously offered from HZAU, they succeeded inserting the reporter gene GFP with RBS respectively to the downstream of the three ptrp mutants. | ||
</p> | </p> | ||
Line 370: | Line 375: | ||
<div align="center" class="description"><a name="5"></a><br> | <div align="center" class="description"><a name="5"></a><br> | ||
<div class="dongxi"></div> | <div class="dongxi"></div> | ||
− | < | + | <h3 align="left"><b>Others</b></h3> |
<p>Apart from these collaborations, we also tried to make collaborations away from Wuhan region. For example: We had planned to utilize a device NZAU designed as a fluorescence detector to achieve a part of our characterization work and help them test the accuracy of the device. But it was a pity that we did not achieve the cooperation this year, because we didn’t finish this corresponding reporter plasmid in time. And we also offered some reasonable advise to ZJU team on safety problems of their project, provided the ideas of kill switch in our previous project. But finally after deep considerations, for the reason of not suiting their project, they adopted another kill switch. | <p>Apart from these collaborations, we also tried to make collaborations away from Wuhan region. For example: We had planned to utilize a device NZAU designed as a fluorescence detector to achieve a part of our characterization work and help them test the accuracy of the device. But it was a pity that we did not achieve the cooperation this year, because we didn’t finish this corresponding reporter plasmid in time. And we also offered some reasonable advise to ZJU team on safety problems of their project, provided the ideas of kill switch in our previous project. But finally after deep considerations, for the reason of not suiting their project, they adopted another kill switch. | ||
</p> | </p> | ||
Line 378: | Line 383: | ||
<div align="center" class="description"><a name="6"></a><br> | <div align="center" class="description"><a name="6"></a><br> | ||
<div class="dongxi"></div> | <div class="dongxi"></div> | ||
− | < | + | <h3 align="left"><b>Conclusion</b></h3> |
<p><br>All in all, we have achieved several successful collaborations this summer. In the future, we aim at expanding the collaboration region and diversifying the cooperation content, such as helping high school teams with their project. | <p><br>All in all, we have achieved several successful collaborations this summer. In the future, we aim at expanding the collaboration region and diversifying the cooperation content, such as helping high school teams with their project. | ||
<br> <br> <br> | <br> <br> <br> |
Latest revision as of 15:52, 18 September 2015
click it~
Collaborations
HUST-China, WHU-China and HZAU-China, three universities located in Wuhan region have been keeping close communications and collaborations these years. This summer, we continue the tradition, we three iGEM teams held a seminar in 29st Jul, during which we reached the consensus to establish Wuhan iGEM Committee in the future and held conferences and Science Fair at regular intervals to spread the idea of synthesis biology. Moreover we discussed about our project and exchanged some valuable suggestions. Here are the three main collaborations we made this summer.
Construction of CI-PSB1C3
We helped WHU team constructing a standardized plasmid C1-pSB1C3. Owing to the limit of time and the cost of fragment’s synthesis, WHU decided to generate a short C1 fragment through anneal of single-stranded DNA then insert it into the pSB1C3 between the restriction sites of XbaI and PstI. But they met difficulties and failed after several attempts.
After discussions and new experiment design, we helped them finish the construction through the following protocol:
1. Mix up 2.5μL primer F and R
2. Put the mixture in PCR Amplifier :
DNA denateration for 5 minutes
Annealing for 30 seconds
3. Ligation with pSB1C3(XbaI and PstI digested) for 1h
4. Transformation to E.coli
5. Plasmid extract
Notes:
F:
5’ CTAGATTGACAAACAAGATACATTGTATGAAAATACAAGAAAGTTTGTTGAACTAGTAGCGGCCGCCTGCA 3’
R:
5’ GGCGGCCGCTACTAGTTCAACAAACTTTCTTGTATTTTCATACAATGTATCTTGTTTGTCAAT 3’
The result of prime F and R pairing:
Equipment Sharing
As this year a 96-well plate is required for parts shipment while the lyophilizer in WHU-China team and HZAU-China team was not working, they ask us for assistance on the lyophilization of samples before shipment. In order to share experimental resources and promote work efficiency, we undertook the job to help them submiting all the samples.
Help from HZAU
We met difficulties when amplifying the reporter BBa_E0040 because of certain unknown factors. Considering the limited time, we turned to HZAU-China iGEM team for help. Finally, with the construction of RBS+GFP-pSB1C3 plasmid generously offered from HZAU, they succeeded inserting the reporter gene GFP with RBS respectively to the downstream of the three ptrp mutants.
Others
Apart from these collaborations, we also tried to make collaborations away from Wuhan region. For example: We had planned to utilize a device NZAU designed as a fluorescence detector to achieve a part of our characterization work and help them test the accuracy of the device. But it was a pity that we did not achieve the cooperation this year, because we didn’t finish this corresponding reporter plasmid in time. And we also offered some reasonable advise to ZJU team on safety problems of their project, provided the ideas of kill switch in our previous project. But finally after deep considerations, for the reason of not suiting their project, they adopted another kill switch.