Difference between revisions of "Team:CSU Fort Collins/Measurement"

BBa_J23101: 2015 Kit Plate 1, Well 20K. Size: 35 bp.

BBa_I13504: 2015 Kit Plate 4, Well 21J. Size: 875 bp.

1. With a pipette tip, punch a hole through the foil cover into the corresponding well of the part desired. Make sure you have properly oriented the plate. To prevent cross-contamination, do not remove the foil cover.
2. Pipette 10 μl of nuclease-free water into the well. Pipette up and down a few times until mixture is homogeneous. The sample should turn red

1. Set the water bath to 42 ℃ and remove 2 Cm²⁵ plates (for part J23101) and 2 Amp¹⁰⁰ plates (for part I13504) and allow the plates to come to room temperature.
2. Thaw 2 tubes (1 for each part) of chemically competent E. coli cells on ice. Leave in microcentrifuge tube.
3. For each part, add 1 ul of the resuspended DNA into the tube of competent cells.
4. Incubate on ice for 30 minutes.
5. Heat shock cells for 60 seconds at 42 ℃ without shaking.
6. Place on ice for 2 minutes.
7. Aseptically (by fire or in the hood) add 250 μl of LB media to the tube of chemically competent cells. Do not add antibiotic at this step. Cap tightly.
8. Place tube horizontally in shaker. Incubate at 37 ℃ and 225 rpm for 1 hour.
9. In the laminar hood, spread 100 μl of transformants onto respective LB+Antibiotic plates.
10. Leave plates in 37 ℃ incubator overnight. Store remaining liquid cultures in 4 ℃

1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Antibiotic plates – see above for respective antibiotic resistances. Leave plates in 37 ℃ incubator overnight.
2. Verify all 16 colonies via colony PCR.
3. Use the following mixture and thermalcycler program:

   Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

   Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

   Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

   Component	50μl reaction
   Molecular grade H2O	Added first. 32.5μL
   5x HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Template DNA	1.0μL
   DNA polymerase	Added last. 0.5μL

   Component	50μl reaction
   Molecular grade H2O	Added first 33.5ul
   5x Phusion HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Colony	1
   Phusion DNA polymerase	Added last. 0.5μL

4. Run PCR products in 2% agarose gel with a 100 bp ladder at 110 V for 60 minutes. Do you see the correct sizes?
   1. J23101: 318 bp
   2. I13504: 1197 bp

1. Once you confirm both parts have been transformed correctly, start a 2 mL overnight culture with antibiotic for each.
2. The next day, miniprep the overnight cultures via kit instructions. Nanodrop the resulting samples. Ask for help in preparing each part for sequencing. Once the sequencing confirms the part, glycerol stock it.

2. Digest your mixture in a water bath at 37C for 60min

1. Incubate the ligation mixture at 25 °C (room temperature – can be done on the lab bench) for 1 hour (or at 16 °C overnight). Heat inactivate at 65 °C for 10 minutes. Place on ice.

1. Set water bath to 42 °C
2. Remove 3 LB + Cm25 plates from 4 °C and allow them to come to room temperature.
3. Thaw chemically competent cells on ice. Leave in microcentrifuge tube.
4. Add 5 μl of ligation mix to chemically competent cells.
5. Add 5 μl of digested backbone to chemically competent cells as a control.
6. Incubate on ice for 30 minutes.
7. Heat shock cells for 60 sec at 42 °C without shaking.
8. Place on ice for 2 minutes.
9. Aseptically (by the fire on in the hood) add 250 μl of LB media to the tube. Do not add antibiotic at this step. Cap tightly.
10. Place tube horizontally in shaker. Incubate at 37 °C and 225 rpm for 1 hour.
11. In the laminar hood, spread 100 μL of transformants onto an LB + Cm²⁵ plate.
12. Spin down the remaining cells (16,000 x g for 10 minutes should suffice). Remove all media and resuspend in 100 μL of LB until the mixture is homogeneous. This step isn’t necessary for the control.
13. In the laminar hood, spread the remaining 100 μL of transformants onto an LB + Cm²⁵
14. Leave plates in 37 °C incubator overnight. Store remaining liquid cultures in 4 °C.

1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Cm²⁵ plates.
2. Verify all 16 colonies via colony PCR.
3. Use the following mixture and thermalcycler program:

   Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

   Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

   Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

   Component	50μl reaction
   Molecular grade H2O	Added first. 32.5μL
   5x HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Template DNA	1.0μL
   DNA polymerase	Added last. 0.5μL

   Component	50μl reaction
   Molecular grade H2O	Added first 33.5ul
   5x Phusion HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Colony	1
   Phusion DNA polymerase	Added last. 0.5μL

4. Run PCR products in 1% agarose gel with a 1 kb ladder at 110 V for 60 minutes. Do you see the correct sizes? [Should be ~930 bp]

BBa_J23106: 2015 Kit Plate 1, Well 22A. Size: 35 bp.

BBa_I13504: 2015 Kit Plate 4, Well 21J. Size: 875 bp.

1. With a pipette tip, punch a hole through the foil cover into the corresponding well of the part desired. Make sure you have properly oriented the plate. To prevent cross-contamination, do not remove the foil cover.
2. Pipette 10 μl of nuclease-free water into the well. Pipette up and down a few times until mixture is homogeneous. The sample should turn red

1. Set the water bath to 42 ℃ and remove 2 Cm²⁵ plates (for part J23106) and 2 Amp¹⁰⁰ plates (for part I13504) and allow the plates to come to room temperature.
2. Thaw 2 tubes (1 for each part) of chemically competent E. coli cells on ice. Leave in microcentrifuge tube.
3. For each part, add 1 ul of the resuspended DNA into the tube of competent cells.
4. Incubate on ice for 30 minutes.
5. Heat shock cells for 60 seconds at 42 ℃ without shaking.
6. Place on ice for 2 minutes.
7. Aseptically (by fire or in the hood) add 250 μl of LB media to the tube of chemically competent cells. Do not add antibiotic at this step. Cap tightly.
8. Place tube horizontally in shaker. Incubate at 37 ℃ and 225 rpm for 1 hour.
9. In the laminar hood, spread 100 μl of transformants onto respective LB+Antibiotic plates.
10. Leave plates in 37 ℃ incubator overnight. Store remaining liquid cultures in 4 ℃

1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Antibiotic plates – see above for respective antibiotic resistances. Leave plates in 37 ℃ incubator overnight.
2. Verify all 16 colonies via colony PCR.
3. Use the following mixture and thermalcycler program:

   Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

   Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

   Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

   Component	50μl reaction
   Molecular grade H2O	Added first. 32.5μL
   5x HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Template DNA	1.0μL
   DNA polymerase	Added last. 0.5μL

   Component	50μl reaction
   Molecular grade H2O	Added first 33.5ul
   5x Phusion HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Colony	1
   Phusion DNA polymerase	Added last. 0.5μL

4. Run PCR products in 2% agarose gel with a 100 bp ladder at 110 V for 60 minutes. Do you see the correct sizes?
   1. J23106: 320 bp
   2. I13504: 1197 bp

1. Once you confirm both parts have been transformed correctly, start a 2 mL overnight culture with antibiotic for each.
2. The next day, miniprep the overnight cultures via kit instructions. Nanodrop the resulting samples. Ask for help in preparing each part for sequencing. Once the sequencing confirms the part, glycerol stock it.

2. Digest your mixture in a water bath at 37C for 60min

1. Incubate the ligation mixture at 25 °C (room temperature – can be done on the lab bench) for 1 hour (or at 16 °C overnight). Heat inactivate at 65 °C for 10 minutes. Place on ice.

1. Set water bath to 42 °C
2. Remove 3 LB + Cm25 plates from 4 °C and allow them to come to room temperature.
3. Thaw chemically competent cells on ice. Leave in microcentrifuge tube.
4. Add 5 μl of ligation mix to chemically competent cells.
5. Add 5 μl of digested backbone to chemically competent cells as a control.
6. Incubate on ice for 30 minutes.
7. Heat shock cells for 60 sec at 42 °C without shaking.
8. Place on ice for 2 minutes.
9. Aseptically (by the fire on in the hood) add 250 μl of LB media to the tube. Do not add antibiotic at this step. Cap tightly.
10. Place tube horizontally in shaker. Incubate at 37 °C and 225 rpm for 1 hour.
11. In the laminar hood, spread 100 μL of transformants onto an LB + Cm²⁵ plate.
12. Spin down the remaining cells (16,000 x g for 10 minutes should suffice). Remove all media and resuspend in 100 μL of LB until the mixture is homogeneous. This step isn’t necessary for the control.
13. In the laminar hood, spread the remaining 100 μL of transformants onto an LB + Cm²⁵
14. Leave plates in 37 °C incubator overnight. Store remaining liquid cultures in 4 °C.

1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Cm²⁵ plates.
2. Verify all 16 colonies via colony PCR.
3. Use the following mixture and thermalcycler program:

   Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

   Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

   Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

   Component	50μl reaction
   Molecular grade H2O	Added first. 32.5μL
   5x HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Template DNA	1.0μL
   DNA polymerase	Added last. 0.5μL

   Component	50μl reaction
   Molecular grade H2O	Added first 33.5ul
   5x Phusion HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Colony	1
   Phusion DNA polymerase	Added last. 0.5μL

4. Run PCR products in 1% agarose gel with a 1 kb ladder at 110 V for 60 minutes. Do you see the correct sizes? [Should be ~930 bp]

BBa_J23117: 2015 Kit Plate 1, Well 22K. Size: 35 bp.

BBa_I13504: 2015 Kit Plate 4, Well 21J. Size: 875 bp.

1. With a pipette tip, punch a hole through the foil cover into the corresponding well of the part desired. Make sure you have properly oriented the plate. To prevent cross-contamination, do not remove the foil cover.
2. Pipette 10 μl of nuclease-free water into the well. Pipette up and down a few times until mixture is homogeneous. The sample should turn red

1. Set the water bath to 42 ℃ and remove 2 Cm²⁵ plates (for part J23117) and 2 Amp¹⁰⁰ plates (for part I13504) and allow the plates to come to room temperature.
2. Thaw 2 tubes (1 for each part) of chemically competent E. coli cells on ice. Leave in microcentrifuge tube.
3. For each part, add 1 ul of the resuspended DNA into the tube of competent cells.
4. Incubate on ice for 30 minutes.
5. Heat shock cells for 60 seconds at 42 ℃ without shaking.
6. Place on ice for 2 minutes.
7. Aseptically (by fire or in the hood) add 250 μl of LB media to the tube of chemically competent cells. Do not add antibiotic at this step. Cap tightly.
8. Place tube horizontally in shaker. Incubate at 37 ℃ and 225 rpm for 1 hour.
9. In the laminar hood, spread 100 μl of transformants onto respective LB+Antibiotic plates.
10. Leave plates in 37 ℃ incubator overnight. Store remaining liquid cultures in 4 ℃

1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Antibiotic plates – see above for respective antibiotic resistances. Leave plates in 37 ℃ incubator overnight.
2. Verify all 16 colonies via colony PCR.
3. Use the following mixture and thermalcycler program:

   Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

   Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

   Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

   Component	50μl reaction
   Molecular grade H2O	Added first. 32.5μL
   5x HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Template DNA	1.0μL
   DNA polymerase	Added last. 0.5μL

   Component	50μl reaction
   Molecular grade H2O	Added first 33.5ul
   5x Phusion HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Colony	1
   Phusion DNA polymerase	Added last. 0.5μL

4. Run PCR products in 2% agarose gel with a 100 bp ladder at 110 V for 60 minutes. Do you see the correct sizes?
   1. J23117: 320 bp
   2. I13504: 1197 bp

1. Once you confirm both parts have been transformed correctly, start a 2 mL overnight culture with antibiotic for each.
2. The next day, miniprep the overnight cultures via kit instructions. Nanodrop the resulting samples. Ask for help in preparing each part for sequencing. Once the sequencing confirms the part, glycerol stock it.

2. Digest your mixture in a water bath at 37C for 60min

1. Incubate the ligation mixture at 25 °C (room temperature – can be done on the lab bench) for 1 hour (or at 16 °C overnight). Heat inactivate at 65 °C for 10 minutes. Place on ice.

1. Set water bath to 42 °C
2. Remove 3 LB + Cm25 plates from 4 °C and allow them to come to room temperature.
3. Thaw chemically competent cells on ice. Leave in microcentrifuge tube.
4. Add 5 μl of ligation mix to chemically competent cells.
5. Add 5 μl of digested backbone to chemically competent cells as a control.
6. Incubate on ice for 30 minutes.
7. Heat shock cells for 60 sec at 42 °C without shaking.
8. Place on ice for 2 minutes.
9. Aseptically (by the fire on in the hood) add 250 μl of LB media to the tube. Do not add antibiotic at this step. Cap tightly.
10. Place tube horizontally in shaker. Incubate at 37 °C and 225 rpm for 1 hour.
11. In the laminar hood, spread 100 μL of transformants onto an LB + Cm²⁵ plate.
12. Spin down the remaining cells (16,000 x g for 10 minutes should suffice). Remove all media and resuspend in 100 μL of LB until the mixture is homogeneous. This step isn’t necessary for the control.
13. In the laminar hood, spread the remaining 100 μL of transformants onto an LB + Cm²⁵
14. Leave plates in 37 °C incubator overnight. Store remaining liquid cultures in 4 °C.

1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Cm²⁵ plates.
2. Verify all 16 colonies via colony PCR.
3. Use the following mixture and thermalcycler program:

   Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

   Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

   Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

   Component	50μl reaction
   Molecular grade H2O	Added first. 32.5μL
   5x HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Template DNA	1.0μL
   DNA polymerase	Added last. 0.5μL

   Component	50μl reaction
   Molecular grade H2O	Added first 33.5ul
   5x Phusion HF Buffer	10μL
   10 mM dNTPs	1.0μL
   Primer A (10μM)	2.5μL
   Primer B (10μM)	2.5μL
   Colony	1
   Phusion DNA polymerase	Added last. 0.5μL

4. Run PCR products in 1% agarose gel with a 1 kb ladder at 110 V for 60 minutes. Do you see the correct sizes? [Should be ~930 bp]