Difference between revisions of "Team:UAM Poznan/Parts"
Line 249: | Line 249: | ||
<nav class="cmn-tile-nav"> | <nav class="cmn-tile-nav"> | ||
<ul class="clearfix"> | <ul class="clearfix"> | ||
− | <li class="colour-1"><a href="#">Arabinose <br>induced <br>promoters</a></li> | + | <li class="colour-1"><a href="#Arabinose">Arabinose <br>induced <br>promoters</a></li> |
− | <li class="colour-2"><a href="#">Melibiose <br>induced <br>promoters</a></li> | + | <li class="colour-2"><a href="#Melibiose">Melibiose <br>induced <br>promoters</a></li> |
− | <li class="colour-3"><a href="#">Rhamnose <br>induced <br>promoters</a></li> | + | <li class="colour-3"><a href="#Rhamnose">Rhamnose <br>induced <br>promoters</a></li> |
− | <li class="colour-4"><a href="#">Xylose <br>induced <br>promoters</a></li> | + | <li class="colour-4"><a href="#Xylose">Xylose <br>induced <br>promoters</a></li> |
− | <li class="colour-5"><a href="#">Other <br>tested <br>promoters</a></li> | + | <li class="colour-5"><a href="#Other">Other <br>tested <br>promoters</a></li> |
− | + | ||
</ul> | </ul> | ||
</nav> | </nav> | ||
+ | |||
<h1>ABSTRACT</h1> | <h1>ABSTRACT</h1> | ||
<p> At the moment, the most popular system in use for protein expression is the pET expression system. | <p> At the moment, the most popular system in use for protein expression is the pET expression system. | ||
Line 268: | Line 268: | ||
<p>All promoter fragments derive from Escherichia coli K12, strain DH5 alpha, some elements are synthetic. Chromosomal DNA of E. coli was isolated as described in the methods section.</p> | <p>All promoter fragments derive from Escherichia coli K12, strain DH5 alpha, some elements are synthetic. Chromosomal DNA of E. coli was isolated as described in the methods section.</p> | ||
− | <h2>Arabinose induced promoters</h2> | + | <a name="Arabinose"><h2>Arabinose induced promoters</h2></a> |
<h4>sfGFP under arabinose promoter s1 without AraC (Arashort1) - BBa_K1741000</h4> | <h4>sfGFP under arabinose promoter s1 without AraC (Arashort1) - BBa_K1741000</h4> | ||
<p>In commercially available expression vectors arabinose promoter araBAD is usually used together with a gene for AraC transcription activator / repressor to make the system independent of chromosomal copy of AraC gene. We fused the araBAD promoter without AraC reading frame, as other sugar induced promoters to sfGFP. The shorter version of the popular promoter is still functional i.e. induced by arabinose. Arabinose induced (0,4%) in a a short time (1-8h) expression is a bit lower than driven by AraC-araBAD but after a longer time like 18h the GFP level is higher than from AraC-araBAD promoter. New shorter versions of arabinose induced promoters, all originating from E. coli genome were compared to the biobrick <a href="http://parts.igem.org/Part:BBa_K1481002" target="_blank">BBa_K1481002</a>, provided last year by Poznan_Bioinf team.<br>The sequence of this promoter starts from O2 region the left part of the binding site of AraC in absence of arabinose. </p> | <p>In commercially available expression vectors arabinose promoter araBAD is usually used together with a gene for AraC transcription activator / repressor to make the system independent of chromosomal copy of AraC gene. We fused the araBAD promoter without AraC reading frame, as other sugar induced promoters to sfGFP. The shorter version of the popular promoter is still functional i.e. induced by arabinose. Arabinose induced (0,4%) in a a short time (1-8h) expression is a bit lower than driven by AraC-araBAD but after a longer time like 18h the GFP level is higher than from AraC-araBAD promoter. New shorter versions of arabinose induced promoters, all originating from E. coli genome were compared to the biobrick <a href="http://parts.igem.org/Part:BBa_K1481002" target="_blank">BBa_K1481002</a>, provided last year by Poznan_Bioinf team.<br>The sequence of this promoter starts from O2 region the left part of the binding site of AraC in absence of arabinose. </p> | ||
Line 277: | Line 277: | ||
<p>You can find this part's sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741002" target="_blank">BBa_K1741002.</a></p> | <p>You can find this part's sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741002" target="_blank">BBa_K1741002.</a></p> | ||
− | <h2>Melibiose induced promoters</h2> | + | <a name="Melibiose"><h2>Melibiose induced promoters</h2></a> |
<h4>sfGFP under melibiose promoter - BBa_K1741003</h4> | <h4>sfGFP under melibiose promoter - BBa_K1741003</h4> | ||
<p>MelR chromosomal copy of MelR is sufficient to activate the melibiose melAB promoter copied from E. coli K12 chromosome when melibiose is added to M9 minimal medium or to a rich medium 2xLB (0,4%). In both media induction is much weaker than of arabinose or rhamnose induced promoters. </p> | <p>MelR chromosomal copy of MelR is sufficient to activate the melibiose melAB promoter copied from E. coli K12 chromosome when melibiose is added to M9 minimal medium or to a rich medium 2xLB (0,4%). In both media induction is much weaker than of arabinose or rhamnose induced promoters. </p> | ||
Line 290: | Line 290: | ||
− | <h2>Rhamnose induced promoters</h2> | + | <a name="Rhamnose"><h2>Rhamnose induced promoters</h2></a> |
<h4>sfGFP under rhamnose promoter with removed EcoRI site - BBa_K1741005</h4> | <h4>sfGFP under rhamnose promoter with removed EcoRI site - BBa_K1741005</h4> | ||
Line 304: | Line 304: | ||
<p>You can find this part's sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741006" target="_blank">BBa_K1741006.</a></p> | <p>You can find this part's sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741006" target="_blank">BBa_K1741006.</a></p> | ||
− | <h2>Xylose induced promoters</h2> | + | <a name="Xylose"><h2>Xylose induced promoters</h2></a> |
<h4>sfGFP under xylose promoter xylA (xylWT) - BBa_K1741007</h4> | <h4>sfGFP under xylose promoter xylA (xylWT) - BBa_K1741007</h4> | ||
<p>SfGFP under xylose promoter xylA (wild type).</p> | <p>SfGFP under xylose promoter xylA (wild type).</p> | ||
Line 321: | Line 321: | ||
<p>You can find this part's sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741010" target="_blank">BBa_K1741010.</a></p> | <p>You can find this part's sequence with more information in registry: <a href="http://parts.igem.org/Part:BBa_K1741010" target="_blank">BBa_K1741010.</a></p> | ||
− | <h2>Other promoters</h2> | + | <a name=Other><h2>Other promoters</h2></a> |
<h4>sfGFP under T7 promoter - BBa_K1741011</h4> | <h4>sfGFP under T7 promoter - BBa_K1741011</h4> | ||
<p>This part imitates the most popular IPTG/lactose dependent T7 driven expression systems. To express sfGFP or another sequence with which one can substitute sfGFP ORF using Gibson or CPEC assembly, host strain of choice expressing T7 RNA polymerase is necessary, not only DE3.</p> | <p>This part imitates the most popular IPTG/lactose dependent T7 driven expression systems. To express sfGFP or another sequence with which one can substitute sfGFP ORF using Gibson or CPEC assembly, host strain of choice expressing T7 RNA polymerase is necessary, not only DE3.</p> |
Revision as of 21:45, 18 September 2015
Toggle Navigation
![](https://static.igem.org/mediawiki/2015/4/4a/UAMPOZNANbannerhorizontal.png)
ABSTRACT
At the moment, the most popular system in use for protein expression is the pET expression system. The pET expression system is a lactose induced T7 polymerase dependent system. This system, however, has few downsides: i) the system tends to leak; ii) it is very hard to control the protein expression level once it is induced; iii) being a viral polymerase,T7 polymerase has a tendency to insert the mismatches (mutations) in the transcripted sequence; iv) if the produced protein is toxic for the host, the bacterial culture can decline before the desired concentration of the protein of interest is manufactured; v) the organized and stable transfer of the produced protein to i.e. a medium can prove difficult to carry out.
Therefore, we decided to seek an alternate solution to use in protein expression. We prepared a series of plasmids expressing his-tagged superfolder GFP under the control of four nontoxic inducers: arabinose, melibiose, rhamnose and xylose. The four promoters are more controllable than the most popular lactose induced T7RNA polymerase dependent systems. The coding sequences are transcribed by the cellular RNA polymerase which is slower and more accurate than T7 RNA polymerase. SfGFP can be used to compare activities of standard, modified, and minimal promoters during growth on different carbon sources and as well as a probe of a fused protein solubility. We present a comprehensive comparison of the sfGFP expression driven by inducible promoters with the insulated, constitutive promoters proC and proD as standards. Two pairs of primers should be sufficient to clone an ORF of interest as a protein fused to sfGFP or to replace it in all vectors of the mulltipromoter system.
Our next step is to compare the efficiency between these promoters and test their function when grown on the media consisting of different components.
All promoter fragments derive from Escherichia coli K12, strain DH5 alpha, some elements are synthetic. Chromosomal DNA of E. coli was isolated as described in the methods section.
Arabinose induced promoters
sfGFP under arabinose promoter s1 without AraC (Arashort1) - BBa_K1741000
In commercially available expression vectors arabinose promoter araBAD is usually used together with a gene for AraC transcription activator / repressor to make the system independent of chromosomal copy of AraC gene. We fused the araBAD promoter without AraC reading frame, as other sugar induced promoters to sfGFP. The shorter version of the popular promoter is still functional i.e. induced by arabinose. Arabinose induced (0,4%) in a a short time (1-8h) expression is a bit lower than driven by AraC-araBAD but after a longer time like 18h the GFP level is higher than from AraC-araBAD promoter. New shorter versions of arabinose induced promoters, all originating from E. coli genome were compared to the biobrick BBa_K1481002, provided last year by Poznan_Bioinf team.
The sequence of this promoter starts from O2 region the left part of the binding site of AraC in absence of arabinose.
You can find this part's sequence with more information in registry: BBa_K1741000.
sfGFP under a short arabinose promoter s2 without O1 and O2 - BBa_K1741002
This shortened version of araBAD promoter does not contain O1 and O2 regions, but still contains the CRP binding site. We can expect than this version of araBAD will be still repressed by CRP but not by AraC without arabinose. From our preliminary experiments it appears that the promoter is more strongly induced by arabinose than AraC-AraBAD but is weaker than arashort1. All three arabinose pomoters are repressed by glucose.
You can find this part's sequence with more information in registry: BBa_K1741002.
Melibiose induced promoters
sfGFP under melibiose promoter - BBa_K1741003
MelR chromosomal copy of MelR is sufficient to activate the melibiose melAB promoter copied from E. coli K12 chromosome when melibiose is added to M9 minimal medium or to a rich medium 2xLB (0,4%). In both media induction is much weaker than of arabinose or rhamnose induced promoters.
![](https://static.igem.org/mediawiki/2015/8/88/UAMPOZNANhairpin.png)
You can find this part's sequence with more information in registry: BBa_K1741003.
sfGFP under melibiose promoter, with improved 5'UTR - BBa_K1741004
Twice higher expression has been obtained by 5’UTR editing – removal of potential secondary structure which involved RBS and a better positioning of RBS - 7 nt upstream AUG start codon. The modified 5’UTR results in about twice higher expression upon melibiose addition to the M9 or 2xLB medium. The promer is still weaker than araBAD or rhaBAD, so can be a promoter of choice if lower expression level is necessary for efficient folding or secretion of a recombinant protein.
![](https://static.igem.org/mediawiki/2015/5/57/UAMPOZNANhairpinremoved.png)
You can find this part's sequence with more information in registry: BBa_K1741004.
Rhamnose induced promoters
sfGFP under rhamnose promoter with removed EcoRI site - BBa_K1741005
rhaBAD promoter has been copied from E. coli genome: ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgaattcaggcgctttttagactggtcgtaatgaaattcagcaggatcacatt,
then Eco RI site was removed by PCR to obtain Rha1 in a biobrick standard:
ggtgagcatcacatcaccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgaatttaggcgctttttagactggtcgtaatgaaattcagcaggatcacatt.
The only one point mutation makes the promoter slightly stronger and more sensitive to rhamnose.
You can find this part's sequence with more information in registry: BBa_K1741005.
sfGFP under short rhamnose promoter (very weak) - BBa_K1741006
From rhaBAD1 promoter we removed both CRP binding sites. It seems likely thatt RhaS binding site has been also affected, so however the resulting promoter is still induced by rhamnose, the induction is very weak.
You can find this part's sequence with more information in registry: BBa_K1741006.
Xylose induced promoters
sfGFP under xylose promoter xylA (xylWT) - BBa_K1741007
SfGFP under xylose promoter xylA (wild type).
You can find this part's sequence with more information in registry: BBa_K1741007.
sfGFP under xylose promoter xylA1 with improved 5'UTR - BBa_K1741008
Xylose induced promoter xylA is weaker than arabinose and rhamnose promoters. To enhance the efficiency of xylA driven transcription/translation we have transplanted 5'UTR from the strong constitutive promoter proD. In some experiments it seems to be slightly stronger than original xylA promoter from part BBa_K1741007.
You can find this part's sequence with more information in registry: BBa_K1741008.
sfGFP under shortened xylose promoter xylA1 with improved 5'UTR BBa_K1741009
Short version of xylA promoter with known functional elements is stronger than two other versions.
You can find this part's sequence with more information in registry: BBa_K1741009.
sfGFP under xylose promoter xylF (very weak) - BBa_K1741010
We also tested the xylF promoter from the same double sided regulatory element, and xylF appears to be a very weak promoter slightly induced by xylose.
You can find this part's sequence with more information in registry: BBa_K1741010.
Other promoters
sfGFP under T7 promoter - BBa_K1741011
This part imitates the most popular IPTG/lactose dependent T7 driven expression systems. To express sfGFP or another sequence with which one can substitute sfGFP ORF using Gibson or CPEC assembly, host strain of choice expressing T7 RNA polymerase is necessary, not only DE3.
You can find this part's sequence with more information in registry: BBa_K1741011.
sfGFP under proC promoter - BBa_K1741012
proC - moderately strong constitutive promoter seems to reflect growth rate of E. coli bacterial strains on different media, and potentially can be a measure of protein biosynthesis rate, to be determined in future. Expression is higher than of inducible promoters.
You can find this part's sequence with more information in registry: BBa_K1741012.
sfGFP under proC promoter with a hairpin in 5'UTR BBa_K1741013
A weak hairpin introduced to 5’UTR slightly lowers transcription/translation. Will be extended to a thermometer, actually we see no temp. dependence.
You can find this part's sequence with more information in registry: BBa_K1741013.
sfGFP under proD promoter - BBa_K1741014
A strong insulated constitutive promoter proD is stronger than proC. Expression profiles of proC and proD are similar on different media = both seem to be really constitutive and the expression level does depend on E. coli growth rate.
You can find this part's sequence with more information in registry: BBa_K1741014.