Difference between revisions of "Team:MIT/Promoter"

Line 8: Line 8:
 
</div>
 
</div>
 
<div id = "spacer">
 
<div id = "spacer">
−
<div id = "title">
+
<div id = "title"> Anderson Promoter Characterization
 
 
 
</div>
 
</div>
Line 16: Line 16:
  
 
<div class = "text" align = "center">
 
<div class = "text" align = "center">
 +
Anderson Promoter Characterization
 +
The Anderson promoters are a collection of variable strength constitutive promoters for use in <i>E. coli</i> and other prokaryotes. They were created from a consensus sequence (J23119) by Chris Anderson. The table below lists, for the promoters we characterized, their relative strengths and the sequence changes (in red) that distinguish each promoter from the consensus. 
 +
 +
<table style = "width:100%">
 +
<tr>
 +
<td>Identifier</td>
 +
<td>Sequence</td>
 +
<td>Measured Strength</td>
 +
</tr>
 +
<td>
 +
<td>BBa_J23119</td>
 +
<td>ttgacagctagctcagtcctaggtataatgctagc</td>
 +
<td>n/a</td>
 +
</tr>
 +
<tr>
 +
<td>BBa_J23100</td>
 +
<td>ttgacggctagctcagtcctaggtacagtgctagc</td>
 +
<td>1</td>
 +
</tr>
 +
<tr>
 +
<td>BBa_J23102</td>
 +
<td>ttgacagctagctcagtcctaggtactgtgctagc</td>
 +
<td>0.86</td>
 +
</tr>
 +
<tr>
 +
<td>BBa_J23107</td>
 +
<td>tttacggctagctcagccctaggtattatgctagc</td>
 +
<td>0.36</td>
 +
</tr>
 +
<tr>
 +
<td>BBa_J23116</td>
 +
<td>ttgacagctagctcagtcctagggactatgctagc</td>
 +
<td>0.16</td>
 +
</tr>
 +
The relative strengths of these promoters were measured by Chris Anderson and the 2006 Berkeley iGEM team. These measurements are explained in greater detail in the Characterization section below. Source: http://parts.igem.org/Promoters/Catalog/Anderson
 +
 +
 +
In order to further characterize these promoters, we created several transcriptional units containing different Anderson promoters and a gene for GFP. After transforming into <i>E. coli</i>, we measured fluorescence on a flow cytometer. The results, after gating out anything except bacteria, are below.
 +
 +
 +
Sample
 +
Fluorescence (au)
 +
Relative Fluorescence
 +
Beads
 +
4.657
 +
0.000
 +
J23100
 +
7.283
 +
0.000
 +
J23102
 +
63891.58
 +
1
 +
J23107
 +
4417.016
 +
0.069
 +
J23116
 +
13911.683
 +
0.218
 +
J23116*
 +
7428.910
 +
0.116
 +
Untransformed
 +
4.615
 +
0.000
 +
* Duplicate prepared using alternate protocol
 +
 +
The controls functioned as expected: untransformed <i>E. coli</i> exhibited essentially no fluorescence and the beads, while having a high fluorescence initially, were removed by the gating for debris (anything other than bacteria).
 +
 +
Oddly, the construct with J23100, which should have been the strongest of the promoters, also did not fluoresce. Though we are unsure of the reason, it may have been human error such as a mislabeling of a tube. Also unexpected was the low, though discernable, level of fluorescence with J23107 which was six times lower than measured by the Berkeley 2006 team (by comparison between J23107 and J23102). J23116 showed expression around the same levels as the Berkeley team demonstrated.
 +
 +
Because J23102 exhibited the highest level of fluorescence, it was the promoter which we used throughout our experiments this summer in all of the transcriptional units which we made.
 
</div>
 
</div>
  

Revision as of 03:56, 19 September 2015


Anderson Promoter Characterization
Anderson Promoter Characterization The Anderson promoters are a collection of variable strength constitutive promoters for use in E. coli and other prokaryotes. They were created from a consensus sequence (J23119) by Chris Anderson. The table below lists, for the promoters we characterized, their relative strengths and the sequence changes (in red) that distinguish each promoter from the consensus. The relative strengths of these promoters were measured by Chris Anderson and the 2006 Berkeley iGEM team. These measurements are explained in greater detail in the Characterization section below. Source: http://parts.igem.org/Promoters/Catalog/Anderson In order to further characterize these promoters, we created several transcriptional units containing different Anderson promoters and a gene for GFP. After transforming into E. coli, we measured fluorescence on a flow cytometer. The results, after gating out anything except bacteria, are below. Sample Fluorescence (au) Relative Fluorescence Beads 4.657 0.000 J23100 7.283 0.000 J23102 63891.58 1 J23107 4417.016 0.069 J23116 13911.683 0.218 J23116* 7428.910 0.116 Untransformed 4.615 0.000 * Duplicate prepared using alternate protocol The controls functioned as expected: untransformed E. coli exhibited essentially no fluorescence and the beads, while having a high fluorescence initially, were removed by the gating for debris (anything other than bacteria). Oddly, the construct with J23100, which should have been the strongest of the promoters, also did not fluoresce. Though we are unsure of the reason, it may have been human error such as a mislabeling of a tube. Also unexpected was the low, though discernable, level of fluorescence with J23107 which was six times lower than measured by the Berkeley 2006 team (by comparison between J23107 and J23102). J23116 showed expression around the same levels as the Berkeley team demonstrated. Because J23102 exhibited the highest level of fluorescence, it was the promoter which we used throughout our experiments this summer in all of the transcriptional units which we made.


Identifier Sequence Measured Strength
BBa_J23119 ttgacagctagctcagtcctaggtataatgctagc n/a
BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc 1
BBa_J23102 ttgacagctagctcagtcctaggtactgtgctagc 0.86
BBa_J23107 tttacggctagctcagccctaggtattatgctagc 0.36
BBa_J23116 ttgacagctagctcagtcctagggactatgctagc 0.16