Difference between revisions of "Team:Tuebingen/Parts"

(Prototype team page)
 
 
(29 intermediate revisions by 4 users not shown)
Line 2: Line 2:
 
<html>
 
<html>
  
−
<h2> Part Documentation</h2>
 
  
−
<p>Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The <code>&lt;groupparts&gt;</code> tag (see below) will generate a table with all of the parts that your team adds to your team sandbox.</p>
+
<script type="text/javascript">
−
<p>Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without needing to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.</p>
+
dias = ['Simple Parts', 'Composite Parts'];
 +
</script>
 +
 +
 +
<div id="dia0" class="dia">
 +
<p>For the generation of our memory system we needed to create different parts. Because the Dronpa-caged Cre constructs are fusion proteins, we used the RFC25 standard for the assembly of these parts from the simple parts we generated from gBlocks synthesized by IDT.</p>
 +
<p>All simple parts were cloned into the shipping vector pSB1C3 for further use and submission to the registry. </p>
 +
<h2>Linkers for protein fusion</h2>
 +
<p>These parts contain the protein coding region for the generation of 6/9/12/15 amino acid linkers. The linker will be composed of 4 amino acids from the scars from using RFC25 standard and serine/glycine residues. The parts are supplied in RFC25 standard.
 +
Characterisation of these parts was not possible, because they do not fulfill a direct function.
 +
</p>
  
 +
<label class="collapse" for="_1"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680000"> BBa_K1680000:</a> Protein linker, 6 amino acids</h4></label>
 +
  <input id="_1" type="checkbox">
 +
        <div>
 +
Part only sequence: TCTTCT
 +
        </div>
  
−
<div class="highlightBox">
+
<label class="collapse" for="_2"><h4> <a href="http://parts.igem.org/Part:BBa_K1680001"> BBa_K1680001: </a> Protein linker, 9 amino acids</h4></label>
−
<h4>Note</h4>
+
  <input id="_2" type="checkbox">  
−
<p>Note that parts must be documented on the <a href="http://parts.igem.org/Main_Page"> Registry</a>. This page serves to <i>showcase</i> the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.</p>
+
        <div>
−
</div>
+
Part only sequence: TCTGGTTCTGGTTCT
 +
        </div>
  
 +
<label class="collapse" for="_3"><h4> <a href="http://parts.igem.org/Part:BBa_K1680002"> BBa_K1680002: </a> Protein linker, 12 amino acids</h4></label>
 +
  <input id="_3" type="checkbox">
 +
        <div>
 +
Part only sequence: TCTGGTTCTGGTGGTTCTGGTTCT
 +
        </div>
  
 +
<label class="collapse" for="_4"><h4> <a href="http://parts.igem.org/Part:BBa_K1680003"> BBa_K1680003: </a> Protein linker, 15 amino acids</h4></label>
 +
  <input id="_4" type="checkbox">
 +
        <div>
 +
Part only sequence: TCTGGTTCTGGTTCTGGTTCTGGTTCTGGTTCT
 +
        </div>
  
−
<h4>Adding parts to the registry</h4>
+
<h2>SV40 nuclear location sequence</h2>
−
<p>You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry">Add a Part to the Registry</a> link.</p>
+
<p>
−
<p>We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you <b>do</b> need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)</p>
+
This part contains the protein coding sequence for the nuclear localisation signal of SV40 large T antigen (amino acids: PKKKRKV). The part is supplied in RFC25 standard.
 +
This part was characterised as a fusion protein with Dronpa (BBa_K1680006). Fluorescence microscopy showed nuclear localisation of the fusion construct (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=1">see Results</a>).
 +
</p>
  
 +
<label class="collapse" for="_5"><h4> <a href="http://parts.igem.org/Part:BBa_K1680004"> BBa_K1680004: </a> SV40 NLS</h4></label>
 +
  <input id="_5" type="checkbox">
 +
        <div>
 +
Part only sequence: CCACCAAAGAAAAAGAGAAAAGTT
 +
        </div>
  
−
<h4>What information do I need to start putting my parts on the Registry?</h4>
+
<h2>loxP site</h2>
−
<p>The information needed to initially create a part on the Registry is:</p>
+
<p>
−
<ul>
+
This part contains the WT loxP site which is recognised by Cre recombinase (<a href= "http://parts.igem.org/Part:BBa_K1680007">BBa_K1680007</a>), in forward orientation. The part is supplied in RFC10.
−
<li>Part Name</li>
+
The Cre reporter part we assembled (<a href= "http://parts.igem.org/Part:BBa_K1680025">BBa_K1680025</a>) used this part and in vitro experiments showed an effective turnover by a purified Cre recombinase (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=2">see Results</a>).
−
<li>Part type</li>
+
</p>
−
<li>Creator</li>
+
<label class="collapse" for="_6"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680005">BBa_K1680005</a>: loxP site</h4></label>
−
<li>Sequence</li>
+
  <input id="_6" type="checkbox">  
−
<li>Short Description (60 characters on what the DNA does)</li>
+
        <div>
−
<li>Long Description (Longer description of what the DNA does)</li>
+
Part only sequence: ATAACTTCGTATAGCATACATTATACGAAGTTAT
−
<li>Design considerations</li>
+
        </div>
−
</ul>
+
  
 +
<h2>Fluorescent protein Dronpa</h2>
 
<p>
 
<p>
−
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. </p>
+
This part contains the protein coding sequence for a mutant (K145N) of the fluorescent protein Dronpa and is codon optimised for yeast. Dronpa is a photoswitchable protein. Fluorescence can be turned off by illumination with 488 nm light and switched back on by illumination with 405 nm. The K145N mutation leads to photoswitchable monomerisation/multimerisation behaviour (as described by Zhou et al. 2012). The part is supplied in RFC25.
 +
Fluorescence microscopy showed that the expression of this part works and photoswitching can be observed as expected (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=1">see Results</a>).  
 +
</p>
  
 +
<label class="collapse" for="_7"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>: Fluorescent protein Dronpa</h4></label>
 +
  <input id="_7" type="checkbox">
 +
        <div style="word-wrap:break-word;width:100%;">
 +
TCTGTTATCAAGCCAGACATGAAGATCAAGTTGAGAATGGAAGGTGCTGTTAACGGTCACCCATTCGCTATCGAAGGTGTTGGTTTGGGTAAGCCATTCGAAGGTAAGCAATCTATGGACTTGAAGGTTAAGGAAGGTGGTCCATTGCCATTCGCTTACGACATCTTGACTACTGTTTTCTGTTACGGTAACAGAGTTTTCGCTAAGTACCCAGAAAACATCGTTGACTACTTCAAGCAATCTTTCCCAGAAGGTTACTCTTGGGAAAGATCTATGAACTACGAAGACGGTGGTATCTGTAACGCTACTAACGACATCACTTTGGACGGTGACTGTTACATCTACGAAATCAGATTCGACGGTGTTAACTTCCCAGCTAACGGTCCAGTTATGCAAAAGAGAACTGTTAAGTGGGAACCATCTACTGAAAATTTGTACGTTAGAGACGGTGTTTTGAAGGGTGACGTTAACATGGCTTTGTCTTTGGAAGGTGGTGGTCACTACAGATGTGACTTCAAGACTACTTACAAGGCTAAGAAGGTTGTTCAATTGCCAGACTACCACTTCGTTGACCACCACATCGAAATCAAGTCTCACGACAAGGACTACTCTAACGTTAACTTGCACGAACACGCTGAAGCTCACTCTGAATTGCCAAGACAAGCTAAG
 +
        </div>
  
 +
<h2>Cre recombinase</h2>
 +
<p>
 +
This part contains the protein coding sequence  for the DNA recombinase Cre and is codon optimized for yeast. Cre recombinases recognize two loxp sites (<a href= "http://parts.igem.org/Part:BBa_K1680005">BBa_K1680005</a>) and depending on their orientation cuts out or reverses the DNA sequence between them. The part is supplied in RFC25.</p>
 +
<p>
 +
Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this plasmids, we were not able to characterise this part.
 +
</p>
  
 +
<label class="collapse" for="_8"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680007">BBa_K1680007</a>: Cre recombinase</h4></label>
 +
  <input id="_8" type="checkbox">
 +
        <div style="word-wrap:break-word;width:100%;">
 +
ATGTCTAATCTGCTTACTGTTCATCAAAATCTTCCTGCATTACCTGTTGATGCTACCTCAGACGAAGTTAGGAAAAACTTAATGGATATGTTTAGAGATAGACAAGCTTTCTCTGAACATACCTGGAAAATGTTATTAAGCGTTTGTCGTTCTTGGGCTGCATGGTGTAAATTAAATAATAGGAAGTGGTTCCCAGCAGAGCCTGAAGATGTGAGAGATTATTTGTTGTACTTACAGGCCAGAGGTTTAGCAGTAAAAACAATTCAACAACATTTAGGTCAATTGAATATGCTACACAGAAGATCCGGTTTGCCCAGACCTAGCGATTCTAATGCAGTGTCTTTAGTTATGAGGAGAATAAGAAAAGAAAATGTTGACGCCGGTGAAAGAGCCAAACAGGCATTAGCTTTTGAAAGGACAGATTTCGATCAAGTAAGGTCTCTTATGGAAAATTCAGATAGGTGCCAGGACATCAGAAATTTGGCATTTTTAGGCATAGCATATAATACGTTGCTGAGAATCGCAGAAATCGCAAGAATCAGAGTTAAAGACATTTCCAGAACAGATGGCGGCAGAATGTTGATACATATTGGCAGAACCAAAACTTTAGTTTCCACAGCAGGTGTCGAGAAAGCCTTGTCTTTAGGTGTTACGAAGCTTGTGGAAAGATGGATTTCTGTGTCTGGAGTGGCGGATGACCCAAATAACTATTTATTTTGCAGGGTGAGGAAAAATGGGGTAGCCGCTCCATCTGCTACTTCACAATTGTCAACGAGAGCCCTAGAGGGCATCTTCGAGGCTACACACAGGTTGATATATGGCGCCAAAGATGACTCTGGTCAAAGATACTTGGCCTGGTCCGGGCATTCTGCTAGAGTGGGGGCAGCAAGGGATATGGCAAGGGCGGGTGTCTCTATCCCAGAAATTATGCAAGCTGGTGGTTGGACCAATGTCAATATCGTTATGAACTATATAAGAAATCTTGACAGCGAGACTGGAGCAATGGTTAGACTTTTAGAAGACGGTGAC
 +
        </div>
  
 +
<h2>&#916;1-19 Cre recombinase</h2>
 +
<p>This part contains the protein coding region for a mutant (Deletion of AA1-19) of DNA recombinase Cre and is codon optimised for yeast. Cre recombinases recognize two loxP sites (<a href= "http://parts.igem.org/Part:BBa_K1680005">BBa_K1680005</a>) and depending on their orientation cuts out or reverses the DNA sequence between them. The first 19 amino acids were removed because these amino acids are most likely very flexible, because they could not be crystallized when the structure was determined (RCSB: <a href="http://www.rcsb.org/pdb/explore.do?structureId=3MGV">3MGV</a>). The part is supplied in RFC25.
 +
</p>
 +
<p>
 +
Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this part, we were not able to characterise this part.
 +
</p>
  
 +
<label class="collapse" for="_9"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680008">BBa_K1680008</a>: &#916;1-19 Cre recombinase</h4></label>
 +
  <input id="_9" type="checkbox">
 +
        <div style="word-wrap:break-word;width:100%;">
 +
Part only sequence: TCTGATGAAGTTAGAAAGAACCTGATGGACATGTTTAGAGATAGACAGGCTTTCAGTGAACATACCTGGAAGATGCTATTGTCCGTTTGCAGATCCTGGGCGGCGTGGTGTAAGCTTAATAATAGAAAATGGTTTCCTGCCGAACCTGAAGATGTTAGGGACTATCTACTGTATTTGCAAGCCAGAGGATTAGCCGTAAAAACAATTCAGCAGCACTTGGGTCAACTAAATATGTTACATAGACGTTCTGGTTTGCCGAGACCATCTGATTCCAATGCAGTCTCCTTAGTTATGAGAAGAATTAGAAAAGAAAATGTAGATGCCGGTGAAAGAGCAAAGCAGGCCTTAGCGTTCGAAAGAACTGACTTCGATCAAGTTAGGTCTTTAATGGAAAACAGTGACAGGTGTCAAGACATTAGAAATTTGGCTTTCTTGGGAATTGCCTATAACACGTTGTTAAGAATTGCAGAGATCGCCAGAATAAGGGTAAAGGATATATCTCGTACAGACGGTGGTAGAATGTTGATACACATCGGAAGAACTAAAACTTTGGTTTCAACAGCTGGGGTTGAGAAGGCCTTGAGTTTGGGTGTAACGAAGCTAGTCGAAAGATGGATTAGCGTTTCTGGTGTTGCCGACGACCCTAACAATTACCTATTTTGTAGAGTCAGGAAGAATGGCGTCGCTGCACCGTCAGCAACATCCCAGCTTTCAACTAGAGCGTTAGAGGGAATTTTTGAAGCAACACATAGACTGATTTATGGAGCCAAGGACGATAGTGGACAGCGTTATCTTGCTTGGTCTGGTCATAGTGCGAGAGTGGGAGCTGCAAGAGATATGGCGAGGGCTGGCGTCTCAATTCCCGAAATTATGCAAGCTGGGGGTTGGACAAACGTCAACATAGTGATGAACTACATCAGGAACTTGGACTCTGAGACAGGTGCGATGGTAAGGTTATTGGAGGATGGTGAC
 +
        </div>
  
−
<h4>Inspiration</h4>
+
<h2>NanoLuc</h2>
−
<p>We have a created  a <a href="http://parts.igem.org/Well_Documented_Parts">collection of well documented parts</a> that can help you get started.</p>
+
<p>This part contains the protein coding region for the NanoLuc(tm) luciferase, which is designed by  Promega Corporation and free for research use, and is codon optimised for yeast. The Nanoluc is smaller than other luciferase proteins and yields equal or stronger luminescence readings. The part is supplied in RFC10.
 +
</p>
 +
<p>
 +
We used this part successfully under the control of many promoters to determine promoter strength (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=3">see Results</a>).
 +
</p>
 +
 
 +
<label class="collapse" for="_10"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680009">BBa_K1680009:</a> NanoLuc</h4></label>
 +
  <input id="_10" type="checkbox">
 +
        <div style="word-wrap:break-word;width:100%;">
 +
ATGGTCTTCACCTTAGAAGACTTTGTTGGTGACTGGAGGCAAACTGCCGGTTATAATCTTGACCAAGTTTTGGAACAAGGTGGTGTATCATCACTTTTCCAGAATCTAGGAGTTAGCGTCACACCCATTCAAAGAATCGTCCTATCTGGCGAAAATGGTTTAAAAATTGATATTCATGTTATTATTCCCTATGAAGGTTTATCAGGAGATCAAATGGGTCAGATCGAGAAGATTTTTAAGGTGGTATATCCTGTCGATGACCACCACTTCAAAGTCATTTTGCATTATGGTACTTTGGTTATTGACGGCGTAACCCCTAACATGATTGATTACTTCGGTAGACCTTATGAGGGGATAGCAGTTTTTGATGGTAAAAAAATTACAGTCACAGGGACTTTATGGAACGGCAATAAAATCATCGACGAACGTCTAATCAATCCAGATGGATCATTGTTATTCAGGGTTACCATTAATGGAGTTACTGGTTGGAGATTGTGTGAGCGTATTTTGGCTTAA
 +
        </div>
 +
 
 +
<h2>Firefly Luciferase</h2>
 +
<p>
 +
This part contains the protein coding region for the firefly (Photinus pyralis) luciferase and is codon optimised for yeast. The part is supplied in RFC10.
 +
</p>
 +
<p>
 +
We tested this part with the Promega ONE-Glo Luciferase Assay System using both live cells and cell lysates without positive results.
 +
</p>
 +
 
 +
<label class="collapse" for="_11"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680010">BBa_K1680010:</a> Firefly Luciferase</h4></label>
 +
  <input id="_11" type="checkbox">
 +
        <div style="word-wrap:break-word;width:100%;">
 +
ATGGAGGACGCCAAGAATATCAAAAAGGGCCCCGCTCCATTCTATCCCTTGGAGGATGGAACCGCCGGGGAGCAGCTACATAAAGCTATGAAAAGATATGCTCTAGTACCTGGCACCATCGCCTTTACGGATGCCCATATCGAAGTTGACATAACATATGCAGAGTACTTTGAGATGTCTGTTAGATTGGCTGAGGCTATGAAGAGATATGGATTAAACACAAATCATCGTATCGTAGTTTGTTCTGAAAACTCCCTGCAATTTTTTATGCCAGTACTAGGTGCACTTTTCATTGGTGTTGCAGTAGCACCAGCCAATGACATATATAATGAAAGGGAATTGTTGAACAGTATGGGAATCTCACAACCTACCGTTGTCTTCGTTAGCAAAAAGGGCTTACAGAAGATATTGAACGTCCAAAAAAAATTGCCAATAATCCAAAAAATTATTATCATGGATTCAAAAACGGACTACCAAGGCTTTCAAAGCATGTACACGTTCGTTACGAGTCATCTTCCTCCAGGATTCAATGAATATGATTTTGTTCCTGAGTCTTTTGATCGTGATAAAACTATAGCTTTGATTATGAATAGCAGCGGTAGCACGGGCCTACCAAAAGGAGTAGCTCTGCCTCATAGGACAGCCTGTGTTAGATTTTCCCATGCAAGAGATCCCATTTTTGGTAATCAGATTATTCCTGACACGGCAATTCTATCAGTTGTGCCATTTCATCACGGTTTTGGAATGTTTACAACTCTAGGCTATCTAATATGTGGGTTTAGGGTAGTTTTGATGTATAGATTTGAAGAGGAATTGTTTTTAAGATCATTACAAGACTACAAGATTCAATCCGCTCTTCTTGTGCCTACCTTGTTCTCATTCTTTGCAAAATCTACTTTAATCGATAAATACGATTTGAGCAATTTACATGAAATTGCAAGTGGTGGCGCCCCGTTATCTAAGGAAGTGGGTGAGGCGGTTGCTAAAAGGTTTCATTTGCCTGGCATCAGGCAGGGTTATGGTCTAACTGAAACTACTTCAGCTATTCTGATCACTCCGGAGGGTGATGATAAACCTGGTGCAGTGGGAAAGGTTGTGCCATTTTTTGAAGCCAAAGTTGTAGATCTGGACACTGGTAAAACCTTAGGGGTGAATCAAAGAGGTGAATTGTGTGTGAGAGGACCCATGATCATGAGCGGTTACGTAAACAACCCAGAAGCTACTAATGCCTTAATCGATAAGGATGGCTGGCTGCATAGCGGGGATATCGCATATTGGGATGAAGATGAGCACTTCTTTATTGTAGATAGATTGAAATCATTGATTAAATATAAAGGTTACCAAGTGGCCCCTGCTGAATTGGAGTCAATACTGCTTCAGCATCCAAATATCTTCGATGCGGGTGTGGCTGGATTGCCAGATGATGATGCAGGTGAACTTCCCGCAGCAGTAGTTGTTTTAGAACATGGCAAAACGATGACTGAAAAAGAGATTGTTGATTACGTAGCATCTCAAGTTACTACAGCCAAAAAGCTTAGAGGTGGAGTGGTATTCGTTGATGAGGTACCAAAAGGTCTAACAGGTAAGTTAGACGCAAGAAAGATACGTGAAATATTAATTAAAGCCAAGAAAGGTGGTAAAATCGCTGTCTGA
 +
        </div>
 +
 
 +
 
 +
 
 +
<h2>HCV protease with linkers</h2>
 +
 
 +
<p>This part contains the protein coding region for the Hepatitis C virus (HCV) NS3-4A protease with N- & C-terminal linkers and is codon optimised for yeast. It is intended for combination with 145N-Dronpa (<a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>) to a light- dependent caged construct as described by <a href="https://2015.igem.org/Team:Tuebingen/References">[Zhou 2012]</a>. The part is supplied in RFC25.</p>
 +
<p>This part was intended as a backup for our project, due to time restraints we did not use it.</p>
 +
 
 +
<label class="collapse" for="_27"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680011">BBa_K1680011:</a> HCV protease with linkers</h4></label>
 +
  <input id="_27" type="checkbox">
 +
        <div style="word-wrap:break-word;width:100%;">Part only sequence: AAGGGTTCTATGGGTTCTTCTGGTACTGGTTGTGTTGTTATCGTTGGTAGAATCGTTTTGTCTGGTTCTGGTACTTCTGCTCCAATCACTGCTTACGCTCAACAAACTAGAGGTTTGTTGGGTTGTATCATCACTTCTTTGACTGGTAGAGACAAGAACCAAGTTGAAGGTGAAGTTCAAATCGTTTCTACTGCTACTCAAACTTTCTTGGCTACTTGTATCAACGGTGTTTGTTGGGCTGTTTACCACGGTGCTGGTACTAGAACTATCGCTTCTCCAAAGGGTCCAGTTATCCAAATGTACACTAACGTTGACCAAGACTTGGTTGGTTGGCCAGCTCCACAAGGTTCTCGTTCTTTGACTCCATGTACTTGTGGTTCTTCTGACTTGTACTTGGTTACTAGACACGCTGACGTTATCCCAGTTAGAAGAAGAGGTGACTCTCGTGGTTCTTTGTTGTCTCCAAGACCAATCTCTTACTTGAAGGGTTCTTCTGGTGGTCCATTGTTGTGTCCAGCTGGTCACGCTGTTGGTTTGTTCAGAGCTGCTGTTTGTACTAGAGGTGTTGCTAAGGCTGTTGACTTCATCCCAGTTGAAAACTTGGAAACTACTATGAGAGCTTCTGGTTCTTCTGGTTCTTCTGAATTT
 +
</div>
 +
 
 +
<h2>Cleavage site for HCV protease</h2>
 +
<p>This part contains the protein coding region for the cleavage site of the HCV NS3-4A protease (<a href= "http://parts.igem.org/Part:BBa_K1680011">BBa_K1680011</a>). The part is supplied in RFC25.
 +
This part was intended as a backup for our project, due to time restraints we did not use it.</p>
 +
<label class="collapse" for="_12"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680012">BBa_K1680012:</a> Cleavage site for HCV protease</h4></label>
 +
  <input id="_12" type="checkbox">
 +
        <div>
 +
GATGAAATGGAAGAGTGCAGTCAACATTATCCTTAT
 +
        </div>
 +
 
 +
<h2>NDegron</h2>
 +
<p>This part contains the protein coding region for an NDegron as described by Taxis et al. 2009. The NDegron enhances protein turnover by destabilising the protein it is fused to upon cleavage by TEV protease.</p>
 +
<p>The part is supplied in RFC25.
 +
This part was intended as a backup for our project, due to time restraints we did not use it.</p>
 +
<label class="collapse" for="_13"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680013">BBa_K1680013:</a> NDegron</h4></label>
 +
  <input id="_13" type="checkbox">
 +
        <div style="word-wrap:break-word;width:100%;">
 +
ATGGCCGGCCCCCCTAAGAAAAAGAGAAAAGTCAGCATTACAAGTTTGTACAAAAAAGCCGGTTCTGAGAATCTGTATTTCCAGTTCCACAAGAGCGGCGCTTGGAAGCTACCAGTTTCCCTGGTCAAGTTGGGTCTTGATAAGTTAGATTATAAGACCGGTTAA
 +
        </div>
 +
 
 +
<!-- DIA0 ENDE-->
 +
</div>
 +
 
 +
<div id="dia1" class="dia">
 +
<br>
 +
<p>
 +
The complex parts were assembled into the pTUM vector series (Team TU Munich 2012, e.g. <a href="http://parts.igem.org/Part:BBa_K801000">BBa_K801000</a>). Due to time constraints we were not able to clone these parts into the pSB backbone prior to part submission.<br>
 +
Additionally, we submitted the biobricked pRS vectors as well as the pETue vector.
 +
</p>
  
−
<p> You can also take a look at how other teams have documented their parts in their wiki:</p>
+
<h2>Yeast shuttle vectors with Biobrick MCS</h2>
 +
<p>These parts are biobricked shuttle vectors for yeast. The vectors were made compatible with the RFC10 standard and also contain an RFC10 cloning site. They all encode an ampicillin resistance gene and replicate to high-copy numbers in E.Coli. Furthermore, the CEN6/ARS4 (Chromosome VI centromere/Autonomously Replicating Sequence 4) cassette ensures that the plasmid stays at a low copy number in yeast, because they are treated as pseudo chromosomes. Each vector contains a different auxotrophy marker:</p>
 
<ul>
 
<ul>
−
<li><a href="https://2014.igem.org/Team:MIT/Parts"> 2014 MIT </a></li>
+
<li>pRS313 - HIS3</li>
−
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts"> 2014 Heidelberg</a></li>
+
<li>pRS315 - LEU2</li>
−
<li><a href="https://2014.igem.org/Team:Tokyo_Tech/Parts">2014 Tokyo Tech</a></li>
+
<li>pRS316 - URA3</li>
 
</ul>
 
</ul>
  
 +
<label class="collapse" for="_14"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680014">BBa_K1680014</a>: pRS313-MCS</h4></label>
 +
  <input id="_14" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/2/20/Team_Tuebingen_Plasmidmap-RS313.jpg"/>
 +
        </div>
 +
 +
<label class="collapse" for="_15"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680015">BBa_K1680015</a>: pRS315-MCS</h4></label>
 +
  <input id="_15" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/e/e2/Team_Tuebingen_Plasmidmap-RS315.jpg"/>
 +
        </div>
 +
 +
<label class="collapse" for="_16"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680016">BBa_K1680016</a>: pRS316-MCS</h4></label>
 +
  <input id="_16" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/6/63/Team_Tuebingen_Plasmidmap-RS316.jpg"/>
 +
        </div>
 +
 +
<h2>pETue</h2>
 +
<p>This part is a E. coli expression plasmid that is compatible with RFC10. The vector can be linearized with PstI/XmaI, so that parts cut with PstI/NgoMIV can be cloned into it. Overexpression of genes cloned into this site is IPTG inducible. It also encodes for a 6xHis-tag with a Thrombin cleavage site between coding region and 6xHis-tag, so that the His-tag can easily be cleaved off. The vector replicates with a high copy number in E. coli, and has an ampicillin resistance.</p>
 +
 +
<label class="collapse" for="_17"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680026">BBa_K1680026:</a> pETue</h4></label>
 +
  <input id="_17" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/4/43/Team_Tuebinge_pETue_map.png"/>
 +
        </div>
 +
 +
<h2>Cre-Dronpa Fusions</h2>
 +
<p>These parts contain the protein coding region for the fusion constructs of Cre Recombinase (BBa_K1680007) and 145N Dronpa (<a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>) with intermediate linkers (BBa_K1680000 - BBa_K1680003). Oligomerisation of Dronpa should stop Cre from accessing DNA in the nucleus thereby inhibiting it until light deactivation of Dronpa.</p>
 +
<p>These parts are</p>
 +
 +
<label class="collapse" for="_18"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680017">BBa_K1680017:</a> L6-Cre-L6-Dronpa</h4></label>
 +
  <input id="_18" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/0/00/Team_Tuebingen_parts-6C6D.png"/>
 +
        </div>
 +
 +
<label class="collapse" for="_19"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680018">BBa_K1680018:</a> L9-Cre-L9-Dronpa</h4></label>
 +
  <input id="_19" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/c/cf/Team_Tuebingen_parts-9C9D.png"/>
 +
 +
        </div>
 +
<label class="collapse" for="_20"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680019">BBa_K1680019:</a> L12-Cre-L12-Dronpa</h4></label>
 +
  <input id="_20" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/a/a8/Team_Tuebingen_parts-12C12D.png"/>
 +
 +
        </div>
 +
<label class="collapse" for="_21"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680020">BBa_K1680020:</a> L15-Cre-L15-Dronpa</h4></label>
 +
  <input id="_21" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/9/9a/Team_Tuebingen_parts-15C15D.png"/>
 +
 +
        </div>
 +
 +
<h2>Dronpa caged Cre with NLS</h2>
 +
<p>These parts contains the protein coding region for a fusion protein of Cre recombinase (<a href= "http://parts.igem.org/Part:BBa_K1680007">BBa_K1680007</a>) that is C- & N-terminal flanked with 145N Dronpa (<a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>) using a 6/9/12/15 AA linker as spacer (BBa_K1680000 - BBa_K16800003). The construct has an N-terminal NLS sequence (<a href= "http://parts.igem.org/Part:BBa_K1680004">BBa_K1680004</a>). In the expressed construct the two Dronpa domains should form multimers leading to an inactive Cre recombinase that is reversibly activatable through Dronpa illumination (see Zhou et al 2012).
 +
</p>
 +
<label class="collapse" for="_22"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680021">BBa_K1680021:</a> NLS-DN-L6-Cre-L6-DN</h4></label>
 +
  <input id="_22" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/6/64/Team_Tuebingen_parts-cage6.png"/>
 +
 +
        </div>
 +
<label class="collapse" for="_23"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680022">BBa_K1680022:</a> NLS-DN-L9-Cre-L9-DN</h4></label>
 +
  <input id="_23" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/a/ac/Team_Tuebingen_parts-cage9.png "/>
 +
 +
        </div>
 +
<label class="collapse" for="_24"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680023">BBa_K1680023:</a> NLS-DN-L12-Cre-L12-DN</h4></label>
 +
  <input id="_24" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src=" https://static.igem.org/mediawiki/2015/1/17/Team_Tuebingen_parts-cage12.png"/>
 +
 +
        </div>
 +
<label class="collapse" for="_25"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680024">BBa_K1680024:</a> NLS-DN-L15-Cre-L15-DN</h4></label>
 +
  <input id="_25" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/5/54/Team_Tuebingen_parts-cage15.png"/>
  
 +
        </div>
  
−
<h4>Part Table </h4>
+
<h2>RFP-Luciferase Cre reporter </h2>
−
</html>
+
<p>This part encodes a reporter cassette for the Cre Recombinase (e.g. BBa_K1680007) in Yeast. An active Cre protein will switch expression from RFP to NanoLuc luciferase. It is composed of pADH-loxp-RFP-tADH-loxp-Nluc.</p>
−
<groupparts>iGEM015 Example</groupparts>
+
−
<html>
+
  
 +
<label class="collapse" for="_26"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680025">BBa_K1680025:</a> RFP-Luciferase Cre cassette</h4></label>
 +
  <input id="_26" type="checkbox">
 +
        <div>
 +
<img id="teamfoto" style="max-height:300px;display: block; margin-left: auto;margin-right: auto;" src="https://static.igem.org/mediawiki/2015/c/c8/Team_Tuebingen_parts-stop.png"/>
  
 +
        </div>
 +
        </div>
  
 
</div>
 
</div>
 
</html>
 
</html>

Latest revision as of 17:01, 9 November 2015

<
>

For the generation of our memory system we needed to create different parts. Because the Dronpa-caged Cre constructs are fusion proteins, we used the RFC25 standard for the assembly of these parts from the simple parts we generated from gBlocks synthesized by IDT.

All simple parts were cloned into the shipping vector pSB1C3 for further use and submission to the registry.

Linkers for protein fusion

These parts contain the protein coding region for the generation of 6/9/12/15 amino acid linkers. The linker will be composed of 4 amino acids from the scars from using RFC25 standard and serine/glycine residues. The parts are supplied in RFC25 standard. Characterisation of these parts was not possible, because they do not fulfill a direct function.

Part only sequence: TCTTCT
Part only sequence: TCTGGTTCTGGTTCT
Part only sequence: TCTGGTTCTGGTGGTTCTGGTTCT
Part only sequence: TCTGGTTCTGGTTCTGGTTCTGGTTCTGGTTCT

SV40 nuclear location sequence

This part contains the protein coding sequence for the nuclear localisation signal of SV40 large T antigen (amino acids: PKKKRKV). The part is supplied in RFC25 standard. This part was characterised as a fusion protein with Dronpa (BBa_K1680006). Fluorescence microscopy showed nuclear localisation of the fusion construct (see Results).

Part only sequence: CCACCAAAGAAAAAGAGAAAAGTT

loxP site

This part contains the WT loxP site which is recognised by Cre recombinase (BBa_K1680007), in forward orientation. The part is supplied in RFC10. The Cre reporter part we assembled (BBa_K1680025) used this part and in vitro experiments showed an effective turnover by a purified Cre recombinase (see Results).

Part only sequence: ATAACTTCGTATAGCATACATTATACGAAGTTAT

Fluorescent protein Dronpa

This part contains the protein coding sequence for a mutant (K145N) of the fluorescent protein Dronpa and is codon optimised for yeast. Dronpa is a photoswitchable protein. Fluorescence can be turned off by illumination with 488 nm light and switched back on by illumination with 405 nm. The K145N mutation leads to photoswitchable monomerisation/multimerisation behaviour (as described by Zhou et al. 2012). The part is supplied in RFC25. Fluorescence microscopy showed that the expression of this part works and photoswitching can be observed as expected (see Results).

TCTGTTATCAAGCCAGACATGAAGATCAAGTTGAGAATGGAAGGTGCTGTTAACGGTCACCCATTCGCTATCGAAGGTGTTGGTTTGGGTAAGCCATTCGAAGGTAAGCAATCTATGGACTTGAAGGTTAAGGAAGGTGGTCCATTGCCATTCGCTTACGACATCTTGACTACTGTTTTCTGTTACGGTAACAGAGTTTTCGCTAAGTACCCAGAAAACATCGTTGACTACTTCAAGCAATCTTTCCCAGAAGGTTACTCTTGGGAAAGATCTATGAACTACGAAGACGGTGGTATCTGTAACGCTACTAACGACATCACTTTGGACGGTGACTGTTACATCTACGAAATCAGATTCGACGGTGTTAACTTCCCAGCTAACGGTCCAGTTATGCAAAAGAGAACTGTTAAGTGGGAACCATCTACTGAAAATTTGTACGTTAGAGACGGTGTTTTGAAGGGTGACGTTAACATGGCTTTGTCTTTGGAAGGTGGTGGTCACTACAGATGTGACTTCAAGACTACTTACAAGGCTAAGAAGGTTGTTCAATTGCCAGACTACCACTTCGTTGACCACCACATCGAAATCAAGTCTCACGACAAGGACTACTCTAACGTTAACTTGCACGAACACGCTGAAGCTCACTCTGAATTGCCAAGACAAGCTAAG

Cre recombinase

This part contains the protein coding sequence for the DNA recombinase Cre and is codon optimized for yeast. Cre recombinases recognize two loxp sites (BBa_K1680005) and depending on their orientation cuts out or reverses the DNA sequence between them. The part is supplied in RFC25.

Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this plasmids, we were not able to characterise this part.

ATGTCTAATCTGCTTACTGTTCATCAAAATCTTCCTGCATTACCTGTTGATGCTACCTCAGACGAAGTTAGGAAAAACTTAATGGATATGTTTAGAGATAGACAAGCTTTCTCTGAACATACCTGGAAAATGTTATTAAGCGTTTGTCGTTCTTGGGCTGCATGGTGTAAATTAAATAATAGGAAGTGGTTCCCAGCAGAGCCTGAAGATGTGAGAGATTATTTGTTGTACTTACAGGCCAGAGGTTTAGCAGTAAAAACAATTCAACAACATTTAGGTCAATTGAATATGCTACACAGAAGATCCGGTTTGCCCAGACCTAGCGATTCTAATGCAGTGTCTTTAGTTATGAGGAGAATAAGAAAAGAAAATGTTGACGCCGGTGAAAGAGCCAAACAGGCATTAGCTTTTGAAAGGACAGATTTCGATCAAGTAAGGTCTCTTATGGAAAATTCAGATAGGTGCCAGGACATCAGAAATTTGGCATTTTTAGGCATAGCATATAATACGTTGCTGAGAATCGCAGAAATCGCAAGAATCAGAGTTAAAGACATTTCCAGAACAGATGGCGGCAGAATGTTGATACATATTGGCAGAACCAAAACTTTAGTTTCCACAGCAGGTGTCGAGAAAGCCTTGTCTTTAGGTGTTACGAAGCTTGTGGAAAGATGGATTTCTGTGTCTGGAGTGGCGGATGACCCAAATAACTATTTATTTTGCAGGGTGAGGAAAAATGGGGTAGCCGCTCCATCTGCTACTTCACAATTGTCAACGAGAGCCCTAGAGGGCATCTTCGAGGCTACACACAGGTTGATATATGGCGCCAAAGATGACTCTGGTCAAAGATACTTGGCCTGGTCCGGGCATTCTGCTAGAGTGGGGGCAGCAAGGGATATGGCAAGGGCGGGTGTCTCTATCCCAGAAATTATGCAAGCTGGTGGTTGGACCAATGTCAATATCGTTATGAACTATATAAGAAATCTTGACAGCGAGACTGGAGCAATGGTTAGACTTTTAGAAGACGGTGAC

Δ1-19 Cre recombinase

This part contains the protein coding region for a mutant (Deletion of AA1-19) of DNA recombinase Cre and is codon optimised for yeast. Cre recombinases recognize two loxP sites (BBa_K1680005) and depending on their orientation cuts out or reverses the DNA sequence between them. The first 19 amino acids were removed because these amino acids are most likely very flexible, because they could not be crystallized when the structure was determined (RCSB: 3MGV). The part is supplied in RFC25.

Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this part, we were not able to characterise this part.

Part only sequence: TCTGATGAAGTTAGAAAGAACCTGATGGACATGTTTAGAGATAGACAGGCTTTCAGTGAACATACCTGGAAGATGCTATTGTCCGTTTGCAGATCCTGGGCGGCGTGGTGTAAGCTTAATAATAGAAAATGGTTTCCTGCCGAACCTGAAGATGTTAGGGACTATCTACTGTATTTGCAAGCCAGAGGATTAGCCGTAAAAACAATTCAGCAGCACTTGGGTCAACTAAATATGTTACATAGACGTTCTGGTTTGCCGAGACCATCTGATTCCAATGCAGTCTCCTTAGTTATGAGAAGAATTAGAAAAGAAAATGTAGATGCCGGTGAAAGAGCAAAGCAGGCCTTAGCGTTCGAAAGAACTGACTTCGATCAAGTTAGGTCTTTAATGGAAAACAGTGACAGGTGTCAAGACATTAGAAATTTGGCTTTCTTGGGAATTGCCTATAACACGTTGTTAAGAATTGCAGAGATCGCCAGAATAAGGGTAAAGGATATATCTCGTACAGACGGTGGTAGAATGTTGATACACATCGGAAGAACTAAAACTTTGGTTTCAACAGCTGGGGTTGAGAAGGCCTTGAGTTTGGGTGTAACGAAGCTAGTCGAAAGATGGATTAGCGTTTCTGGTGTTGCCGACGACCCTAACAATTACCTATTTTGTAGAGTCAGGAAGAATGGCGTCGCTGCACCGTCAGCAACATCCCAGCTTTCAACTAGAGCGTTAGAGGGAATTTTTGAAGCAACACATAGACTGATTTATGGAGCCAAGGACGATAGTGGACAGCGTTATCTTGCTTGGTCTGGTCATAGTGCGAGAGTGGGAGCTGCAAGAGATATGGCGAGGGCTGGCGTCTCAATTCCCGAAATTATGCAAGCTGGGGGTTGGACAAACGTCAACATAGTGATGAACTACATCAGGAACTTGGACTCTGAGACAGGTGCGATGGTAAGGTTATTGGAGGATGGTGAC

NanoLuc

This part contains the protein coding region for the NanoLuc(tm) luciferase, which is designed by Promega Corporation and free for research use, and is codon optimised for yeast. The Nanoluc is smaller than other luciferase proteins and yields equal or stronger luminescence readings. The part is supplied in RFC10.

We used this part successfully under the control of many promoters to determine promoter strength (see Results).

ATGGTCTTCACCTTAGAAGACTTTGTTGGTGACTGGAGGCAAACTGCCGGTTATAATCTTGACCAAGTTTTGGAACAAGGTGGTGTATCATCACTTTTCCAGAATCTAGGAGTTAGCGTCACACCCATTCAAAGAATCGTCCTATCTGGCGAAAATGGTTTAAAAATTGATATTCATGTTATTATTCCCTATGAAGGTTTATCAGGAGATCAAATGGGTCAGATCGAGAAGATTTTTAAGGTGGTATATCCTGTCGATGACCACCACTTCAAAGTCATTTTGCATTATGGTACTTTGGTTATTGACGGCGTAACCCCTAACATGATTGATTACTTCGGTAGACCTTATGAGGGGATAGCAGTTTTTGATGGTAAAAAAATTACAGTCACAGGGACTTTATGGAACGGCAATAAAATCATCGACGAACGTCTAATCAATCCAGATGGATCATTGTTATTCAGGGTTACCATTAATGGAGTTACTGGTTGGAGATTGTGTGAGCGTATTTTGGCTTAA

Firefly Luciferase

This part contains the protein coding region for the firefly (Photinus pyralis) luciferase and is codon optimised for yeast. The part is supplied in RFC10.

We tested this part with the Promega ONE-Glo Luciferase Assay System using both live cells and cell lysates without positive results.

ATGGAGGACGCCAAGAATATCAAAAAGGGCCCCGCTCCATTCTATCCCTTGGAGGATGGAACCGCCGGGGAGCAGCTACATAAAGCTATGAAAAGATATGCTCTAGTACCTGGCACCATCGCCTTTACGGATGCCCATATCGAAGTTGACATAACATATGCAGAGTACTTTGAGATGTCTGTTAGATTGGCTGAGGCTATGAAGAGATATGGATTAAACACAAATCATCGTATCGTAGTTTGTTCTGAAAACTCCCTGCAATTTTTTATGCCAGTACTAGGTGCACTTTTCATTGGTGTTGCAGTAGCACCAGCCAATGACATATATAATGAAAGGGAATTGTTGAACAGTATGGGAATCTCACAACCTACCGTTGTCTTCGTTAGCAAAAAGGGCTTACAGAAGATATTGAACGTCCAAAAAAAATTGCCAATAATCCAAAAAATTATTATCATGGATTCAAAAACGGACTACCAAGGCTTTCAAAGCATGTACACGTTCGTTACGAGTCATCTTCCTCCAGGATTCAATGAATATGATTTTGTTCCTGAGTCTTTTGATCGTGATAAAACTATAGCTTTGATTATGAATAGCAGCGGTAGCACGGGCCTACCAAAAGGAGTAGCTCTGCCTCATAGGACAGCCTGTGTTAGATTTTCCCATGCAAGAGATCCCATTTTTGGTAATCAGATTATTCCTGACACGGCAATTCTATCAGTTGTGCCATTTCATCACGGTTTTGGAATGTTTACAACTCTAGGCTATCTAATATGTGGGTTTAGGGTAGTTTTGATGTATAGATTTGAAGAGGAATTGTTTTTAAGATCATTACAAGACTACAAGATTCAATCCGCTCTTCTTGTGCCTACCTTGTTCTCATTCTTTGCAAAATCTACTTTAATCGATAAATACGATTTGAGCAATTTACATGAAATTGCAAGTGGTGGCGCCCCGTTATCTAAGGAAGTGGGTGAGGCGGTTGCTAAAAGGTTTCATTTGCCTGGCATCAGGCAGGGTTATGGTCTAACTGAAACTACTTCAGCTATTCTGATCACTCCGGAGGGTGATGATAAACCTGGTGCAGTGGGAAAGGTTGTGCCATTTTTTGAAGCCAAAGTTGTAGATCTGGACACTGGTAAAACCTTAGGGGTGAATCAAAGAGGTGAATTGTGTGTGAGAGGACCCATGATCATGAGCGGTTACGTAAACAACCCAGAAGCTACTAATGCCTTAATCGATAAGGATGGCTGGCTGCATAGCGGGGATATCGCATATTGGGATGAAGATGAGCACTTCTTTATTGTAGATAGATTGAAATCATTGATTAAATATAAAGGTTACCAAGTGGCCCCTGCTGAATTGGAGTCAATACTGCTTCAGCATCCAAATATCTTCGATGCGGGTGTGGCTGGATTGCCAGATGATGATGCAGGTGAACTTCCCGCAGCAGTAGTTGTTTTAGAACATGGCAAAACGATGACTGAAAAAGAGATTGTTGATTACGTAGCATCTCAAGTTACTACAGCCAAAAAGCTTAGAGGTGGAGTGGTATTCGTTGATGAGGTACCAAAAGGTCTAACAGGTAAGTTAGACGCAAGAAAGATACGTGAAATATTAATTAAAGCCAAGAAAGGTGGTAAAATCGCTGTCTGA

HCV protease with linkers

This part contains the protein coding region for the Hepatitis C virus (HCV) NS3-4A protease with N- & C-terminal linkers and is codon optimised for yeast. It is intended for combination with 145N-Dronpa (BBa_K1680006) to a light- dependent caged construct as described by [Zhou 2012]. The part is supplied in RFC25.

This part was intended as a backup for our project, due to time restraints we did not use it.

Part only sequence: AAGGGTTCTATGGGTTCTTCTGGTACTGGTTGTGTTGTTATCGTTGGTAGAATCGTTTTGTCTGGTTCTGGTACTTCTGCTCCAATCACTGCTTACGCTCAACAAACTAGAGGTTTGTTGGGTTGTATCATCACTTCTTTGACTGGTAGAGACAAGAACCAAGTTGAAGGTGAAGTTCAAATCGTTTCTACTGCTACTCAAACTTTCTTGGCTACTTGTATCAACGGTGTTTGTTGGGCTGTTTACCACGGTGCTGGTACTAGAACTATCGCTTCTCCAAAGGGTCCAGTTATCCAAATGTACACTAACGTTGACCAAGACTTGGTTGGTTGGCCAGCTCCACAAGGTTCTCGTTCTTTGACTCCATGTACTTGTGGTTCTTCTGACTTGTACTTGGTTACTAGACACGCTGACGTTATCCCAGTTAGAAGAAGAGGTGACTCTCGTGGTTCTTTGTTGTCTCCAAGACCAATCTCTTACTTGAAGGGTTCTTCTGGTGGTCCATTGTTGTGTCCAGCTGGTCACGCTGTTGGTTTGTTCAGAGCTGCTGTTTGTACTAGAGGTGTTGCTAAGGCTGTTGACTTCATCCCAGTTGAAAACTTGGAAACTACTATGAGAGCTTCTGGTTCTTCTGGTTCTTCTGAATTT

Cleavage site for HCV protease

This part contains the protein coding region for the cleavage site of the HCV NS3-4A protease (BBa_K1680011). The part is supplied in RFC25. This part was intended as a backup for our project, due to time restraints we did not use it.

GATGAAATGGAAGAGTGCAGTCAACATTATCCTTAT

NDegron

This part contains the protein coding region for an NDegron as described by Taxis et al. 2009. The NDegron enhances protein turnover by destabilising the protein it is fused to upon cleavage by TEV protease.

The part is supplied in RFC25. This part was intended as a backup for our project, due to time restraints we did not use it.

ATGGCCGGCCCCCCTAAGAAAAAGAGAAAAGTCAGCATTACAAGTTTGTACAAAAAAGCCGGTTCTGAGAATCTGTATTTCCAGTTCCACAAGAGCGGCGCTTGGAAGCTACCAGTTTCCCTGGTCAAGTTGGGTCTTGATAAGTTAGATTATAAGACCGGTTAA

The complex parts were assembled into the pTUM vector series (Team TU Munich 2012, e.g. BBa_K801000). Due to time constraints we were not able to clone these parts into the pSB backbone prior to part submission.
Additionally, we submitted the biobricked pRS vectors as well as the pETue vector.

Yeast shuttle vectors with Biobrick MCS

These parts are biobricked shuttle vectors for yeast. The vectors were made compatible with the RFC10 standard and also contain an RFC10 cloning site. They all encode an ampicillin resistance gene and replicate to high-copy numbers in E.Coli. Furthermore, the CEN6/ARS4 (Chromosome VI centromere/Autonomously Replicating Sequence 4) cassette ensures that the plasmid stays at a low copy number in yeast, because they are treated as pseudo chromosomes. Each vector contains a different auxotrophy marker:

  • pRS313 - HIS3
  • pRS315 - LEU2
  • pRS316 - URA3

pETue

This part is a E. coli expression plasmid that is compatible with RFC10. The vector can be linearized with PstI/XmaI, so that parts cut with PstI/NgoMIV can be cloned into it. Overexpression of genes cloned into this site is IPTG inducible. It also encodes for a 6xHis-tag with a Thrombin cleavage site between coding region and 6xHis-tag, so that the His-tag can easily be cleaved off. The vector replicates with a high copy number in E. coli, and has an ampicillin resistance.

Cre-Dronpa Fusions

These parts contain the protein coding region for the fusion constructs of Cre Recombinase (BBa_K1680007) and 145N Dronpa (BBa_K1680006) with intermediate linkers (BBa_K1680000 - BBa_K1680003). Oligomerisation of Dronpa should stop Cre from accessing DNA in the nucleus thereby inhibiting it until light deactivation of Dronpa.

These parts are

Dronpa caged Cre with NLS

These parts contains the protein coding region for a fusion protein of Cre recombinase (BBa_K1680007) that is C- & N-terminal flanked with 145N Dronpa (BBa_K1680006) using a 6/9/12/15 AA linker as spacer (BBa_K1680000 - BBa_K16800003). The construct has an N-terminal NLS sequence (BBa_K1680004). In the expressed construct the two Dronpa domains should form multimers leading to an inactive Cre recombinase that is reversibly activatable through Dronpa illumination (see Zhou et al 2012).

RFP-Luciferase Cre reporter

This part encodes a reporter cassette for the Cre Recombinase (e.g. BBa_K1680007) in Yeast. An active Cre protein will switch expression from RFP to NanoLuc luciferase. It is composed of pADH-loxp-RFP-tADH-loxp-Nluc.