Difference between revisions of "Team:Tuebingen/Parts"
Nicolai vK (Talk | contribs) |
Nicolai vK (Talk | contribs) |
||
| (8 intermediate revisions by the same user not shown) | |||
| Line 43: | Line 43: | ||
<p> | <p> | ||
This part contains the protein coding sequence for the nuclear localisation signal of SV40 large T antigen (amino acids: PKKKRKV). The part is supplied in RFC25 standard. | This part contains the protein coding sequence for the nuclear localisation signal of SV40 large T antigen (amino acids: PKKKRKV). The part is supplied in RFC25 standard. | ||
| − | This part was characterised as a fusion protein with Dronpa (BBa_K1680006). Fluorescence microscopy showed nuclear localisation of the fusion construct (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=1"> see Results </a>). | + | This part was characterised as a fusion protein with Dronpa (BBa_K1680006). Fluorescence microscopy showed nuclear localisation of the fusion construct (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=1">see Results</a>). |
</p> | </p> | ||
| − | <label class="collapse" for="_5"><h4> <a href=http://parts.igem.org/Part:BBa_K1680004"> BBa_K1680004: </a> SV40 NLS</h4></label> | + | <label class="collapse" for="_5"><h4> <a href="http://parts.igem.org/Part:BBa_K1680004"> BBa_K1680004: </a> SV40 NLS</h4></label> |
<input id="_5" type="checkbox"> | <input id="_5" type="checkbox"> | ||
<div> | <div> | ||
| Line 54: | Line 54: | ||
<h2>loxP site</h2> | <h2>loxP site</h2> | ||
<p> | <p> | ||
| − | This part contains the WT loxP site which is recognised by Cre recombinase (BBa_K1680007), in forward orientation. The part is supplied in RFC10. | + | This part contains the WT loxP site which is recognised by Cre recombinase (<a href= "http://parts.igem.org/Part:BBa_K1680007">BBa_K1680007</a>), in forward orientation. The part is supplied in RFC10. |
| − | The Cre reporter part we assembled (BBa_K1680025) used this part and in vitro experiments showed an effective turnover by a purified Cre recombinase (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=2>see Results</a>). | + | The Cre reporter part we assembled (<a href= "http://parts.igem.org/Part:BBa_K1680025">BBa_K1680025</a>) used this part and in vitro experiments showed an effective turnover by a purified Cre recombinase (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=2">see Results</a>). |
</p> | </p> | ||
| − | <label class="collapse" for="_6"><h4> BBa_K1680005: loxP site</h4></label> | + | <label class="collapse" for="_6"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680005">BBa_K1680005</a>: loxP site</h4></label> |
<input id="_6" type="checkbox"> | <input id="_6" type="checkbox"> | ||
<div> | <div> | ||
| Line 66: | Line 66: | ||
<p> | <p> | ||
This part contains the protein coding sequence for a mutant (K145N) of the fluorescent protein Dronpa and is codon optimised for yeast. Dronpa is a photoswitchable protein. Fluorescence can be turned off by illumination with 488 nm light and switched back on by illumination with 405 nm. The K145N mutation leads to photoswitchable monomerisation/multimerisation behaviour (as described by Zhou et al. 2012). The part is supplied in RFC25. | This part contains the protein coding sequence for a mutant (K145N) of the fluorescent protein Dronpa and is codon optimised for yeast. Dronpa is a photoswitchable protein. Fluorescence can be turned off by illumination with 488 nm light and switched back on by illumination with 405 nm. The K145N mutation leads to photoswitchable monomerisation/multimerisation behaviour (as described by Zhou et al. 2012). The part is supplied in RFC25. | ||
| − | Fluorescence microscopy showed that the expression of this part works and photoswitching can be observed as expected (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=1>see Results</a>). | + | Fluorescence microscopy showed that the expression of this part works and photoswitching can be observed as expected (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=1">see Results</a>). |
</p> | </p> | ||
| − | <label class="collapse" for="_7"><h4>BBa_K1680006: Fluorescent protein Dronpa</h4></label> | + | <label class="collapse" for="_7"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>: Fluorescent protein Dronpa</h4></label> |
<input id="_7" type="checkbox"> | <input id="_7" type="checkbox"> | ||
<div style="word-wrap:break-word;width:100%;"> | <div style="word-wrap:break-word;width:100%;"> | ||
| Line 77: | Line 77: | ||
<h2>Cre recombinase</h2> | <h2>Cre recombinase</h2> | ||
<p> | <p> | ||
| − | This part contains the protein coding sequence for the DNA recombinase Cre and is codon optimized for yeast. Cre recombinases recognize two loxp sites (BBa_K1680005) and depending on their orientation cuts out or reverses the DNA sequence between them. The part is supplied in RFC25.</p> | + | This part contains the protein coding sequence for the DNA recombinase Cre and is codon optimized for yeast. Cre recombinases recognize two loxp sites (<a href= "http://parts.igem.org/Part:BBa_K1680005">BBa_K1680005</a>) and depending on their orientation cuts out or reverses the DNA sequence between them. The part is supplied in RFC25.</p> |
<p> | <p> | ||
Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this plasmids, we were not able to characterise this part. | Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this plasmids, we were not able to characterise this part. | ||
</p> | </p> | ||
| − | <label class="collapse" for="_8"><h4> BBa_K1680007: Cre recombinase</h4></label> | + | <label class="collapse" for="_8"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680007">BBa_K1680007</a>: Cre recombinase</h4></label> |
<input id="_8" type="checkbox"> | <input id="_8" type="checkbox"> | ||
<div style="word-wrap:break-word;width:100%;"> | <div style="word-wrap:break-word;width:100%;"> | ||
| Line 89: | Line 89: | ||
<h2>Δ1-19 Cre recombinase</h2> | <h2>Δ1-19 Cre recombinase</h2> | ||
| − | <p>This part contains the protein coding region for a mutant (Deletion of AA1-19) of DNA recombinase Cre and is codon optimised for yeast. Cre recombinases recognize two loxP sites (BBa_K1680005) and depending on their orientation cuts out or reverses the DNA sequence between them. The first 19 amino acids were removed because these amino acids are most likely very flexible, because they could not be crystallized when the structure was determined (RCSB: 3MGV). The part is supplied in RFC25. | + | <p>This part contains the protein coding region for a mutant (Deletion of AA1-19) of DNA recombinase Cre and is codon optimised for yeast. Cre recombinases recognize two loxP sites (<a href= "http://parts.igem.org/Part:BBa_K1680005">BBa_K1680005</a>) and depending on their orientation cuts out or reverses the DNA sequence between them. The first 19 amino acids were removed because these amino acids are most likely very flexible, because they could not be crystallized when the structure was determined (RCSB: <a href="http://www.rcsb.org/pdb/explore.do?structureId=3MGV">3MGV</a>). The part is supplied in RFC25. |
</p> | </p> | ||
<p> | <p> | ||
| Line 95: | Line 95: | ||
</p> | </p> | ||
| − | <label class="collapse" for="_9"><h4> BBa_K1680008: Δ1-19 Cre recombinase</h4></label> | + | <label class="collapse" for="_9"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680008">BBa_K1680008</a>: Δ1-19 Cre recombinase</h4></label> |
<input id="_9" type="checkbox"> | <input id="_9" type="checkbox"> | ||
<div style="word-wrap:break-word;width:100%;"> | <div style="word-wrap:break-word;width:100%;"> | ||
| Line 105: | Line 105: | ||
</p> | </p> | ||
<p> | <p> | ||
| − | We used this part successfully under the control of many promoters to determine promoter strength (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=3>see Results</a>). | + | We used this part successfully under the control of many promoters to determine promoter strength (<a href="https://2015.igem.org/Team:Tuebingen/Results?slide=3">see Results</a>). |
</p> | </p> | ||
| − | <label class="collapse" for="_10"><h4> BBa_K1680009: NanoLuc</h4></label> | + | <label class="collapse" for="_10"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680009">BBa_K1680009:</a> NanoLuc</h4></label> |
<input id="_10" type="checkbox"> | <input id="_10" type="checkbox"> | ||
<div style="word-wrap:break-word;width:100%;"> | <div style="word-wrap:break-word;width:100%;"> | ||
| Line 122: | Line 122: | ||
</p> | </p> | ||
| − | <label class="collapse" for="_11"><h4> BBa_K1680010: Firefly Luciferase</h4></label> | + | <label class="collapse" for="_11"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680010">BBa_K1680010:</a> Firefly Luciferase</h4></label> |
<input id="_11" type="checkbox"> | <input id="_11" type="checkbox"> | ||
<div style="word-wrap:break-word;width:100%;"> | <div style="word-wrap:break-word;width:100%;"> | ||
ATGGAGGACGCCAAGAATATCAAAAAGGGCCCCGCTCCATTCTATCCCTTGGAGGATGGAACCGCCGGGGAGCAGCTACATAAAGCTATGAAAAGATATGCTCTAGTACCTGGCACCATCGCCTTTACGGATGCCCATATCGAAGTTGACATAACATATGCAGAGTACTTTGAGATGTCTGTTAGATTGGCTGAGGCTATGAAGAGATATGGATTAAACACAAATCATCGTATCGTAGTTTGTTCTGAAAACTCCCTGCAATTTTTTATGCCAGTACTAGGTGCACTTTTCATTGGTGTTGCAGTAGCACCAGCCAATGACATATATAATGAAAGGGAATTGTTGAACAGTATGGGAATCTCACAACCTACCGTTGTCTTCGTTAGCAAAAAGGGCTTACAGAAGATATTGAACGTCCAAAAAAAATTGCCAATAATCCAAAAAATTATTATCATGGATTCAAAAACGGACTACCAAGGCTTTCAAAGCATGTACACGTTCGTTACGAGTCATCTTCCTCCAGGATTCAATGAATATGATTTTGTTCCTGAGTCTTTTGATCGTGATAAAACTATAGCTTTGATTATGAATAGCAGCGGTAGCACGGGCCTACCAAAAGGAGTAGCTCTGCCTCATAGGACAGCCTGTGTTAGATTTTCCCATGCAAGAGATCCCATTTTTGGTAATCAGATTATTCCTGACACGGCAATTCTATCAGTTGTGCCATTTCATCACGGTTTTGGAATGTTTACAACTCTAGGCTATCTAATATGTGGGTTTAGGGTAGTTTTGATGTATAGATTTGAAGAGGAATTGTTTTTAAGATCATTACAAGACTACAAGATTCAATCCGCTCTTCTTGTGCCTACCTTGTTCTCATTCTTTGCAAAATCTACTTTAATCGATAAATACGATTTGAGCAATTTACATGAAATTGCAAGTGGTGGCGCCCCGTTATCTAAGGAAGTGGGTGAGGCGGTTGCTAAAAGGTTTCATTTGCCTGGCATCAGGCAGGGTTATGGTCTAACTGAAACTACTTCAGCTATTCTGATCACTCCGGAGGGTGATGATAAACCTGGTGCAGTGGGAAAGGTTGTGCCATTTTTTGAAGCCAAAGTTGTAGATCTGGACACTGGTAAAACCTTAGGGGTGAATCAAAGAGGTGAATTGTGTGTGAGAGGACCCATGATCATGAGCGGTTACGTAAACAACCCAGAAGCTACTAATGCCTTAATCGATAAGGATGGCTGGCTGCATAGCGGGGATATCGCATATTGGGATGAAGATGAGCACTTCTTTATTGTAGATAGATTGAAATCATTGATTAAATATAAAGGTTACCAAGTGGCCCCTGCTGAATTGGAGTCAATACTGCTTCAGCATCCAAATATCTTCGATGCGGGTGTGGCTGGATTGCCAGATGATGATGCAGGTGAACTTCCCGCAGCAGTAGTTGTTTTAGAACATGGCAAAACGATGACTGAAAAAGAGATTGTTGATTACGTAGCATCTCAAGTTACTACAGCCAAAAAGCTTAGAGGTGGAGTGGTATTCGTTGATGAGGTACCAAAAGGTCTAACAGGTAAGTTAGACGCAAGAAAGATACGTGAAATATTAATTAAAGCCAAGAAAGGTGGTAAAATCGCTGTCTGA | ATGGAGGACGCCAAGAATATCAAAAAGGGCCCCGCTCCATTCTATCCCTTGGAGGATGGAACCGCCGGGGAGCAGCTACATAAAGCTATGAAAAGATATGCTCTAGTACCTGGCACCATCGCCTTTACGGATGCCCATATCGAAGTTGACATAACATATGCAGAGTACTTTGAGATGTCTGTTAGATTGGCTGAGGCTATGAAGAGATATGGATTAAACACAAATCATCGTATCGTAGTTTGTTCTGAAAACTCCCTGCAATTTTTTATGCCAGTACTAGGTGCACTTTTCATTGGTGTTGCAGTAGCACCAGCCAATGACATATATAATGAAAGGGAATTGTTGAACAGTATGGGAATCTCACAACCTACCGTTGTCTTCGTTAGCAAAAAGGGCTTACAGAAGATATTGAACGTCCAAAAAAAATTGCCAATAATCCAAAAAATTATTATCATGGATTCAAAAACGGACTACCAAGGCTTTCAAAGCATGTACACGTTCGTTACGAGTCATCTTCCTCCAGGATTCAATGAATATGATTTTGTTCCTGAGTCTTTTGATCGTGATAAAACTATAGCTTTGATTATGAATAGCAGCGGTAGCACGGGCCTACCAAAAGGAGTAGCTCTGCCTCATAGGACAGCCTGTGTTAGATTTTCCCATGCAAGAGATCCCATTTTTGGTAATCAGATTATTCCTGACACGGCAATTCTATCAGTTGTGCCATTTCATCACGGTTTTGGAATGTTTACAACTCTAGGCTATCTAATATGTGGGTTTAGGGTAGTTTTGATGTATAGATTTGAAGAGGAATTGTTTTTAAGATCATTACAAGACTACAAGATTCAATCCGCTCTTCTTGTGCCTACCTTGTTCTCATTCTTTGCAAAATCTACTTTAATCGATAAATACGATTTGAGCAATTTACATGAAATTGCAAGTGGTGGCGCCCCGTTATCTAAGGAAGTGGGTGAGGCGGTTGCTAAAAGGTTTCATTTGCCTGGCATCAGGCAGGGTTATGGTCTAACTGAAACTACTTCAGCTATTCTGATCACTCCGGAGGGTGATGATAAACCTGGTGCAGTGGGAAAGGTTGTGCCATTTTTTGAAGCCAAAGTTGTAGATCTGGACACTGGTAAAACCTTAGGGGTGAATCAAAGAGGTGAATTGTGTGTGAGAGGACCCATGATCATGAGCGGTTACGTAAACAACCCAGAAGCTACTAATGCCTTAATCGATAAGGATGGCTGGCTGCATAGCGGGGATATCGCATATTGGGATGAAGATGAGCACTTCTTTATTGTAGATAGATTGAAATCATTGATTAAATATAAAGGTTACCAAGTGGCCCCTGCTGAATTGGAGTCAATACTGCTTCAGCATCCAAATATCTTCGATGCGGGTGTGGCTGGATTGCCAGATGATGATGCAGGTGAACTTCCCGCAGCAGTAGTTGTTTTAGAACATGGCAAAACGATGACTGAAAAAGAGATTGTTGATTACGTAGCATCTCAAGTTACTACAGCCAAAAAGCTTAGAGGTGGAGTGGTATTCGTTGATGAGGTACCAAAAGGTCTAACAGGTAAGTTAGACGCAAGAAAGATACGTGAAATATTAATTAAAGCCAAGAAAGGTGGTAAAATCGCTGTCTGA | ||
</div> | </div> | ||
| + | |||
| + | |||
| + | |||
| + | <h2>HCV protease with linkers</h2> | ||
| + | |||
| + | <p>This part contains the protein coding region for the Hepatitis C virus (HCV) NS3-4A protease with N- & C-terminal linkers and is codon optimised for yeast. It is intended for combination with 145N-Dronpa (<a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>) to a light- dependent caged construct as described by <a href="https://2015.igem.org/Team:Tuebingen/References">[Zhou 2012]</a>. The part is supplied in RFC25.</p> | ||
| + | <p>This part was intended as a backup for our project, due to time restraints we did not use it.</p> | ||
| + | |||
| + | <label class="collapse" for="_27"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680011">BBa_K1680011:</a> HCV protease with linkers</h4></label> | ||
| + | <input id="_27" type="checkbox"> | ||
| + | <div style="word-wrap:break-word;width:100%;">Part only sequence: AAGGGTTCTATGGGTTCTTCTGGTACTGGTTGTGTTGTTATCGTTGGTAGAATCGTTTTGTCTGGTTCTGGTACTTCTGCTCCAATCACTGCTTACGCTCAACAAACTAGAGGTTTGTTGGGTTGTATCATCACTTCTTTGACTGGTAGAGACAAGAACCAAGTTGAAGGTGAAGTTCAAATCGTTTCTACTGCTACTCAAACTTTCTTGGCTACTTGTATCAACGGTGTTTGTTGGGCTGTTTACCACGGTGCTGGTACTAGAACTATCGCTTCTCCAAAGGGTCCAGTTATCCAAATGTACACTAACGTTGACCAAGACTTGGTTGGTTGGCCAGCTCCACAAGGTTCTCGTTCTTTGACTCCATGTACTTGTGGTTCTTCTGACTTGTACTTGGTTACTAGACACGCTGACGTTATCCCAGTTAGAAGAAGAGGTGACTCTCGTGGTTCTTTGTTGTCTCCAAGACCAATCTCTTACTTGAAGGGTTCTTCTGGTGGTCCATTGTTGTGTCCAGCTGGTCACGCTGTTGGTTTGTTCAGAGCTGCTGTTTGTACTAGAGGTGTTGCTAAGGCTGTTGACTTCATCCCAGTTGAAAACTTGGAAACTACTATGAGAGCTTCTGGTTCTTCTGGTTCTTCTGAATTT | ||
| + | </div> | ||
<h2>Cleavage site for HCV protease</h2> | <h2>Cleavage site for HCV protease</h2> | ||
| − | <p>This part contains the protein coding region for the cleavage site of the HCV NS3-4A protease (Part BBa_K1680011). The part is supplied in RFC25. | + | <p>This part contains the protein coding region for the cleavage site of the HCV NS3-4A protease (<a href= "http://parts.igem.org/Part:BBa_K1680011">BBa_K1680011</a>). The part is supplied in RFC25. |
This part was intended as a backup for our project, due to time restraints we did not use it.</p> | This part was intended as a backup for our project, due to time restraints we did not use it.</p> | ||
| − | <label class="collapse" for="_12"><h4>BBa_K1680012: Cleavage site for HCV protease</h4></label> | + | <label class="collapse" for="_12"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680012">BBa_K1680012:</a> Cleavage site for HCV protease</h4></label> |
<input id="_12" type="checkbox"> | <input id="_12" type="checkbox"> | ||
<div> | <div> | ||
| Line 141: | Line 153: | ||
<p>The part is supplied in RFC25. | <p>The part is supplied in RFC25. | ||
This part was intended as a backup for our project, due to time restraints we did not use it.</p> | This part was intended as a backup for our project, due to time restraints we did not use it.</p> | ||
| − | <label class="collapse" for="_13"><h4> BBa_K1680013: NDegron</h4></label> | + | <label class="collapse" for="_13"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680013">BBa_K1680013:</a> NDegron</h4></label> |
<input id="_13" type="checkbox"> | <input id="_13" type="checkbox"> | ||
<div style="word-wrap:break-word;width:100%;"> | <div style="word-wrap:break-word;width:100%;"> | ||
| Line 153: | Line 165: | ||
<br> | <br> | ||
<p> | <p> | ||
| − | The complex parts were assembled into the pTUM vector series (Team TU Munich 2012< | + | The complex parts were assembled into the pTUM vector series (Team TU Munich 2012, e.g. <a href="http://parts.igem.org/Part:BBa_K801000">BBa_K801000</a>). Due to time constraints we were not able to clone these parts into the pSB backbone prior to part submission.<br> |
Additionally, we submitted the biobricked pRS vectors as well as the pETue vector. | Additionally, we submitted the biobricked pRS vectors as well as the pETue vector. | ||
</p> | </p> | ||
| Line 165: | Line 177: | ||
</ul> | </ul> | ||
| − | <label class="collapse" for="_14"><h4> BBa_K1680014: pRS313-MCS</h4></label> | + | <label class="collapse" for="_14"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680014">BBa_K1680014</a>: pRS313-MCS</h4></label> |
<input id="_14" type="checkbox"> | <input id="_14" type="checkbox"> | ||
<div> | <div> | ||
| Line 171: | Line 183: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_15"><h4> BBa_K1680015: pRS315-MCS</h4></label> | + | <label class="collapse" for="_15"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680015">BBa_K1680015</a>: pRS315-MCS</h4></label> |
<input id="_15" type="checkbox"> | <input id="_15" type="checkbox"> | ||
<div> | <div> | ||
| Line 177: | Line 189: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_16"><h4> BBa_K1680016: pRS316-MCS</h4></label> | + | <label class="collapse" for="_16"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680016">BBa_K1680016</a>: pRS316-MCS</h4></label> |
<input id="_16" type="checkbox"> | <input id="_16" type="checkbox"> | ||
<div> | <div> | ||
| Line 185: | Line 197: | ||
<h2>pETue</h2> | <h2>pETue</h2> | ||
<p>This part is a E. coli expression plasmid that is compatible with RFC10. The vector can be linearized with PstI/XmaI, so that parts cut with PstI/NgoMIV can be cloned into it. Overexpression of genes cloned into this site is IPTG inducible. It also encodes for a 6xHis-tag with a Thrombin cleavage site between coding region and 6xHis-tag, so that the His-tag can easily be cleaved off. The vector replicates with a high copy number in E. coli, and has an ampicillin resistance.</p> | <p>This part is a E. coli expression plasmid that is compatible with RFC10. The vector can be linearized with PstI/XmaI, so that parts cut with PstI/NgoMIV can be cloned into it. Overexpression of genes cloned into this site is IPTG inducible. It also encodes for a 6xHis-tag with a Thrombin cleavage site between coding region and 6xHis-tag, so that the His-tag can easily be cleaved off. The vector replicates with a high copy number in E. coli, and has an ampicillin resistance.</p> | ||
| − | <label class="collapse" for="_17"><h4> BBa_K1680026: pETue</h4></label> | + | |
| + | <label class="collapse" for="_17"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680026">BBa_K1680026:</a> pETue</h4></label> | ||
<input id="_17" type="checkbox"> | <input id="_17" type="checkbox"> | ||
<div> | <div> | ||
| Line 192: | Line 205: | ||
<h2>Cre-Dronpa Fusions</h2> | <h2>Cre-Dronpa Fusions</h2> | ||
| − | <p>These parts contain the protein coding region for the fusion constructs of Cre Recombinase (BBa_K1680007) and 145N Dronpa (BBa_K1680006) with intermediate linkers (BBa_K1680000 - BBa_K1680003). Oligomerisation of Dronpa should stop Cre from accessing DNA in the nucleus thereby inhibiting it until light deactivation of Dronpa.</p> | + | <p>These parts contain the protein coding region for the fusion constructs of Cre Recombinase (BBa_K1680007) and 145N Dronpa (<a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>) with intermediate linkers (BBa_K1680000 - BBa_K1680003). Oligomerisation of Dronpa should stop Cre from accessing DNA in the nucleus thereby inhibiting it until light deactivation of Dronpa.</p> |
<p>These parts are</p> | <p>These parts are</p> | ||
| − | <label class="collapse" for="_18"><h4> BBa_K1680017: L6-Cre-L6-Dronpa</h4></label> | + | <label class="collapse" for="_18"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680017">BBa_K1680017:</a> L6-Cre-L6-Dronpa</h4></label> |
<input id="_18" type="checkbox"> | <input id="_18" type="checkbox"> | ||
<div> | <div> | ||
| Line 201: | Line 214: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_19"><h4> | + | <label class="collapse" for="_19"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680018">BBa_K1680018:</a> L9-Cre-L9-Dronpa</h4></label> |
<input id="_19" type="checkbox"> | <input id="_19" type="checkbox"> | ||
<div> | <div> | ||
| Line 207: | Line 220: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_20"><h4> BBa_K1680019: L12-Cre-L12-Dronpa</h4></label> | + | <label class="collapse" for="_20"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680019">BBa_K1680019:</a> L12-Cre-L12-Dronpa</h4></label> |
<input id="_20" type="checkbox"> | <input id="_20" type="checkbox"> | ||
<div> | <div> | ||
| Line 213: | Line 226: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_21"><h4> BBa_K1680020: L15-Cre-L15-Dronpa</h4></label> | + | <label class="collapse" for="_21"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680020">BBa_K1680020:</a> L15-Cre-L15-Dronpa</h4></label> |
<input id="_21" type="checkbox"> | <input id="_21" type="checkbox"> | ||
<div> | <div> | ||
| Line 221: | Line 234: | ||
<h2>Dronpa caged Cre with NLS</h2> | <h2>Dronpa caged Cre with NLS</h2> | ||
| − | <p>These parts contains the protein coding region for a fusion protein of Cre recombinase (BBa_K1680007) that is C- & N-terminal flanked with 145N Dronpa (BBa_K1680006) using a 6/9/12/15 AA linker as spacer ( | + | <p>These parts contains the protein coding region for a fusion protein of Cre recombinase (<a href= "http://parts.igem.org/Part:BBa_K1680007">BBa_K1680007</a>) that is C- & N-terminal flanked with 145N Dronpa (<a href= "http://parts.igem.org/Part:BBa_K1680006">BBa_K1680006</a>) using a 6/9/12/15 AA linker as spacer (BBa_K1680000 - BBa_K16800003). The construct has an N-terminal NLS sequence (<a href= "http://parts.igem.org/Part:BBa_K1680004">BBa_K1680004</a>). In the expressed construct the two Dronpa domains should form multimers leading to an inactive Cre recombinase that is reversibly activatable through Dronpa illumination (see Zhou et al 2012). |
</p> | </p> | ||
| − | <label class="collapse" for="_22"><h4> BBa_K1680021: NLS-DN-L6-Cre-L6-DN</h4></label> | + | <label class="collapse" for="_22"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680021">BBa_K1680021:</a> NLS-DN-L6-Cre-L6-DN</h4></label> |
<input id="_22" type="checkbox"> | <input id="_22" type="checkbox"> | ||
<div> | <div> | ||
| Line 229: | Line 242: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_23"><h4> BBa_K1680022: NLS-DN-L9-Cre-L9-DN</h4></label> | + | <label class="collapse" for="_23"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680022">BBa_K1680022:</a> NLS-DN-L9-Cre-L9-DN</h4></label> |
<input id="_23" type="checkbox"> | <input id="_23" type="checkbox"> | ||
<div> | <div> | ||
| Line 235: | Line 248: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_24"><h4> BBa_K1680023: NLS-DN-L12-Cre-L12-DN</h4></label> | + | <label class="collapse" for="_24"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680023">BBa_K1680023:</a> NLS-DN-L12-Cre-L12-DN</h4></label> |
<input id="_24" type="checkbox"> | <input id="_24" type="checkbox"> | ||
<div> | <div> | ||
| Line 241: | Line 254: | ||
</div> | </div> | ||
| − | <label class="collapse" for="_25"><h4> BBa_K1680024: NLS-DN-L15-Cre-L15-DN</h4></label> | + | <label class="collapse" for="_25"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680024">BBa_K1680024:</a> NLS-DN-L15-Cre-L15-DN</h4></label> |
<input id="_25" type="checkbox"> | <input id="_25" type="checkbox"> | ||
<div> | <div> | ||
| Line 250: | Line 263: | ||
<h2>RFP-Luciferase Cre reporter </h2> | <h2>RFP-Luciferase Cre reporter </h2> | ||
<p>This part encodes a reporter cassette for the Cre Recombinase (e.g. BBa_K1680007) in Yeast. An active Cre protein will switch expression from RFP to NanoLuc luciferase. It is composed of pADH-loxp-RFP-tADH-loxp-Nluc.</p> | <p>This part encodes a reporter cassette for the Cre Recombinase (e.g. BBa_K1680007) in Yeast. An active Cre protein will switch expression from RFP to NanoLuc luciferase. It is composed of pADH-loxp-RFP-tADH-loxp-Nluc.</p> | ||
| − | <label class="collapse" for="_26"><h4> BBa_K1680025: RFP-Luciferase Cre cassette</h4></label> | + | |
| + | <label class="collapse" for="_26"><h4> <a href= "http://parts.igem.org/Part:BBa_K1680025">BBa_K1680025:</a> RFP-Luciferase Cre cassette</h4></label> | ||
<input id="_26" type="checkbox"> | <input id="_26" type="checkbox"> | ||
<div> | <div> | ||
Latest revision as of 17:01, 9 November 2015
<
>
For the generation of our memory system we needed to create different parts. Because the Dronpa-caged Cre constructs are fusion proteins, we used the RFC25 standard for the assembly of these parts from the simple parts we generated from gBlocks synthesized by IDT.
All simple parts were cloned into the shipping vector pSB1C3 for further use and submission to the registry.
Linkers for protein fusion
These parts contain the protein coding region for the generation of 6/9/12/15 amino acid linkers. The linker will be composed of 4 amino acids from the scars from using RFC25 standard and serine/glycine residues. The parts are supplied in RFC25 standard. Characterisation of these parts was not possible, because they do not fulfill a direct function.
Part only sequence: TCTTCT
Part only sequence: TCTGGTTCTGGTTCT
Part only sequence: TCTGGTTCTGGTGGTTCTGGTTCT
Part only sequence: TCTGGTTCTGGTTCTGGTTCTGGTTCTGGTTCT
SV40 nuclear location sequence
This part contains the protein coding sequence for the nuclear localisation signal of SV40 large T antigen (amino acids: PKKKRKV). The part is supplied in RFC25 standard. This part was characterised as a fusion protein with Dronpa (BBa_K1680006). Fluorescence microscopy showed nuclear localisation of the fusion construct (see Results).
Part only sequence: CCACCAAAGAAAAAGAGAAAAGTT
loxP site
This part contains the WT loxP site which is recognised by Cre recombinase (BBa_K1680007), in forward orientation. The part is supplied in RFC10. The Cre reporter part we assembled (BBa_K1680025) used this part and in vitro experiments showed an effective turnover by a purified Cre recombinase (see Results).
Part only sequence: ATAACTTCGTATAGCATACATTATACGAAGTTAT
Fluorescent protein Dronpa
This part contains the protein coding sequence for a mutant (K145N) of the fluorescent protein Dronpa and is codon optimised for yeast. Dronpa is a photoswitchable protein. Fluorescence can be turned off by illumination with 488 nm light and switched back on by illumination with 405 nm. The K145N mutation leads to photoswitchable monomerisation/multimerisation behaviour (as described by Zhou et al. 2012). The part is supplied in RFC25. Fluorescence microscopy showed that the expression of this part works and photoswitching can be observed as expected (see Results).
TCTGTTATCAAGCCAGACATGAAGATCAAGTTGAGAATGGAAGGTGCTGTTAACGGTCACCCATTCGCTATCGAAGGTGTTGGTTTGGGTAAGCCATTCGAAGGTAAGCAATCTATGGACTTGAAGGTTAAGGAAGGTGGTCCATTGCCATTCGCTTACGACATCTTGACTACTGTTTTCTGTTACGGTAACAGAGTTTTCGCTAAGTACCCAGAAAACATCGTTGACTACTTCAAGCAATCTTTCCCAGAAGGTTACTCTTGGGAAAGATCTATGAACTACGAAGACGGTGGTATCTGTAACGCTACTAACGACATCACTTTGGACGGTGACTGTTACATCTACGAAATCAGATTCGACGGTGTTAACTTCCCAGCTAACGGTCCAGTTATGCAAAAGAGAACTGTTAAGTGGGAACCATCTACTGAAAATTTGTACGTTAGAGACGGTGTTTTGAAGGGTGACGTTAACATGGCTTTGTCTTTGGAAGGTGGTGGTCACTACAGATGTGACTTCAAGACTACTTACAAGGCTAAGAAGGTTGTTCAATTGCCAGACTACCACTTCGTTGACCACCACATCGAAATCAAGTCTCACGACAAGGACTACTCTAACGTTAACTTGCACGAACACGCTGAAGCTCACTCTGAATTGCCAAGACAAGCTAAG
Cre recombinase
This part contains the protein coding sequence for the DNA recombinase Cre and is codon optimized for yeast. Cre recombinases recognize two loxp sites (BBa_K1680005) and depending on their orientation cuts out or reverses the DNA sequence between them. The part is supplied in RFC25.
Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this plasmids, we were not able to characterise this part.
ATGTCTAATCTGCTTACTGTTCATCAAAATCTTCCTGCATTACCTGTTGATGCTACCTCAGACGAAGTTAGGAAAAACTTAATGGATATGTTTAGAGATAGACAAGCTTTCTCTGAACATACCTGGAAAATGTTATTAAGCGTTTGTCGTTCTTGGGCTGCATGGTGTAAATTAAATAATAGGAAGTGGTTCCCAGCAGAGCCTGAAGATGTGAGAGATTATTTGTTGTACTTACAGGCCAGAGGTTTAGCAGTAAAAACAATTCAACAACATTTAGGTCAATTGAATATGCTACACAGAAGATCCGGTTTGCCCAGACCTAGCGATTCTAATGCAGTGTCTTTAGTTATGAGGAGAATAAGAAAAGAAAATGTTGACGCCGGTGAAAGAGCCAAACAGGCATTAGCTTTTGAAAGGACAGATTTCGATCAAGTAAGGTCTCTTATGGAAAATTCAGATAGGTGCCAGGACATCAGAAATTTGGCATTTTTAGGCATAGCATATAATACGTTGCTGAGAATCGCAGAAATCGCAAGAATCAGAGTTAAAGACATTTCCAGAACAGATGGCGGCAGAATGTTGATACATATTGGCAGAACCAAAACTTTAGTTTCCACAGCAGGTGTCGAGAAAGCCTTGTCTTTAGGTGTTACGAAGCTTGTGGAAAGATGGATTTCTGTGTCTGGAGTGGCGGATGACCCAAATAACTATTTATTTTGCAGGGTGAGGAAAAATGGGGTAGCCGCTCCATCTGCTACTTCACAATTGTCAACGAGAGCCCTAGAGGGCATCTTCGAGGCTACACACAGGTTGATATATGGCGCCAAAGATGACTCTGGTCAAAGATACTTGGCCTGGTCCGGGCATTCTGCTAGAGTGGGGGCAGCAAGGGATATGGCAAGGGCGGGTGTCTCTATCCCAGAAATTATGCAAGCTGGTGGTTGGACCAATGTCAATATCGTTATGAACTATATAAGAAATCTTGACAGCGAGACTGGAGCAATGGTTAGACTTTTAGAAGACGGTGAC
Δ1-19 Cre recombinase
This part contains the protein coding region for a mutant (Deletion of AA1-19) of DNA recombinase Cre and is codon optimised for yeast. Cre recombinases recognize two loxP sites (BBa_K1680005) and depending on their orientation cuts out or reverses the DNA sequence between them. The first 19 amino acids were removed because these amino acids are most likely very flexible, because they could not be crystallized when the structure was determined (RCSB: 3MGV). The part is supplied in RFC25.
Due to time constraints and failed attempts at cloning our Cre reporter into a vector for cotransfection with this part, we were not able to characterise this part.
Part only sequence: TCTGATGAAGTTAGAAAGAACCTGATGGACATGTTTAGAGATAGACAGGCTTTCAGTGAACATACCTGGAAGATGCTATTGTCCGTTTGCAGATCCTGGGCGGCGTGGTGTAAGCTTAATAATAGAAAATGGTTTCCTGCCGAACCTGAAGATGTTAGGGACTATCTACTGTATTTGCAAGCCAGAGGATTAGCCGTAAAAACAATTCAGCAGCACTTGGGTCAACTAAATATGTTACATAGACGTTCTGGTTTGCCGAGACCATCTGATTCCAATGCAGTCTCCTTAGTTATGAGAAGAATTAGAAAAGAAAATGTAGATGCCGGTGAAAGAGCAAAGCAGGCCTTAGCGTTCGAAAGAACTGACTTCGATCAAGTTAGGTCTTTAATGGAAAACAGTGACAGGTGTCAAGACATTAGAAATTTGGCTTTCTTGGGAATTGCCTATAACACGTTGTTAAGAATTGCAGAGATCGCCAGAATAAGGGTAAAGGATATATCTCGTACAGACGGTGGTAGAATGTTGATACACATCGGAAGAACTAAAACTTTGGTTTCAACAGCTGGGGTTGAGAAGGCCTTGAGTTTGGGTGTAACGAAGCTAGTCGAAAGATGGATTAGCGTTTCTGGTGTTGCCGACGACCCTAACAATTACCTATTTTGTAGAGTCAGGAAGAATGGCGTCGCTGCACCGTCAGCAACATCCCAGCTTTCAACTAGAGCGTTAGAGGGAATTTTTGAAGCAACACATAGACTGATTTATGGAGCCAAGGACGATAGTGGACAGCGTTATCTTGCTTGGTCTGGTCATAGTGCGAGAGTGGGAGCTGCAAGAGATATGGCGAGGGCTGGCGTCTCAATTCCCGAAATTATGCAAGCTGGGGGTTGGACAAACGTCAACATAGTGATGAACTACATCAGGAACTTGGACTCTGAGACAGGTGCGATGGTAAGGTTATTGGAGGATGGTGAC
NanoLuc
This part contains the protein coding region for the NanoLuc(tm) luciferase, which is designed by Promega Corporation and free for research use, and is codon optimised for yeast. The Nanoluc is smaller than other luciferase proteins and yields equal or stronger luminescence readings. The part is supplied in RFC10.
We used this part successfully under the control of many promoters to determine promoter strength (see Results).
ATGGTCTTCACCTTAGAAGACTTTGTTGGTGACTGGAGGCAAACTGCCGGTTATAATCTTGACCAAGTTTTGGAACAAGGTGGTGTATCATCACTTTTCCAGAATCTAGGAGTTAGCGTCACACCCATTCAAAGAATCGTCCTATCTGGCGAAAATGGTTTAAAAATTGATATTCATGTTATTATTCCCTATGAAGGTTTATCAGGAGATCAAATGGGTCAGATCGAGAAGATTTTTAAGGTGGTATATCCTGTCGATGACCACCACTTCAAAGTCATTTTGCATTATGGTACTTTGGTTATTGACGGCGTAACCCCTAACATGATTGATTACTTCGGTAGACCTTATGAGGGGATAGCAGTTTTTGATGGTAAAAAAATTACAGTCACAGGGACTTTATGGAACGGCAATAAAATCATCGACGAACGTCTAATCAATCCAGATGGATCATTGTTATTCAGGGTTACCATTAATGGAGTTACTGGTTGGAGATTGTGTGAGCGTATTTTGGCTTAA
Firefly Luciferase
This part contains the protein coding region for the firefly (Photinus pyralis) luciferase and is codon optimised for yeast. The part is supplied in RFC10.
We tested this part with the Promega ONE-Glo Luciferase Assay System using both live cells and cell lysates without positive results.
ATGGAGGACGCCAAGAATATCAAAAAGGGCCCCGCTCCATTCTATCCCTTGGAGGATGGAACCGCCGGGGAGCAGCTACATAAAGCTATGAAAAGATATGCTCTAGTACCTGGCACCATCGCCTTTACGGATGCCCATATCGAAGTTGACATAACATATGCAGAGTACTTTGAGATGTCTGTTAGATTGGCTGAGGCTATGAAGAGATATGGATTAAACACAAATCATCGTATCGTAGTTTGTTCTGAAAACTCCCTGCAATTTTTTATGCCAGTACTAGGTGCACTTTTCATTGGTGTTGCAGTAGCACCAGCCAATGACATATATAATGAAAGGGAATTGTTGAACAGTATGGGAATCTCACAACCTACCGTTGTCTTCGTTAGCAAAAAGGGCTTACAGAAGATATTGAACGTCCAAAAAAAATTGCCAATAATCCAAAAAATTATTATCATGGATTCAAAAACGGACTACCAAGGCTTTCAAAGCATGTACACGTTCGTTACGAGTCATCTTCCTCCAGGATTCAATGAATATGATTTTGTTCCTGAGTCTTTTGATCGTGATAAAACTATAGCTTTGATTATGAATAGCAGCGGTAGCACGGGCCTACCAAAAGGAGTAGCTCTGCCTCATAGGACAGCCTGTGTTAGATTTTCCCATGCAAGAGATCCCATTTTTGGTAATCAGATTATTCCTGACACGGCAATTCTATCAGTTGTGCCATTTCATCACGGTTTTGGAATGTTTACAACTCTAGGCTATCTAATATGTGGGTTTAGGGTAGTTTTGATGTATAGATTTGAAGAGGAATTGTTTTTAAGATCATTACAAGACTACAAGATTCAATCCGCTCTTCTTGTGCCTACCTTGTTCTCATTCTTTGCAAAATCTACTTTAATCGATAAATACGATTTGAGCAATTTACATGAAATTGCAAGTGGTGGCGCCCCGTTATCTAAGGAAGTGGGTGAGGCGGTTGCTAAAAGGTTTCATTTGCCTGGCATCAGGCAGGGTTATGGTCTAACTGAAACTACTTCAGCTATTCTGATCACTCCGGAGGGTGATGATAAACCTGGTGCAGTGGGAAAGGTTGTGCCATTTTTTGAAGCCAAAGTTGTAGATCTGGACACTGGTAAAACCTTAGGGGTGAATCAAAGAGGTGAATTGTGTGTGAGAGGACCCATGATCATGAGCGGTTACGTAAACAACCCAGAAGCTACTAATGCCTTAATCGATAAGGATGGCTGGCTGCATAGCGGGGATATCGCATATTGGGATGAAGATGAGCACTTCTTTATTGTAGATAGATTGAAATCATTGATTAAATATAAAGGTTACCAAGTGGCCCCTGCTGAATTGGAGTCAATACTGCTTCAGCATCCAAATATCTTCGATGCGGGTGTGGCTGGATTGCCAGATGATGATGCAGGTGAACTTCCCGCAGCAGTAGTTGTTTTAGAACATGGCAAAACGATGACTGAAAAAGAGATTGTTGATTACGTAGCATCTCAAGTTACTACAGCCAAAAAGCTTAGAGGTGGAGTGGTATTCGTTGATGAGGTACCAAAAGGTCTAACAGGTAAGTTAGACGCAAGAAAGATACGTGAAATATTAATTAAAGCCAAGAAAGGTGGTAAAATCGCTGTCTGA
HCV protease with linkers
This part contains the protein coding region for the Hepatitis C virus (HCV) NS3-4A protease with N- & C-terminal linkers and is codon optimised for yeast. It is intended for combination with 145N-Dronpa (BBa_K1680006) to a light- dependent caged construct as described by [Zhou 2012]. The part is supplied in RFC25.
This part was intended as a backup for our project, due to time restraints we did not use it.
Part only sequence: AAGGGTTCTATGGGTTCTTCTGGTACTGGTTGTGTTGTTATCGTTGGTAGAATCGTTTTGTCTGGTTCTGGTACTTCTGCTCCAATCACTGCTTACGCTCAACAAACTAGAGGTTTGTTGGGTTGTATCATCACTTCTTTGACTGGTAGAGACAAGAACCAAGTTGAAGGTGAAGTTCAAATCGTTTCTACTGCTACTCAAACTTTCTTGGCTACTTGTATCAACGGTGTTTGTTGGGCTGTTTACCACGGTGCTGGTACTAGAACTATCGCTTCTCCAAAGGGTCCAGTTATCCAAATGTACACTAACGTTGACCAAGACTTGGTTGGTTGGCCAGCTCCACAAGGTTCTCGTTCTTTGACTCCATGTACTTGTGGTTCTTCTGACTTGTACTTGGTTACTAGACACGCTGACGTTATCCCAGTTAGAAGAAGAGGTGACTCTCGTGGTTCTTTGTTGTCTCCAAGACCAATCTCTTACTTGAAGGGTTCTTCTGGTGGTCCATTGTTGTGTCCAGCTGGTCACGCTGTTGGTTTGTTCAGAGCTGCTGTTTGTACTAGAGGTGTTGCTAAGGCTGTTGACTTCATCCCAGTTGAAAACTTGGAAACTACTATGAGAGCTTCTGGTTCTTCTGGTTCTTCTGAATTT
Cleavage site for HCV protease
This part contains the protein coding region for the cleavage site of the HCV NS3-4A protease (BBa_K1680011). The part is supplied in RFC25. This part was intended as a backup for our project, due to time restraints we did not use it.
GATGAAATGGAAGAGTGCAGTCAACATTATCCTTAT
NDegron
This part contains the protein coding region for an NDegron as described by Taxis et al. 2009. The NDegron enhances protein turnover by destabilising the protein it is fused to upon cleavage by TEV protease.
The part is supplied in RFC25. This part was intended as a backup for our project, due to time restraints we did not use it.
ATGGCCGGCCCCCCTAAGAAAAAGAGAAAAGTCAGCATTACAAGTTTGTACAAAAAAGCCGGTTCTGAGAATCTGTATTTCCAGTTCCACAAGAGCGGCGCTTGGAAGCTACCAGTTTCCCTGGTCAAGTTGGGTCTTGATAAGTTAGATTATAAGACCGGTTAA
The complex parts were assembled into the pTUM vector series (Team TU Munich 2012, e.g. BBa_K801000). Due to time constraints we were not able to clone these parts into the pSB backbone prior to part submission.
Additionally, we submitted the biobricked pRS vectors as well as the pETue vector.
Yeast shuttle vectors with Biobrick MCS
These parts are biobricked shuttle vectors for yeast. The vectors were made compatible with the RFC10 standard and also contain an RFC10 cloning site. They all encode an ampicillin resistance gene and replicate to high-copy numbers in E.Coli. Furthermore, the CEN6/ARS4 (Chromosome VI centromere/Autonomously Replicating Sequence 4) cassette ensures that the plasmid stays at a low copy number in yeast, because they are treated as pseudo chromosomes. Each vector contains a different auxotrophy marker:
- pRS313 - HIS3
- pRS315 - LEU2
- pRS316 - URA3
pETue
This part is a E. coli expression plasmid that is compatible with RFC10. The vector can be linearized with PstI/XmaI, so that parts cut with PstI/NgoMIV can be cloned into it. Overexpression of genes cloned into this site is IPTG inducible. It also encodes for a 6xHis-tag with a Thrombin cleavage site between coding region and 6xHis-tag, so that the His-tag can easily be cleaved off. The vector replicates with a high copy number in E. coli, and has an ampicillin resistance.
Cre-Dronpa Fusions
These parts contain the protein coding region for the fusion constructs of Cre Recombinase (BBa_K1680007) and 145N Dronpa (BBa_K1680006) with intermediate linkers (BBa_K1680000 - BBa_K1680003). Oligomerisation of Dronpa should stop Cre from accessing DNA in the nucleus thereby inhibiting it until light deactivation of Dronpa.
These parts are
Dronpa caged Cre with NLS
These parts contains the protein coding region for a fusion protein of Cre recombinase (BBa_K1680007) that is C- & N-terminal flanked with 145N Dronpa (BBa_K1680006) using a 6/9/12/15 AA linker as spacer (BBa_K1680000 - BBa_K16800003). The construct has an N-terminal NLS sequence (BBa_K1680004). In the expressed construct the two Dronpa domains should form multimers leading to an inactive Cre recombinase that is reversibly activatable through Dronpa illumination (see Zhou et al 2012).
RFP-Luciferase Cre reporter
This part encodes a reporter cassette for the Cre Recombinase (e.g. BBa_K1680007) in Yeast. An active Cre protein will switch expression from RFP to NanoLuc luciferase. It is composed of pADH-loxp-RFP-tADH-loxp-Nluc.
