Difference between revisions of "Template:Team:Groningen/CONTENT/LOGBOOK/Colony PCR th18"
(Created page with "{{Team:Groningen/TEMPLATES/EXPERIMENT |title=Colony PCR thrC locus 2 (th18) |protocol=Colony PCR |protocolurl=ColonyPCR |goal=extra integration of DNA in thrC locus |desc...") |
|||
| Line 3: | Line 3: | ||
|protocol=Colony PCR | |protocol=Colony PCR | ||
|protocolurl=ColonyPCR | |protocolurl=ColonyPCR | ||
| − | |goal= | + | |goal=Extra integration of DNA in thrC locus |
|description=Colony PCR on transformed cells with thrC locus in thrC plasmid A | |description=Colony PCR on transformed cells with thrC locus in thrC plasmid A | ||
|conclusion=A positive colony | |conclusion=A positive colony | ||
}} | }} | ||
Latest revision as of 23:15, 21 November 2015
Colony PCR thrC locus 2 (th18)
Colony PCR on transformed cells with thrC locus in thrC plasmid A
Extra integration of DNA in thrC locus
A positive colony
<a class="postscriptum protocol" href="https://2015.igem.org/Team:Groningen/Protocols_and_Protocols/ColonyPCR">Colony PCR</a>
00:00, 4 September 2015 - 00:00, 4 September 2015
Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.
Primer
Sequence
IGEM thrC forward
AATTCATGTAAAAGATGAGGTTGGTTCATT
iGEM erm-thrC rev 2
AGGAAGTTAAAGGAGCTCGAATTAATTCC
Used primers.
The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.