August 8th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC-5’

- tail homology PHO85
- Primer Kanamycin

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
GCATTC-5’

- tail homology PHO80
- Primer Kanamycin

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- FRT
- Primer Kanamycin

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:

August 13rd

PCR purification

Protocol :

Dilute PCR product (5 or 10 times ?) with the resuspension buffer

Pour it in a purification column

Centrifuge 30sec at 14K rpm

Throw the filtrat

Add 700µL of EtOH (washing solution)

Centrifuge 30sec at 14K rpm

Throw the filtrat

Add 500µLof washing solution

Centrifuge 30sec at 14K rpm

Throw the filtrat

Centrifuge 30sec at 14K rpm

Throw the filtrat

Put the column in a Eppendorf

Add 45µL of RNAse/DNAse free water right on the membrane

Wait 2min

Centrifuge 2min at 10K rpm

PCR control with an electrophoresis

Pre-culture

Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.

August 14th

Transformation of yeast

Protocol :

• After growth, determine the titer of the yeast culture by using spectrophotometer : pipette 10µL of cells into 1mL of wtaer in spectrophotometer cuvette and measure the OD at 600nm.
  
• Add 2.5x10⁸ cells to 50mL of 2X YPD in a culture flask.
  
• Incubate the flask in a shaking incubator at 30°C until the cell culture is at least 2x10⁷ cells.mL^-1
  
• Denature 1mL of carrier DNA at 99°C for 5min and chill immediately in ice.
  
• Harvest the yeast cells by centrifugation at 3,000g for 5min.
  
• Resuspend the pellet in 25mL of sterile water and centrifuge at 3,000g for 5min at 20°C. Repeat this wash with sterile water 2 times.
  
• Resuspend the last pellet in 1mL of sterile water.
  
• Transfer the cell suspension to a 1.5mL microcentrifuge tube.
  
• Centrifuge for 30s at 13,000g and discard the supernatant.
  
• Resuspend the cells in 1mL of sterile water and pipette 100µL samples into 1.5mL microcentrifuge tubes, one for each transformation.
  
• For each transformation :
  
• 240µL of PEG 3350 (50% (w/v))
  
• 36µL of LiAc 1.0M
  
• 50µL of single-stranded carrier DNA (2.0mg.mL^-1)
  
• 6µL of PCR product
  
• 28µL of water DNAse Free
  
• Place the tubes at 42°C for 40min.
  
• Centrifuge the tubes at 13,000g for 30s in a microcentrifuge tube and remove the supernatant.
  
• Pipette 1mL of YPD liquid medium into the transformation tube, and vortex mix to resuspend pellet.
  
• Incubate 3h at 30°C to ensure good antibiotic expression.
  
• Plate 2, 20 and 200µL of the cell suspension onto YPD medium with 200µm.mL^-1 antibiotic G418.
  
• Incubate the plates at 30°C for 3 days.
  

August 17th

Result of plates:

There is a culture in plates.

Verification of the results

Thanks to the colony PCR, to determinate if the resistance is integrated.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG

August 18th

Verification of the new negativ control

Problem of FRT

The transformation with the FRT has run well, but the flipase we have is integration of the E.coli plasmide. We can't use this plasmid, it will be rejected by yeast.
Other transformtion with Cre lox is possible.
Cre lox: is a gene which has the same fonction FRT, it not cup thanks to the flipase but thanks to the Cre recombinase.

We creates two primer for the new transformation with Cre lox.

Primer 5'-3' Cre lox + PHO 85

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

Primer 3'-5' Cre lox + PHO 85

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- FRT
- Primer Kanamycin