Difference between revisions of "Team:CHINA CD UESTC/Method"

Line 57: Line 57:
 
     font-weight: 500;
 
     font-weight: 500;
 
     font-family: inherit;
 
     font-family: inherit;
−
}
 
−
.array_foto {
 
−
margin: 20px 0 50px 0;
 
 
}
 
}
 
</style>
 
</style>
Line 85: Line 82:
 
<div class="slide" id="slide2" data-slide="2" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;">
 
<div class="slide" id="slide2" data-slide="2" data-stellar-background-ratio="0.5" style="background-position: 0px 669px;">
 
<div class="container clearfix">
 
<div class="container clearfix">
−
<!--
+
<div id="content">
−
<div id="content" class="grid_12">
+
<div class="grid_8">
−
<h2>Laccase + mamW + RFP</h2>
+
−
</div>
+
−
<div class="clear"></div>
+
−
-->
+
−
<div id="content">
+
−
<div class="grid_8">
+
−
<p>
+
−
If you want to check or follow our project, you can read the METHOD page to get main information concerning our project. In addition, you will get more details about experiment from our protocols.
+
−
</p>
+
−
<div class="array_foto">
+
−
<div class="client_foto">
+
−
<img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%"></div>
+
−
<h3>Q1: How to get target gene?</h3>
+
 
<p>
 
<p>
−
Four gene clusters related to magnetosome synthesis(mamAB/mamGFDC/mamYXZ/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify.
+
If you want to check or follow our project, you can read the METHOD page to get main information concerning our project. In addition, you will get more details about experiment from our protocols.
−
</p>
+
<br>
 +
<br></p>
 +
<div class="array_foto">
 +
<div class="client_foto">
 +
<img src="https://static.igem.org/mediawiki/2015/f/f7/CHINA_CD_UESTC_METHOD01.png" width="60%"></div>
 +
<h3>Q1: How to get target gene?</h3>
 +
<p>
 +
Four gene clusters related to magnetosome synthesis(mamAB/mamGFDC/mamYXZ/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify.
 +
</p>
 +
<p>
 +
Laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: BBa_K863005, BBa_E1010) and amplify them through common PCR.
 +
</p>
 +
</div>
 +
<br>
 +
<br>
 +
<h3>Q2: Where are the backbone vectors from?</h3>
 
<p>
 
<p>
−
Laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: BBa_K863005, BBa_E1010) and amplify them through common PCR.
+
All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aim to carry gene clusters that realize magnetosome generating and the last one is for putting together the genes of laccase + mamW + RFP.
 
</p>
 
</p>
−
</div>
 
−
<h3>Q2: Where are the backbone vectors from?</h3>
 
−
<p>
 
−
All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aim to carry gene clusters that realize magnetosome generating and the last one is for putting together the genes of laccase + mamW + RFP.
 
−
</p>
 
  
−
<div class="project_pic">
+
<div class="project_pic">
−
<p id="pic_title"></p>
+
<p id="pic_title"></p>
−
<img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%">
+
<img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%">
−
<p id="pic_illustration"></p>
+
<p id="pic_illustration"></p>
−
</div>
+
</div>
−
<div class="project_pic">
+
<div class="project_pic">
−
<p id="pic_title"></p>
+
<p id="pic_title"></p>
−
<img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%">
+
<img src="https://static.igem.org/mediawiki/2015/a/a8/CHINA_CD_UESTC_METHOD03.png" width="60%">
−
<p id="pic_illustration"></p>
+
<p id="pic_illustration"></p>
−
</div>
+
</div>
−
<div class="project_pic">
+
<div class="project_pic">
−
<p id="pic_title"></p>
+
<p id="pic_title"></p>
−
<img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%">
+
<img src="https://static.igem.org/mediawiki/2015/6/6c/CHINA_CD_UESTC_METHOD04.png" width="60%">
−
<p id="pic_illustration"></p>
+
<p id="pic_illustration"></p>
−
</div>
+
</div>
−
<div class="project_pic">
+
<div class="project_pic">
−
<p id="pic_title"></p>
+
<p id="pic_title"></p>
−
<img src="https://static.igem.org/mediawiki/2015/0/0e/CHINA_CD_UESTC_METHOD05.png" width="60%">
+
<img src="https://static.igem.org/mediawiki/2015/0/0e/CHINA_CD_UESTC_METHOD05.png" width="60%">
−
<p id="pic_illustration"></p>
+
<p id="pic_illustration"></p>
−
</div>
+
</div>
  
−
<h3>
+
<h3>
−
Q3: What kinds of linker we chose for linking between our protein domains?
+
Q3: What kinds of linker we chose for linking between our protein domains?
−
</h3>
+
</h3>
−
<p>
+
<p>
−
We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers.
+
We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers.
 +
</p>
 
<p>
 
<p>
 
•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
 
•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
Line 157: Line 152:
 
Q4: What kinds of enzymes we used when we made target gene insert into vectors?
 
Q4: What kinds of enzymes we used when we made target gene insert into vectors?
 
</h3>
 
</h3>
−
<p>
+
<div class="array_foto">
−
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="40%" height="30%">
+
<div class="client_foto">
−
•pET28a: For consideration of the gene cluster size (17kb), we divided mamAB operon into three parts, we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to come true the insertion of mamAB.
+
−
</p>
+
−
<p>
+
−
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="40%" height="30%">
+
−
•pCDFDuet-1: The restriction enzyme cut sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamYXZ on either side are (XbaⅠ)and (PstⅠ)
+
−
</p>
+
−
<p>
+
−
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="40%" height="30%">
+
−
•pACYCDuet-1: The restriction enzyme cut sites flanking Laccase + mamW + RFP on either side are  (PstⅠ) and (XhoⅠ).
+
−
</p>
+
  
 +
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="40%" height="30%">
 +
<p>
 +
•pET28a: For consideration of the gene cluster size (17kb), we divided mamAB operon into three parts, we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to come true the insertion of mamAB.
 +
</p>
 +
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="40%" height="30%">
 +
<p>
 +
•pCDFDuet-1: The restriction enzyme cut sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamYXZ on either side are (XbaⅠ)and (PstⅠ)
 +
</p>
 +
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="40%" height="30%">
 +
<p>
 +
•pACYCDuet-1: The restriction enzyme cut sites flanking Laccase + mamW + RFP on either side are  (PstⅠ) and (XhoⅠ).
 +
</p>
 +
 +
</div>
 +
</div>
 
</div>
 
</div>
 
</div>
 
</div>
−
 
+
</div></div></div>
 
</body>
 
</body>
  
−
</html>
+
</html>

Revision as of 16:58, 8 September 2015

<!DOCTYPE html>

METHOD

  We are a skillful and persistent group of nine Finns. We started as a group of students who didn't really know each other, assuming that we were going to spend our summer studying synthetic biology with strange colleagues. In the end we got a bunch of new friends and (in addition to studying synthetic biology) we just might have spent one of the best summers of our lives.

If you want to check or follow our project, you can read the METHOD page to get main information concerning our project. In addition, you will get more details about experiment from our protocols.

Q1: How to get target gene?

Four gene clusters related to magnetosome synthesis(mamAB/mamGFDC/mamYXZ/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify.

Laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: BBa_K863005, BBa_E1010) and amplify them through common PCR.



Q2: Where are the backbone vectors from?

All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aim to carry gene clusters that realize magnetosome generating and the last one is for putting together the genes of laccase + mamW + RFP.

Q3: What kinds of linker we chose for linking between our protein domains?

We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers.

•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: BBa_K416001): between mamW, RFP and Laccase.

•gcaggtagcggcagcggtagcggtagcggcagcgcg
Refer to 6aa [GS]x linker(Name: BBa_J18921): between mamW and RFP.

Q4: What kinds of enzymes we used when we made target gene insert into vectors?

•pET28a: For consideration of the gene cluster size (17kb), we divided mamAB operon into three parts, we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to come true the insertion of mamAB.

•pCDFDuet-1: The restriction enzyme cut sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamYXZ on either side are (XbaⅠ)and (PstⅠ)

•pACYCDuet-1: The restriction enzyme cut sites flanking Laccase + mamW + RFP on either side are (PstⅠ) and (XhoⅠ).