Material

1. E.coli(DH5α、CmR J22102)
2. Tube
3. LB broth
4. Inoculating loop
5. Alcohol Burner

Procedure

Step1:Draw 10mL LB broth with 5mL pipet into a tube (total4).

Step2: Scrape a colony with an inoculating loop sterilized by alcohol burner.

Step3: Add the colony into the tube (two for each strain).

Step4:Keep it in 37℃ incubator.

Material

1. LB agar
2. 0.85% saline
3. Tube
4. Dish

Procedure

1. Solid medium

   Step1:Get certain weight of LB broth (25g/L) and agar (1.5%)

   Step2: Add the powder into the serum bottle with a wash bottle.

   Step3: Add certain amount of ddH₂O into the serum bottle.

   Step4:Dissolve the solution with a spinbar.

   Step5:Sterilization for 1.5hr.

   Step6:Distribute to each dish (10mL/dish).

2. Buffer solution

   Step1: Get certain weight of saline (0.85%)

   Step2: Add the powder into the serum bottle with a wash bottle.

   Step3: Add certain amount of ddH₂O into the serum bottle.

   Step4:Sterilization for 1.5hr.

   Step5:Distribute to each tube (9mL/tube).

Purpose

1. Make sure if the procedure from others’ reference fits our experiment.
2. Compare the different effect of using syringe and pipet.

Material

1. PVA(Polyvinyl alcohol)
2. SA(Alginate)
3. BA(Boric acid)
4. CaCl₂
5. Chitosan
6. Sodium citrate(Na₃C₆H₅O₇•2H₂O)
7. Beaker
8. Syringe
9. Pipet

Procedure

• PVA-SA

  Step1: Pour some solution into beakers.

  Step2: Draw certain amount of 8%PVA-1%SA and add it into 3%BA-1%CaCl₂.

• SA

  Step1: Pour some solution into beakers.

  Step2: Draw certain amount of 3%SA and add it into 1%CaCl₂.

• ACA

  Step1: Pour some solution into beakers.

  Step2: Draw certain amount of 1.5%SA and add it into 100mmol/LCaCl₂

  Step3: Throw the microcapsule into 0.3%Chitosan.

  Step4: Throw the microcapsule into 0.15%SA.

  Step5: Use syringe to inject sodium citrate in the microcapsule.

Result

1. Different method of entrapment

   PVA-SA	SA	ACA
   White, Teardrop-shaped	colorless (bluish), sphere	Bluish, sphere

2. Step5 of ACA is infeasible, so we decide to delete this step.

3. Comparison of syringe and pipet:

   syringe	pipet
   Consistent size, faster, without bubble	Vary in size, slow, with bubble

Purpose

Plate streaking is an important and essential technique in molecular biology. Streaking allows the selection of a single colony from an original mixture of colonies. It also allows for the selection of one single colony from an original plate to be grown up as many colonies on a new plate.

Material

1. E.coli(DH5α)
2. Solid medium(LB agar)
3. Inoculating loop
4. Alcohol Burner

Procedure

Step1: Sterilize the inoculating loop on an alcohol burner flame and allow it to cool for a few seconds.

Step2: Using the loop, streak the first section of the plate using tight sweeping lines that stay within that section.

Step3: Sterilize the loop and allow it to cool in the air for 15 seconds. Touch the loop to an unused edge of the agar surface to cool it completely before continuing.

Step4: Pull the loop through the previous streak one or two times to re-inoculate the loop with cells.

Step5: Streak section 2 of the plate, avoiding section 1 after the first 1-2 streaks and trying not to overlap the streaks.

Step6: Repeat Step3,4,5 for two more times.

Procedure

Today,we get the plasmid which be sent from the United States.

They are:

part1:promoter(J23113)-RBS(B0034)-Laccase(K1092104)-RBS(B0034)-

Part2:promoter(J23113)-QsrR binding site-RBS(B0034)-

We set them according to the following

Put in 37 degree Celsius for 2 hr and then do Gel electrophoresis.

Result

Procedure

We take QsrR(K1092000)-Terminator(B0015) and RFP(E1010)-Ter(B0015) to do gel extraction.

We extract the plasmid of B0015

Material

1. PVA(Polyvinyl alcohol)
2. SA(Alginate)
3. BA(Boric acid)
4. CaCl₂
5. Chitosan
6. Sodium citrate(Na₃C₆H₅O₇•2H₂O)
7. Electronic balance
8. Spatulas
9. Beaker
10. ddH₂O
11. Volumetric flask
12. Mixing rod
13. Hotplate
14. Serum bottle

Procedure

Step1: Get certain weight of chemicals with spatulas by an electronic balance.

Step2: Use a volumetric flask to prepare a certain concentration of solution.

Step3: Dissolve the solution with a stirring rod. (if not dissolving, use the hotplate until the solution becomes clear)

Result

Procedure

1. Add 223.3 μl and 291.1 μl water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes
2. Diluted the two primer 10-fold to a concentration of 10μM for use

3. 1μg of the plasmid (220ng/μl)	4.5(μl)
   ddH2O	5.5(μl)
   Total	10(μ)l
   Primer	2(μl)
   	12(μ)l

4. Send the DNA sequencing

Because we must test E.coli’s Survival in the environment there is benzo[a]pryene by counting the colonies,First we test how much concentration is the best.

1. culture (8/17)

   STEP1:take 1μL DH5α to spread the plate(no Antibiotic)

   STEP2:put in 37 degree Celsius 12~16hr

2. liquid culture(8/18)

3. (8/19)

   STEP1:put 80μL into 2ml LB broth

   STEP2:recovering

   STEP3:After 2hr take 200μL out to spread the plate (no Antibiotic)

   STEP4:After 4hr take 200μL out to spread the plate (no Antibiotic), 6hr and 8hr Similarly

   STEP5:put in 37 degree Celsius 12~16hr

RESULT:

We hope the number of colonies between 30~300,but the result is the colonies is too much!!

Procedure

Extract QsrR(K1092000)-Ter(B0015)

Procedure

We take QsrR(K1092000)- Terminator(B0015) to gel electrophoresis

We set them according to the following

RESULT:

Success!!

Procedure

Culture QsrR(K1092000)-Ter(B0015)

Procedure

Extract RFP(E1010)-Ter(B0015)

Procedure

Culture RFP(E1010)-Ter(B0015)

We successfully draw out the plasmid from E.coli.

Procedure

Extract QsrR(K1092000) plasmid

Procedure

Ligation and Transform RFP(E1010)-Terminator(B0015)

Procedure

Transform QsrR(K1092000)

We pick up the single column and incubate it.

Procedure

Culture RFP(E1010) and Terminator(B0015)

Procedure

Transform QsrR(K1092000)

Procedure

We take QsrR(K1092000) to gel electrophoresis

We set them according to the following

RESULT:

The picture is too blurry.

We think that it is because the concentration is too low.

So we must transform one more time.

We transform J22106 this time.

We get another RBS B0032 and transform it.

Procedure

1. Add 223.3 μl and 291.1 μl water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes
2. Diluted the two primer 10-fold to a concentration of 10μM for use

3. 1μg of the plasmid (220ng/μl)	4.5(μl)
   ddH2O	5.5(μl)
   Total	10(μ)l
   Primer	2(μl)
   	12(μ)l

4. Send the DNA sequencing

The transforming is failed.

Procedure

STEP1:test RFP’s andTerminator’s concentration

STEP2:regulate their concentration to 1000np/μL

STEP3:We set them according to the following

RESULT:

Nothing

The result is failed

Procedure

Extract QsrR(K1092000) plasmid

Procedure

Transform RFP(E1010) and Terminator(B0015)

Procedure

Culture QsrR(K1092000)

We get the part B0034 and transform it.

Procedure

Transform QsrR(K1092000)

Use the enzyme to check the part length correct or not one more time and determine that we success.

Use the enzyme to check the part length correct or not.

Extract RFP(E1010) and Terminator(B0015) plasmid

Procedure

culture RFP & Terminator(B0015)

the primer of second DNA sequencing

TACAGAGTTCTTGAAGTGGTGGCC

TTTAAAGAAAAAGGGCAGGGTGGT

We successfully draw out the plasmid.

Procedure

Transform RFP & Terminator(B0015)

We extract the plasmid of B0034 and J23119 and test their concentration

We fell to draw out the plasmid.

We transform J23119 this time.

We incubate our E.coli.

We purify the gel , ligate the part, and transform into the E.coli.

We use gel electrophoresis to cut our part. Than we purify our gel.

We draw out the plasmid from single column by plasmid mini kit.

And start to use restriction enzyme to cut the part E1010 and B0015.

We draw out the plasmid from single column by plasmid mini kit but failed.

We get the part B0015.

Draw out the plasmid from single column by plasmid mini kit.

We are going to do the combine the part in time but our plasmid disappeared.

Using gel electrophoresis again and check the part have problem.

We use gel electrophoresis to cut our part, and check the part length and determine that the part B0030 which we have has a mistake.

Draw out the plasmid from single column by plasmid mini kit{E0040,B0030,E1010,K896008}

We pick single column, and incubate in another tube.

We get “k89608” part and transform it.

Because transformation we did on 6/11 was fail, this week, we did transformation again.

In order to find the cause, we did two control group. One is J23102 the other is the kit provided. And we transform B0034 this time.

Material:

1. 70 % Ethanol
2. Isopropanol
3. 50 ml centrifuge tubes
4. Plasmid DNA Midi Kit
5. pSB1C3-BBa_B0030 in DH5α
6. pSB1C3-BBa_E1010 in DH5α
7. pSB1A2-BBa_E0040 in DH5α
8. pSB1A2-BBa_B0010 in DH5α

Notes:

1. Add RNase A to PL1 Buffer and store at 4℃
2. Warm PL2 Buffer in a 37℃ waterbath
3. Use 100~150 ml of bacterial culture for Midi Kit

Protocol:

1. Flick a PM Column 2~3 times, then place the PM Column on a conical flask.
2. Equilibrate the PM Column by applying 5 ml of PL4 Buffer by gravity flow
3. Harvest the bacterial culture 100 ml by centrifuge at 6000 x g for 10 mins
4. Add 5 ml of PL1 Buffer to resuspend the cell pellet by vortexing or pipetting
5. Add 5 ml of PL2 Buffer and mix gently by inverting the tube 10 times. DO NOT VORTEX!!!
6. Place for 10 mins at room temperature until lysate clears
7. Add 5 ml of PL3 Buffer and mix immediately by inverting the tube 10 times. DO NOT VORTEX!!!
8. Centrifuge at 15000g for 20 minutes or filtered with a filter paper
9. Apply the supernatant from step 8. to the equilibrated PM Column and allow it to flow by gravity flow.
10. Wash the PM Column by using PL5 Buffer 15 ml and allow the column empty by gravity flow.
11. Discard the filtrate.
12. Place PM Column in a clean centrifuge and apply 10 ml of PL6 Buffer to elute DNA by gravity flow
13. Using eluates from step 12. Add 7.5 ml of room temperature isopropanol. Vortex well and let the mixture sit for 2 minutes.
14. Centrifuge at 12500 x g for 30 minutes.
15. Remove the supernatant, then add 3 ml of 70% ethanol to wash.
16. Centrifuge at 12500 x g for 5 minutes, then dry ethanol at room temperature.
17. Apply 0.2 ml of TE Buffer to resuspend DNA.

We get “B0030, E0040, E1010”part,and transform them.

Procedure

1. total:400 μL
2. material:
   • 13nm Au-NPs 1.5mM,Pb 1mM100μM10μM
   • Cd 1mM100μM10μM,H7 Tris-Borate buffer 100mM,
   • AR 100μM,H₂O₂1mM

3. Caclulate:

   Pb2+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	220μL	20μL	40μL	0μL	40μL	40μL
   100μM	40μL	180μL	20μL	40μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	180μL	20μL	40μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	180μL	20μL	40μL	40μL(10μM→1μM)	40μL	40μL

   Cd2+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	220μL	20μL	40μL	0μL	40μL	40μL
   100μM	40μL	180μL	20μL	40μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	180μL	20μL	40μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	180μL	20μL	40μL	40μL(10μM→1μM)	40μL	40μL

   Pb2+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	260μL	20μL	0μL	0μL	40μL	40μL
   100μM	40μL	220μL	20μL	0μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	220μL	20μL	0μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	220μL	20μL	0μL	40μL(10μM→1μM)	40μL	40μL

   Cd2+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	260μL	20μL	0μL	0μL	40μL	40μL
   100μM	40μL	220μL	20μL	0μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	220μL	20μL	0μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	220μL	20μL	0μL	40μL(10μM→1μM)	40μL	40μL

4. Result:

   We put all the result into fluorescent reader.

   

   This one is stand for Pb⁺.

   

   This one is stand for Cd²⁺.

We do the ligation, and then transform the plasmid into E.coli

Mixing with LB broth, we smear the solid on the plate.

This is our first time do the experience.

We are going to use the restriction enzyme to cut the sample part {E GFP} and add a part by ligation.

So first, we use enzyme to cut the plasmid, and use gel electrophoresis to cut our part.

Than we purify our gel.

Material:

1. E.coli DH5α (ps: E.coli should be kept on the ice at all time)
2. Plasmid : pSB1A2-BBa_E0040(Ampicillin-resistant) GFP
3. Plasmid : pSB1C3-BBa_B0010(Chloramphenicol-resistant) Terminator
4. Plasmid : pSB1C3-BBa_B0030(Chloramphenicol-resistant) RBS
5. Plasmid : pSB1C3-BBa_E1010(Chloramphenicol-resistant) RFP
6. LB broth (10 g /L Tryptone, 5 g/L Yeast extract, 5 g/L NaCl )
7. LB plate(LB broth + 1% agar)
8. Antibiotics : Ampicillin & Chloramphenicol (100μg/mL for each)

Protocol:

1. Add 0.5μL of plasmid into 100μL of E.coli and mix by tapping the tube.(ps: the quantity of plasmid is dependent on bacterial competency)
2. Put the tube on the ice for 20~30mins.
3. Remove from the ice and put the tube to the 42℃ hot bath for 45 sec.
4. After heat shock, put the tube into the ice IMMEDIATELY for 2 mins.
5. Add 500 μL of LB broth into the tube and incubate for 30~60 mins at 37℃
6. Take out the tube and put into 6000 rpm centrifuge for 5 mins.
7. Remove supertant and remain about 100μL of LB to resuspend
8. Spread onto LB plate containing the appropriate antibiotic
9. Incubate overnight for 12~16 hrs at 37℃.

This week, we did transformation.

We transform B0034, B0015, I765001, I732005.

Procedure

1. total:400 μL
2. material:
   • 13nm Au-NPs 15mM,Cu 1mM100μM10μM
   • Hg 1mM100μM10μM,pH7 Tris-Borate buffer 100mM
   • AR 100μM,H₂O₂ 1mM
3. Caclulate:

   Cu2+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	220μL	20μL	40μL	0μL	40μL	40μL
   100μM	40μL	180μL	20μL	40μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	180μL	20μL	40μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	180μL	20μL	40μL	40μL(10μM→1μM)	40μL	40μL

   Hg+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	220μL	20μL	40μL	0μL	40μL	40μL
   100μM	40μL	180μL	20μL	40μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	180μL	20μL	40μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	180μL	20μL	40μL	40μL(10μM→1μM)	40μL	40μL

   Cu2+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	260μL	20μL	0μL	0μL	40μL	40μL
   100μM	40μL	220μL	20μL	0μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	220μL	20μL	0μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	220μL	20μL	0μL	40μL(10μM→1μM)	40μL	40μL

   Hg+	buffer	DI water	Au-NPs	Ag+	Mn+	AR	H2O2
   target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
   Control	40μL	260μL	20μL	0μL	0μL	40μL	40μL
   100μM	40μL	220μL	20μL	0μL	40μL(1mM→100μM)	40μL	40μL
   10μM	40μL	220μL	20μL	0μL	40μL(100μM→10μM)	40μL	40μL
   1μM	40μL	220μL	20μL	0μL	40μL(10μM→1μM)	40μL	40μL

4. Result:

   We put all the result into fluorescent reader.

   

   The horizontal axis:1 means control, 2 means 100μM, 3 means 10μM, 4 means 1μM.And series1 represent no Ag⁺ adsorb on Au-NPs,series2 stand for the experiment with Ag⁺ adsorb on Au-NPs which had time mistake(there are one hour shock between adding Mⁿ⁺ and AR), and the third series is the correct one with Ag⁺ adsorb on Au-NPs.

Procedure

1. total:500 μL
2. material:
   • 3nm Au-NPs 1.5mM,Cu 10mM1mM100μM10μM
   • Cd 10mM1mM100μM10μM,Hg 10mM1mM100μM10μM
   • Zn10mM1mM100μM10μM,pH7 Pb buffer 100mM

3. Caclulate:

   Cu	buffer	DI water	Au-NPs	Mn+
   target	100mM→10mM		1.5mM→3μM	0.1x
   Control	50μL	350μL	100μL	0
   1mM	50μL	300μL	100μL	50μL(10mM→1mM)
   100μM	50μL	300μL	100μL	50μL(1mM→100μM)
   10μM	50μL	300μL	100μL	50μL(100μM→10μM)
   1μM	50μL	300μL	100μL	50μL(10μM→1μM)

   Cd	buffer	DI water	Au-NPs	Mn+
   target	100mM→10mM		1.5mM→3μM	0.1x
   Control	50μL	350μL	100μL	0
   1mM	50μL	300μL	100μL	50μL(10mM→1mM)
   100μM	50μL	300μL	100μL	50μL(1mM→100μM)
   10μM	50μL	300μL	100μL	50μL(100μM→10μM)
   1μM	50μL	300μL	100μL	50μL(10μM→1μM)

   Hg	buffer	DI water	Au-NPs	Mn+
   target	100mM→10mM		1.5mM→3μM	0.1x
   Control	50μL	350μL	100μL	0
   1mM	50μL	300μL	100μL	50μL(10mM→1mM)
   100μM	50μL	300μL	100μL	50μL(1mM→100μM)
   10μM	50μL	300μL	100μL	50μL(100μM→10μM)
   1μM	50μL	300μL	100μL	50μL(10μM→1μM)

   Zn	buffer	DI water	Au-NPs	Mn+
   target	100mM→10mM		1.5mM→3μM	0.1x
   Control	50μL	350μL	100μL	0
   1mM	50μL	300μL	100μL	50μL(10mM→1mM)
   100μM	50μL	300μL	100μL	50μL(1mM→100μM)
   10μM	50μL	300μL	100μL	50μL(100μM→10μM)
   1μM	50μL	300μL	100μL	50μL(10μM→1μM)

4. Result:

   

   H1~H4 Hg1mM~1μM

   H4~H8 Cd1mM~1μM

   

   G1~G4 Cu1mM~1μM

   G5~G8 Zn1mM~1μM

   

Materials

• Resuspended DNA (B0015, E0240, E0840, E0420, E0430, I13001, J23119, B1006)
• Competent cells (20μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic
• Spreader
• 37℃ incubator
• SOC Media (180μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 20 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 180 μL of SOC Media(without antibiotic) and then incubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 100 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(chloramphenicol). Plate 100 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. Store the plate in 4 ℃.

Materials

• Resuspended DNA (Resuspend well in 10μl dH₂0, pipette up and down several times, let sit for a few minutes)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube (1 per transformation)
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic (1 per transformation)
• Spreader (2 per transformation)
• 37℃ incubator
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 150 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. After picking colonies, store the plate in 4 ℃.

Materials

• Resuspended DNA (Resuspend well in 10μl ddH₂0, pipette up and down several times, let sit for a few minutes)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube (1 per transformation)
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic (1 per transformation)
• Spreader (1 per transformation)
• 37℃ incubator
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up, and then store the plate in 4 ℃.

Material

1. randon primer 1㎕
2. 2MUG RNA F10 1.95㎕
3. 2MUG RNA m1 1.95㎕
4. 10mM dNTP 1㎕
5. ddH₂O
6. 5× FSB 4㎕
7. 0.1M DTT 2㎕
8. RNase out 1㎕
9. M-MLV RT 1㎕
10. eppendorf

Procedure

A 20-㎕ reaction volume can be used for 1 ng-5μg of total RNA or 1-500 ng of mRNA.

1. Add the following components to a nuclease-free microcentrifuge tube:
   • 1㎕ oligo(dT)_12-18(500μg/ml), or 50-250 ng random primers, or 2pmole gene -specific primer
   • 1 ng to 5μG total RNA or 1 ng to 500ng of mRNA
   • 1㎕ 10 mM dNTP Mix(10 mM each dATP,dGTP,dCTP and dTTP at neutral pH)
   • Sterile, distilled water to 12㎕
2. Heat mixture to 65℃ for 5 min an quick chill on ice. Collect the contents of the tube by brief centrifugation and add:
   • 4㎕ 5X First-Strand Buffer
   • 2㎕ 0.1 M DTT
   • 1㎕ RNaseOUT^TM Recombinant Ribonuclease Inhibitor (40 units/㎕)

   (Note: When using less than 50 ng of starting RNA, the addition of RNaseOUTTM is essential.)

3. Mix contents of the tube gently and incubate at 37℃ for 2 min.
4. Add 1㎕(200 units) of M-MLV RT,a and mix by pipetting gently up and down. If using random primers, incubate tube at 25℃ for 10 min.
5. Incubate 50 min at 37℃.
6. Inactivate the reaction by heating at 70℃ for 15 min.

Result

Materials

• Resuspended DNA (J04450)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic
• Spreader
• 37℃ incubator
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 2 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 2 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 100 μl and 100 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. After picking colonies, store the plate in 4 ℃.

Material:

1. Resuspension Buffer S1
2. Lysis Buffer S2
3. Neutralization Buffer S3
4. Equilibration Buffer N2
5. Wash Buffer N3

6. Elution Buffer N5

   
7. Overnight bacteria
8. Room-temperature isopropanol
9. 1% agarose
10. TE buffer (using at Gel electrophoresis)

Protocol:(Plasmid Purification)

1. Harvest bacteria from an LB culture by centrifugation at 6000 rpm for 10 mins at 4℃

   

2. Resuspend the pellet of bacterial cells in Buffer S1.

   
3. Add Buffer S2 the suspension .Mix by inverting the tube for 6~8 times. Incubate the mixture at 18~25℃ for 2~3 mins.
4. Add Buffer S3 (pre-cooled at 4℃ ) to the suspension. Immediately mix the lysate by inverting the flask 6~8 times.
5. Equilibrate a Column with Buffer N2

6. Place the folded filter in a funnel of appropriate size. Wet the filter with a few drop of Buffer N2 and load the bacterial lysate onto the wet filter.

   
7. Load the cleared lysate from 6 onto the column. Allow the column to empty by gravity flow.
8. Wash the column with Buffer N3.
9. Elute the plasmid DNA with Buffer N5.
10. Add room-temperature isopropanol to precipitate the eluted plasmid DNA. Mix carefully and centrifuge at 12000 g for 30 mins at 4℃. Carefully discard the supertant.
11. Add room-temperature 70% ethanol to the pellet. Vortex briefly and centrifuge at 12000 g for 10 min at 18~25℃.
12. Carefully remove ethantol from the tube with a pipette tip. Allow the pellet to dry at 18~25℃ no iess than the indicated time.

Procedure

Transform T7promoter-RBS-QsrR BBa_K1092001

Preparing Samples

Homogenizing samples

• Determine your sample type, and perform homogenization at room temperature according to the table below. The sample volume should not exceed 10% of the volume of TRIzol Reagent used for homogenization. Be sure to use the indicated amount of TRIzol Reagent, because an insufficient volume can result in DNA contamination of isolated RNA.

RNA Isolation Procedurec

Always use the appropriate precautions to avoid RNase contamination when preparing and handling RNA.

RNA precipitation

1. (Optional) When precipitating RNA from small sample quantities (<10⁶ cells or < 10 mg tissue), add 5-10μg of RNase-free glycogen as a carrier to the aqueous phase.
   • Note: Glycogen is co-precipitated with the RNA,but does not inhibit first-strand synthesis at concentrations ≤4mg/mL,and does not inhibit PCR.
2. Add 0.5mL of 100% isopropanol to the aqueous phase, per 1mL of TRIzol Reagent used for homogenization.
3. Incubate at room temperature for 10 minutes.
4. Centrifuge at 12,000 × g for 10 minutes at 4℃.
   • Note: The RNA is often invisible prior to centrifugation, and forms a gel-like pellet on the side and bottom of the tube.
5. Proceed to RNA wash.

Proceed to RNA wash.

1. Remove the supernatant from the tube,leaving only the RNA pellet.
2. Wash the pellet,with 1mL of 75% ethanol per 1mL of TRIzol Reagent used in the initial homogenization.
   • Note: The RNA can be stored in 75% ethanol at least 1 year at-20℃, or at least 1 week at 4℃.
3. Vortex the sample briefly,then centrifuge the tube at 7500 × g for 5 minutes at 4℃.Discard the wash.
4. Vacuum or air dry the RNA pellet for 5-10 minutes. Do not dry the pellet by vacuum centrifuge.
   Note: Do not allow the RNA to dry completely,because the pellet can lose solubility.Partially dissolved RNA samples have an A_260/280 ratio<1.6.
5. Proceed to RNA resuspension.

RNA resuspension

1. Resuspend the RNA pellet in RNase-free water or 0.5% SDS solution(20-50㎕) by passing the solution up and down several times through a pipette tip.
   • Note: Do not dissolve the RNA in 0.5% SDS if it is to be used in subsequent enzymatic reactions.
2. Incubate in a water bath or heat block set at 55-60℃ for 10-15 minutes.
3. Proceed to downstream application, or store at -70℃.

Material:

1. E.coli DH5α (ps: E.coli should be kept on the ice at all time)
2. Plasmid pBR322(Ampicillin-resistant)
3. LB broth (10 g /L Tryptone, 5 g/L Yeast extract, 5 g/L NaCl )
4. LB plate(LB broth + 1% agar)
5. Antibiotics : Ampicillin(100μg/mL)

Protocol:

1. Add 5μL of DNA into 100μL of E.coli and mix by tapping the tube. (ps: the quantity of DNA is dependent on bacterial competency)

2. Put the tube on the ice for 20~30mins.

   

3. Remove from the ice and put the tube to the 42℃ hot bath for 45 sec.

   

4. After heat shock, put the tube into the ice IMMEDIATELY for 2 mins.

   
5. Add 500 μL of LB broth into the tube and incubate for 30~60 mins at 37℃
6. Take out the tube and put into 6000 rpm centrifuge for 5 mins
7. Remove supertant and remain about 100μL of LB to resuspend
8. Spread onto LB plate containing the appropriate antibiotic

9. Incubate overnight for 12~16 hrs at 37℃ and you will see so many colonies on the LB plate!!!(A colony is a white dot on the picture below)

   

Procedure

1. Harvesting

Transfer 1.5ml of cultured bacterial cells to a 1.5ml microcentrifuge tube. Centrifuge at 13000 x g for 1 minute at room temperature.

2. Resuspension

Add 200μl of PD1 Buffer to a new 1.5ml microcentrifuge tube. Add 2μl of TrueBlue Lysis Buffer to the same 1.5ml microcentrifuge tube then mix by shaking gently.

3. Cell Lysis

Add 200μl of PD2 to the resuspended sample then mix genlly by inverting the tube 10 times. Let stand at room temperature for at least 2 minutes to ensure the lysate is homogeneous. Do not exceed 5 minutes.

4. Neutralization

Add 300 μl of PD3 Buffer then mix immediately by inverting the tube 10 times. Centrifuge at 13000 x g for 3 minutes at room temperature.

5. DNA Binding

Transfer all of the supernatant to thePDH Columg. Centrifuge at 13000 x g for 30 seconds at room temperature then discard th flow-through. Place the PDH Column back in the 2 ml Collection Tube.

6. Wash

For Improved Downstream Sequencing Reactions

Add 400 μl of W1 Buffer into the PDH Column. Centrifuge at 13000 x g for 30 seconds. Discard the flow-through then place the PDH Column back in the 2 ml Collection Tube. Proceed with Wash Buffer addition.

For Standard Plasmid DNA Purification

Add 600 μl of Wash Buffer into the PDH column. Centrifuge at 13000 x g for 30 seconds at room temperature. Discard the flow through then place the PDH Column back in the 2 ml Collection Tube. Centrifuge at 13000 x g for 3 minutes at room temperature to dry the column matrix.

1. PCR mixer

10X PCR Buffer,-Mg	to 100μl
50mM MgCl2	10μl
10mM dNTP Mix	3μl
Taq DNA Polymerase(5U/μl)	0.4μl
10μM forward primer	5μl
10μM reverse primer	5μl

∗Mix briefly centrifuge the components.

2. Put the mix into each of ten tubes. Eight of them are colonies, and the others are positive and negative control.
3. Put all tubes into the PCR machine and set up like below:

4. Step		Temperature(℃)	Time
   Initial Denaturation		95	5min
   30 PCR Cycles	Denature	94	15sec
   	Anneal	55	15sec
   	Extend	72	30sec
   Final Extension		72	7min			25	indefinitely

5. When it finished, we run gel.

Material needed

1. 70 % ethanol
2. Bba_J23102 (2λ)
3. Dn5α (20λ)
4. soc (200λ)
5. Peni 50 mg/ml
6. chrlo 34mg/ml
7. ministart
8. dish x10
9. pipetman,tip
10. eppendorf

1. Add 2λ plasmid and 20λ E-coli into PCR tube in the ice bucket.
2. Place the tubes on ice for 30min
3. Heatshock 42℃ for 45secs
4. After Heatshock, put into the ice bucket for 30 min.
5. Add soc 200λ to repair the cell wall Culture in the 37℃ incubator for 1.5 hr

Finish smear dish in hood.

Result

Procedure

Step1：Spread some culture media on the petri dish and heated in 37℃ for 20min in the oven.

STEP2：Take the plastid and bacterium out of the refrigerator(-80℃) and heated in 37℃ for 3min in the oven.

STEP3：Take the plastid and bacterium out and put it into the centrifuge.

STEP4：Use a L-type glass rod and spread the plastid and bacterium on the petri dish tell it become gluey.

STEP5：Cover up the petri dish and wait for about 16 to 24 hours to reform.

1. To an autoclaved, 1.5ml microcentrifuge tube, add the following:

   	For Cohesive Ends
   5X Ligase Reaction	4 μl
   Vector D	3 to 30 fmol
   Insert D	9 to 90 fmol
   T4 DNA Ligase (	1 unit (in 1 μl)
   Autoclaved distilled	to 20 μl

2. Mix gently. Centrifuge briefly the contents to the bottom of the tube.
3. Incubate at room temperature for 5 min.
4. Use 2 μl of the ligation reaction to transform 100 μl of competent cells.

Add restriction enzyme (EcoRI / SpeI)

Total:40ul

Plasmid DNA:500ng (77.7ng/ul, 500/77.7≒6.5ul)

1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel.
2. Weigh the gel slice in a colorless tube. Add 3 volumes Buffer QG to 1 volume gel (100 mg gel~100 μl).The maximum amount of gel per spin column is 400 mg.For>2% agarose gels,add 6 volumes Buffer QG.
3. Incubate at 50℃ for 10 min (or until the gel slice has completely dissolved). Vortex the tube every 2–3 min to help dissolve gel. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). If the color of the mixture is orange or violet, add 10μl 3 M sodium acetate, pH 5.0, and mix. The mixture turns yellow.
4. Add 1 gel volume isopropanol to the sample and mix.
5. Place a QIAquick spin column in a provided 2 ml collection tube or into a vacuum manifold. To bind DNA, apply the sample to the QIAquick column and centrifuge for 1 min or apply vacuum to the manifold until all the samples have passed through the column. Discard flow-through and place the QIAquick column back into the same tube. For sample volumes of&62;800μl, load and spin/apply vacuum again.
6. If DNA will subsequently be used for sequencing, in vitro transcription, or microinjection, add 500 μl Buffer QG to the QIAquick column and centrifuge for 1 min or apply vacuum. Discard flow-through and place the QIAquick column back into the same tube.
7. To wash, add 750μl Buffer PE to QIAquick column and centrifuge for 1 min or apply vacuum. Discard flow-through and place the QIAquick column back into the same tube. Note: If the DNA will be used for salt-sensitive applications (e.g., sequencing, bluntended ligation), let the column stand 2–5 min after addition of Buffer PE. Centrifuge the QIAquick column in the provided 2 ml collection tube for 1 min to remove residual wash buffer.
8. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
9. To elute DNA, add 50 μl Buffer EB (10 mM Tris·Cl, pH 8.5) or water to the center of the QIAquick membrane and centrifuge the column for 1 min. For increased DNA concentration, add 30 μl Buffer EB to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min. After the addition of Buffer EB to the QIAquick membrane, increasing the incubation time to up to 4 min can increase the yield of purified DNA.
10. If purified DNA is to be analyzed on a gel, add 1 volume of Loading Dye to 5 volumes of purified DNA. Mix the solution by pipetting up and down before loading the gel

Harvesting

1. Transfer 1.5ml of bacterial culture to a microcentrifuge tube. Centrifuge for 2 min at 6,000 rpm in a microcentrifuge and discard the supernatant.

   Resuspension

2. Add 200μl of PS1 Buffer(RNaseA added)to the tube and resuspend the cell pellet by vortexing or pipetting.

   Lysis

3. Add 200μl of PS2 Buffer and mix gently by inverting the tube 10 times. Do not vortex, avoid shearing genomic DNA. Stand for 3 minutes at room temperature until lysate clears.

   Neutralization

4. Add 300μl of PS3 Buffer and mix immediately by inverting the tube 10 times. Do not vortex. Until the precipitate formation, shake a few times to broken it. Incubate at room temperature for 5 minutes to digest RNA. Centrifuge for 5 minutes at 13,000 rpm.

   DNA Binding

5. Place a PS Column in a Collection tube. Apply the clear lysate (supernatant) from Step 4 to the PS Column. Centrifuge at 13,000 rpm for 30 seconds.

6. Discard the flow-through and place the PS Column back into the Collection Tube.

   Wash

7. Add 400μl of W1 Buffer in the PS Column. Centrifuge at 13,000 rpm for 30 seconds.
8. Discard the flow-through and place the PS Column back into the Collection Tube.
9. Add 600μl of W2 Buffer(ethanol added) in the PS Column. Centrifuge at 13,000 rpm for 30.

10. Discard the flow-through and place the PS Column back into the Collection Tube. Centrifuge again for 3 minutes at 13,000 rpm to dry the Column matrix.

    DNA Elution

11. Transfer dried PS Column to a clean microcentrifuge tube. Add 50μl of distilled water into the center of the column matrix. Stand for 2 minutes until distilled water is absorbed by the matrix. Centrifuge for 2 minutes at 13,000 rpm to elute purified DNA.
12. If would like more production, repeat this elution step again.

Materials

• Resuspended DNA (Resuspend well in 10μl dH₂0, pipette up and down several times, let sit for a few minutes)
• Competent cells (100μl DH5α per transformation)
• Ice (in ice container)
• 2ml tube (1 per transformation)
• 42℃ water bath
• Petri dishes with LB agar and appropriate antibiotic (2 per transformation)
• Spreader (2 per transformation)
• 37℃ incubator
• 10pg/μl RFP Control (pSB1C3 w/ BBa_J23102)
• LB broth (900μl per transformation)
• Pipettman
• Centrifuge

Procedure

1. Start thawing the competent cells on ice.
2. Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
3. Add 1 μL of the DNA with RFP Control to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Close tubes and incubate the cells on ice for 30 minutes.
5. Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
6. Incubate the cells on ice for 3 minutes for recover.
7. Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
8. Centrifuge the cells at 2000 rpm for 2 minutes.
9. Remove 800 μL of the supernatant by the pipettmen.
10. For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 μl and 150 μl of the transformation onto the dishes, and spread.
11. Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
12. After picking colonies, store the plate in 4 ℃.