Difference between revisions of "Team:CSU Fort Collins/Measurement"

Line 26: Line 26:
 
     padding: 5px;
 
     padding: 5px;
 
     cursor: pointer;
 
     cursor: pointer;
−
     background-color: #6CBB6C;
+
     background-color: #efefef;
−
     border-color: #383838;
+
      
 
     border-style: solid 1px;
 
     border-style: solid 1px;
 
     width: 90%;
 
     width: 90%;

Revision as of 23:58, 15 September 2015

InterLab Study

Devices Measured:

Protocols:

J23101 and I13504 into pSB1C3

  1. Reconstitute BioBrick parts.

    BBa_J23101: 2015 Kit Plate 1, Well 20K. Size: 35 bp.

    BBa_I13504: 2015 Kit Plate 4, Well 21J. Size: 875 bp.

    1. With a pipette tip, punch a hole through the foil cover into the corresponding well of the part desired. Make sure you have properly oriented the plate. To prevent cross-contamination, do not remove the foil cover.
    2. Pipette 10 μl of nuclease-free water into the well. Pipette up and down a few times until mixture is homogeneous. The sample should turn red
  2. Transform BioBrick parts
    1. Set the water bath to 42 ℃ and remove 2 Cm25 plates (for part J23101) and 2 Amp100 plates (for part I13504) and allow the plates to come to room temperature.
    2. Thaw 2 tubes (1 for each part) of chemically competent E. coli cells on ice. Leave in microcentrifuge tube.
    3. For each part, add 1 ul of the resuspended DNA into the tube of competent cells.
    4. Incubate on ice for 30 minutes.
    5. Heat shock cells for 60 seconds at 42 ℃ without shaking.
    6. Place on ice for 2 minutes.
    7. Aseptically (by fire or in the hood) add 250 μl of LB media to the tube of chemically competent cells. Do not add antibiotic at this step. Cap tightly.
    8. Place tube horizontally in shaker. Incubate at 37 ℃ and 225 rpm for 1 hour.
    9. In the laminar hood, spread 100 μl of transformants onto respective LB+Antibiotic plates.
    10. Leave plates in 37 ℃ incubator overnight. Store remaining liquid cultures in 4 ℃
  3. Confirm transformation
    1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Antibiotic plates – see above for respective antibiotic resistances. Leave plates in 37 ℃ incubator overnight.
    2. Verify all 16 colonies via colony PCR.
    3. Use the following mixture and thermalcycler program:

      Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

      Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

      Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

      Component 50μl reaction
      Molecular grade H2O Added first. 32.5μL
      5x HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Template DNA 1.0μL
      DNA polymerase Added last. 0.5μL
      Component 50μl reaction
      Molecular grade H2O Added first 33.5ul
      5x Phusion HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Colony 1
      Phusion DNA polymerase Added last. 0.5μL
    4. Run PCR products in 2% agarose gel with a 100 bp ladder at 110 V for 60 minutes. Do you see the correct sizes?
      1. J23101: 318 bp
      2. I13504: 1197 bp
  4. Extract BioBrick DNA
    1. Once you confirm both parts have been transformed correctly, start a 2 mL overnight culture with antibiotic for each.
    2. The next day, miniprep the overnight cultures via kit instructions. Nanodrop the resulting samples. Ask for help in preparing each part for sequencing. Once the sequencing confirms the part, glycerol stock it.
  5. Digest BBa_J232101 with SpeI and PstI at 37 °C for 60 minutes. Use the following mixture:
    6. Component 50μl reaction
    Molecular Grade Water Calculated. Use to make reaction total volume = 50ul
    Custsmart Buffer(different if using pstI) 5ul
    DNA 1ug
    SpeI 0.5ul
    PstI 0.5ul

  6. 2. Digest your mixture in a water bath at 37C for 60min

    Component 50μl reaction
    Molecular Grade Water Calculated. Use to make reaction total volume = 50ul
    Custsmart Buffer(different if using pstI) 5ul
    DNA 1ug
    XbaI 0.5ul
    PstI 0.5ul
  7. Clean up all DNA fragments with PCR clean-up kit.
  8. Using the ‘Ligation Template’ Excel Sheet, calculate the amount of each component to combine in a ligation mix for an Insert:Backbone ratio of 4:1 with a total DNA concentration of 7.5-10.0 ng/uL.
    1. Incubate the ligation mixture at 25 °C (room temperature – can be done on the lab bench) for 1 hour (or at 16 °C overnight). Heat inactivate at 65 °C for 10 minutes. Place on ice.
  9. Transformation
    1. Set water bath to 42 °C
    2. Remove 3 LB + Cm25 plates from 4 °C and allow them to come to room temperature.
    3. Thaw chemically competent cells on ice. Leave in microcentrifuge tube.
    4. Add 5 μl of ligation mix to chemically competent cells.
    5. Add 5 μl of digested backbone to chemically competent cells as a control.
    6. Incubate on ice for 30 minutes.
    7. Heat shock cells for 60 sec at 42 °C without shaking.
    8. Place on ice for 2 minutes.
    9. Aseptically (by the fire on in the hood) add 250 μl of LB media to the tube. Do not add antibiotic at this step. Cap tightly.
    10. Place tube horizontally in shaker. Incubate at 37 °C and 225 rpm for 1 hour.
    11. In the laminar hood, spread 100 μL of transformants onto an LB + Cm25 plate.
    12. Spin down the remaining cells (16,000 x g for 10 minutes should suffice). Remove all media and resuspend in 100 μL of LB until the mixture is homogeneous. This step isn’t necessary for the control.
    13. In the laminar hood, spread the remaining 100 μL of transformants onto an LB + Cm25
    14. Leave plates in 37 °C incubator overnight. Store remaining liquid cultures in 4 °C.
  10. Confirm transformation
    1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Cm25 plates.
    2. Verify all 16 colonies via colony PCR.
    3. Use the following mixture and thermalcycler program:

      Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

      Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

      Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

      Component 50μl reaction
      Molecular grade H2O Added first. 32.5μL
      5x HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Template DNA 1.0μL
      DNA polymerase Added last. 0.5μL
      Component 50μl reaction
      Molecular grade H2O Added first 33.5ul
      5x Phusion HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Colony 1
      Phusion DNA polymerase Added last. 0.5μL
    4. Run PCR products in 1% agarose gel with a 1 kb ladder at 110 V for 60 minutes. Do you see the correct sizes? [Should be ~930 bp]
  11. Sequencing

J23106 and I13504 into pSB1C3

  1. Reconstitute BioBrick parts.

    BBa_J23106: 2015 Kit Plate 1, Well 22A. Size: 35 bp.

    BBa_I13504: 2015 Kit Plate 4, Well 21J. Size: 875 bp.

    1. With a pipette tip, punch a hole through the foil cover into the corresponding well of the part desired. Make sure you have properly oriented the plate. To prevent cross-contamination, do not remove the foil cover.
    2. Pipette 10 μl of nuclease-free water into the well. Pipette up and down a few times until mixture is homogeneous. The sample should turn red
  2. Transform BioBrick parts
    1. Set the water bath to 42 ℃ and remove 2 Cm25 plates (for part J23106) and 2 Amp100 plates (for part I13504) and allow the plates to come to room temperature.
    2. Thaw 2 tubes (1 for each part) of chemically competent E. coli cells on ice. Leave in microcentrifuge tube.
    3. For each part, add 1 ul of the resuspended DNA into the tube of competent cells.
    4. Incubate on ice for 30 minutes.
    5. Heat shock cells for 60 seconds at 42 ℃ without shaking.
    6. Place on ice for 2 minutes.
    7. Aseptically (by fire or in the hood) add 250 μl of LB media to the tube of chemically competent cells. Do not add antibiotic at this step. Cap tightly.
    8. Place tube horizontally in shaker. Incubate at 37 ℃ and 225 rpm for 1 hour.
    9. In the laminar hood, spread 100 μl of transformants onto respective LB+Antibiotic plates.
    10. Leave plates in 37 ℃ incubator overnight. Store remaining liquid cultures in 4 ℃
  3. Confirm transformation
    1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Antibiotic plates – see above for respective antibiotic resistances. Leave plates in 37 ℃ incubator overnight.
    2. Verify all 16 colonies via colony PCR.
    3. Use the following mixture and thermalcycler program:

      Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

      Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

      Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

      Component 50μl reaction
      Molecular grade H2O Added first. 32.5μL
      5x HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Template DNA 1.0μL
      DNA polymerase Added last. 0.5μL
      Component 50μl reaction
      Molecular grade H2O Added first 33.5ul
      5x Phusion HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Colony 1
      Phusion DNA polymerase Added last. 0.5μL
    4. Run PCR products in 2% agarose gel with a 100 bp ladder at 110 V for 60 minutes. Do you see the correct sizes?
      1. J23106: 320 bp
      2. I13504: 1197 bp
  4. Extract BioBrick DNA
    1. Once you confirm both parts have been transformed correctly, start a 2 mL overnight culture with antibiotic for each.
    2. The next day, miniprep the overnight cultures via kit instructions. Nanodrop the resulting samples. Ask for help in preparing each part for sequencing. Once the sequencing confirms the part, glycerol stock it.
  5. Digest BBa_J232106 with SpeI and PstI at 37 °C for 60 minutes. Use the following mixture:
    6. Component 50μl reaction
    Molecular Grade Water Calculated. Use to make reaction total volume = 50ul
    Custsmart Buffer(different if using pstI) 5ul
    DNA 1ug
    SpeI 0.5ul
    PstI 0.5ul

  6. 2. Digest your mixture in a water bath at 37C for 60min

    Component 50μl reaction
    Molecular Grade Water Calculated. Use to make reaction total volume = 50ul
    Custsmart Buffer(different if using pstI) 5ul
    DNA 1ug
    XbaI 0.5ul
    PstI 0.5ul
  7. Clean up all DNA fragments with PCR clean-up kit.
  8. Using the ‘Ligation Template’ Excel Sheet, calculate the amount of each component to combine in a ligation mix for an Insert:Backbone ratio of 4:1 with a total DNA concentration of 7.5-10.0 ng/uL.
    1. Incubate the ligation mixture at 25 °C (room temperature – can be done on the lab bench) for 1 hour (or at 16 °C overnight). Heat inactivate at 65 °C for 10 minutes. Place on ice.
  9. Transformation
    1. Set water bath to 42 °C
    2. Remove 3 LB + Cm25 plates from 4 °C and allow them to come to room temperature.
    3. Thaw chemically competent cells on ice. Leave in microcentrifuge tube.
    4. Add 5 μl of ligation mix to chemically competent cells.
    5. Add 5 μl of digested backbone to chemically competent cells as a control.
    6. Incubate on ice for 30 minutes.
    7. Heat shock cells for 60 sec at 42 °C without shaking.
    8. Place on ice for 2 minutes.
    9. Aseptically (by the fire on in the hood) add 250 μl of LB media to the tube. Do not add antibiotic at this step. Cap tightly.
    10. Place tube horizontally in shaker. Incubate at 37 °C and 225 rpm for 1 hour.
    11. In the laminar hood, spread 100 μL of transformants onto an LB + Cm25 plate.
    12. Spin down the remaining cells (16,000 x g for 10 minutes should suffice). Remove all media and resuspend in 100 μL of LB until the mixture is homogeneous. This step isn’t necessary for the control.
    13. In the laminar hood, spread the remaining 100 μL of transformants onto an LB + Cm25
    14. Leave plates in 37 °C incubator overnight. Store remaining liquid cultures in 4 °C.
  10. Confirm transformation
    1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Cm25 plates.
    2. Verify all 16 colonies via colony PCR.
    3. Use the following mixture and thermalcycler program:

      Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

      Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

      Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

      Component 50μl reaction
      Molecular grade H2O Added first. 32.5μL
      5x HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Template DNA 1.0μL
      DNA polymerase Added last. 0.5μL
      Component 50μl reaction
      Molecular grade H2O Added first 33.5ul
      5x Phusion HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Colony 1
      Phusion DNA polymerase Added last. 0.5μL
    4. Run PCR products in 1% agarose gel with a 1 kb ladder at 110 V for 60 minutes. Do you see the correct sizes? [Should be ~930 bp]
  11. Sequencing

J23117 and I13504 into pSB1C3

  1. Reconstitute BioBrick parts.

    BBa_J23117: 2015 Kit Plate 1, Well 22K. Size: 35 bp.

    BBa_I13504: 2015 Kit Plate 4, Well 21J. Size: 875 bp.

    1. With a pipette tip, punch a hole through the foil cover into the corresponding well of the part desired. Make sure you have properly oriented the plate. To prevent cross-contamination, do not remove the foil cover.
    2. Pipette 10 μl of nuclease-free water into the well. Pipette up and down a few times until mixture is homogeneous. The sample should turn red
  2. Transform BioBrick parts
    1. Set the water bath to 42 ℃ and remove 2 Cm25 plates (for part J23117) and 2 Amp100 plates (for part I13504) and allow the plates to come to room temperature.
    2. Thaw 2 tubes (1 for each part) of chemically competent E. coli cells on ice. Leave in microcentrifuge tube.
    3. For each part, add 1 ul of the resuspended DNA into the tube of competent cells.
    4. Incubate on ice for 30 minutes.
    5. Heat shock cells for 60 seconds at 42 ℃ without shaking.
    6. Place on ice for 2 minutes.
    7. Aseptically (by fire or in the hood) add 250 μl of LB media to the tube of chemically competent cells. Do not add antibiotic at this step. Cap tightly.
    8. Place tube horizontally in shaker. Incubate at 37 ℃ and 225 rpm for 1 hour.
    9. In the laminar hood, spread 100 μl of transformants onto respective LB+Antibiotic plates.
    10. Leave plates in 37 ℃ incubator overnight. Store remaining liquid cultures in 4 ℃
  3. Confirm transformation
    1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Antibiotic plates – see above for respective antibiotic resistances. Leave plates in 37 ℃ incubator overnight.
    2. Verify all 16 colonies via colony PCR.
    3. Use the following mixture and thermalcycler program:

      Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

      Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

      Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

      Component 50μl reaction
      Molecular grade H2O Added first. 32.5μL
      5x HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Template DNA 1.0μL
      DNA polymerase Added last. 0.5μL
      Component 50μl reaction
      Molecular grade H2O Added first 33.5ul
      5x Phusion HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Colony 1
      Phusion DNA polymerase Added last. 0.5μL
    4. Run PCR products in 2% agarose gel with a 100 bp ladder at 110 V for 60 minutes. Do you see the correct sizes?
      1. J23117: 320 bp
      2. I13504: 1197 bp
  4. Extract BioBrick DNA
    1. Once you confirm both parts have been transformed correctly, start a 2 mL overnight culture with antibiotic for each.
    2. The next day, miniprep the overnight cultures via kit instructions. Nanodrop the resulting samples. Ask for help in preparing each part for sequencing. Once the sequencing confirms the part, glycerol stock it.
  5. Digest BBa_J232101 with SpeI and PstI at 37 °C for 60 minutes. Use the following mixture:
    6. Component 50μl reaction
    Molecular Grade Water Calculated. Use to make reaction total volume = 50ul
    Custsmart Buffer(different if using pstI) 5ul
    DNA 1ug
    SpeI 0.5ul
    PstI 0.5ul

  6. 2. Digest your mixture in a water bath at 37C for 60min

    Component 50μl reaction
    Molecular Grade Water Calculated. Use to make reaction total volume = 50ul
    Custsmart Buffer(different if using pstI) 5ul
    DNA 1ug
    XbaI 0.5ul
    PstI 0.5ul
  7. Clean up all DNA fragments with PCR clean-up kit.
  8. Using the ‘Ligation Template’ Excel Sheet, calculate the amount of each component to combine in a ligation mix for an Insert:Backbone ratio of 4:1 with a total DNA concentration of 7.5-10.0 ng/uL.
    1. Incubate the ligation mixture at 25 °C (room temperature – can be done on the lab bench) for 1 hour (or at 16 °C overnight). Heat inactivate at 65 °C for 10 minutes. Place on ice.
  9. Transformation
    1. Set water bath to 42 °C
    2. Remove 3 LB + Cm25 plates from 4 °C and allow them to come to room temperature.
    3. Thaw chemically competent cells on ice. Leave in microcentrifuge tube.
    4. Add 5 μl of ligation mix to chemically competent cells.
    5. Add 5 μl of digested backbone to chemically competent cells as a control.
    6. Incubate on ice for 30 minutes.
    7. Heat shock cells for 60 sec at 42 °C without shaking.
    8. Place on ice for 2 minutes.
    9. Aseptically (by the fire on in the hood) add 250 μl of LB media to the tube. Do not add antibiotic at this step. Cap tightly.
    10. Place tube horizontally in shaker. Incubate at 37 °C and 225 rpm for 1 hour.
    11. In the laminar hood, spread 100 μL of transformants onto an LB + Cm25 plate.
    12. Spin down the remaining cells (16,000 x g for 10 minutes should suffice). Remove all media and resuspend in 100 μL of LB until the mixture is homogeneous. This step isn’t necessary for the control.
    13. In the laminar hood, spread the remaining 100 μL of transformants onto an LB + Cm25
    14. Leave plates in 37 °C incubator overnight. Store remaining liquid cultures in 4 °C.
  10. Confirm transformation
    1. Pick and annotate (give each colony a number or letter) 16 colonies onto new LB+Cm25 plates.
    2. Verify all 16 colonies via colony PCR.
    3. Use the following mixture and thermalcycler program:

      Primer A: Sequencing VF2: TGCCACCTGACGTCTAAGAA [Tm = 55.9]

      Primer B: Sequencing VR: ATTACCGCCTTTGAGTGAGC [Tm = 55.3]

      Note: To add your template DNA, use a toothpick or pipette tip to touch the colony and then swirl it in the PCR mixture to add some cells into your PCR mixture.

      Component 50μl reaction
      Molecular grade H2O Added first. 32.5μL
      5x HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Template DNA 1.0μL
      DNA polymerase Added last. 0.5μL
      Component 50μl reaction
      Molecular grade H2O Added first 33.5ul
      5x Phusion HF Buffer 10μL
      10 mM dNTPs 1.0μL
      Primer A (10μM) 2.5μL
      Primer B (10μM) 2.5μL
      Colony 1
      Phusion DNA polymerase Added last. 0.5μL
    4. Run PCR products in 1% agarose gel with a 1 kb ladder at 110 V for 60 minutes. Do you see the correct sizes? [Should be ~930 bp]
  11. Sequencing

Protocol

Materials

  • First
  • Second
  • Third

Procedure

  1. First
  2. Second
  3. Third

Data: