Difference between revisions of "Team:NU Kazakhstan/Project"

Description

S. mutans (Gram+, Biosafety level 1, naturally competent cells) is an etiologic agent of dental caries which adheres to tooth surfaces and responsible for the biofilm formation known as dental plaque. Dietary sugars metabolized by S. mutans result in the production and secretion of lactic acid, which in turn reduces the pH of the dental cavity. S. mutans possess a membrane-bound F-ATPase that helps to survive them in acidic environment by pumping H+ ions out of the cell (Sasaki et al., 2014). S. mutans survival is tightly associated with the activation of quorum sensing mechanisms that are involved in growth proliferation and biofilm formation. Thus, the aim of this project is to design smart DNA plasmid constructs that will operate according to the following:

1. Will inhibit bacterial growth and biofilm formation through the action of XrpA protein controlled by the pH-sensitive promoter.

2. Will inhibit the VicK (putative histidine kinase) transcription via modified CRISPR-dCas9 complex, since Vick is involved in signal transduction for the activation of lactate metabolism in S. mutans.

In order to control the action of the plasmids, safety regulation mechanisms will be introduced to the system above. Plasmid will be eliminated by the blue-light activation. The safety mechanism ceases the functionality of the plasmid’s origin of the replication via CRISPR-dCas9 system, thus a further propagation of construct to the next generation is eliminated.

The two pathways for XrpA and VicK actions are shown below.

sgRNA designed to target Vick gene is under nlmAB promoter. nlmAB is a promoter in S. mutans, which is precisely regulated by Competence stimulating peptide(CSP)through ComED two-component signal transduction system(Liu et al., 2012). Inactivation of Vick leads to formation of biofilm which is less dense, easily disrupted and loosely adherent to polystyrene(Senadheera et al.,2005).

CRISPR-dCas9

Experiments and Protocols

Circular Polymeraze Extension Cloning(CPEC)

As we had lots of problems with DNA cloning methods we found a method called Circular Polymerase Extension Cloning. This method suggests using parts with overlapping sequences in order to PCR them on each other. For this purpose we ordered two pairs of primers. Prefix-forward(GAATTCGCGGCCGCTTCTAG) and Suffix-reverse(CTGCAGCGGCCGCTACTAGTA) primers will prime the standard part at prefix and suffix regions. Suffix-forward(ACTAGTAGCGGCCGCTGAG)and Prefix-reverse(TCTAGAAGCGGCCGCGAATTC) primers were used to PCR plasmid backbone. These PCR products then were put together into CPEC reaction. There these two parts will anneal to each other with suffix and prefix overlapping sequences and produce circular plasmid with appropriate part ready to be transformed.

MAKING COMPETENT CELLS

1. Inoculate a single colony into 5 mL LB in 50 mL falcon tube (taped on a loosed tap).
2. Grow on 37°C with shaking for 130 rpm overnight.
3. Use 1 mL to inoculate 100 mL to inoculate 100 mL of LB in 250 mL bottle the next morning.
4. Shake 37°C for 1.5-3 hours.
5. When OD is between 0.3-0.4 at 600 nm wavelength put cell on ice.
6. Hold cells on ice for the 10 minutes.
7. Collect cells by centrifugation for 3 min at maximum speed (4700 rpm).
8. Decant supernatant and gently resuspend on 10 mL ice-cold 0.1 M CaCl2 (prepared in ddH2O). Treat them gently.
9. Incubate on ice for 20 minutes.
10. Centrifuge again at maximum speed (4700 rpm).
11. Discard supernatant and gently resuspend in 5 mL cold 0.1 M CaCl2 (15% glycerol).
12. Dispense into chilled microtubes, put on the dry ice. Perform this procedure very quickly.
13. Freeze in -80°C.

TRANSFORMATION

1. Start thawing the competent cells on ice.
2. Add 50 µL of thawed competent cells into pre-chilled 2ml tube, and another 50µL into a 2ml tube, labelled for your control.
3. Add 1 - 2 µL of the resuspended DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
4. Add 1 µL of the RFP Control to your control transformation.
5. Close tubes and incubate the cells on ice for 30 minutes.
6. Heat shock the cells by immersion in a pre-heated water bath at 42ºC for 60 seconds.
7. Incubate the cells on ice for 5 minutes.
8. Add 200 μl of SOC media (make sure that the broth does not contain antibiotics and is not contaminated) to each transformation
9. Incubate the cells at 37ºC for 2 hours while the tubes are rotating or shaking. Important: 2 hour recovery time helps in transformation efficiency, especially for plasmid backbones with antibiotic resistance other than ampicillin.
10. Label two petri dishes with LB agar and the appropriate antibiotic(s) with the part number, plasmid backbone, and antibiotic resistance. Plate 20 µl and 200 µl of the transformation onto the dishes, and spread. This helps ensure that you will be able to pick out a single colony.
11. For the control, label two petri dishes with LB agar (AMP). Plate 20 µl and 200 µl of the transformation onto the dishes, and spread.
12. Incubate the plates at 37ºC for 12-14 hours, making sure the agar side of the plate is up. If incubated for too long the antibiotics start to break down and un-transformed cells will begin to grow. This is especially true for ampicillin - because the resistance enzyme is excreted by the bacteria, and inactivates the antibiotic outside of the bacteria.
13. You can pick a single colony, make a glycerol stock, grow up a cell culture and miniprep.
14. Count the colonies on the 20 μl control plate and calculate your competent cell efficiency.

LIGATION

1. Add 2ul of digested plasmid backbone (25 ng)
2. Add equimolar amount of EcoRI-HF SpeI digested fragment (< 3 ul)
3. Add equimolar amount of XbaI PstI digested fragment (< 3 ul)
4. Add 1 ul T4 DNA ligase buffer. Note: Do not use quick ligase
5. Add 0.5 ul T4 DNA ligase
6. Add water to 10 ul
7. Ligate 16C/30 min, heat kill 80C/20 min
8. Transform with 1-2 ul of product

DNA EXTRACTION FROM CELLS (MINIPREP)

1. Harvest. Centrifuge 1-5 mL of the overnight LB-culture (Use 1-2×104 E.coli cells for each sample). Remove all medium. Add 2 mL of ddH2O and centrifuge again. Remove all medium.
2. Resuspend. Add 250 uL Resuspension Buffer (R3) with RNase A to the cell pellet and resuspend the pellet until it is homogenous.
3. Lyse. Add 250 uL Lysis Buffer (L7). Mix gently by inverting the capped tube until the mixture is homogenous. Do not vortex. Incubate the tube at room temperature for 5 minutes.
4. Precipitate. Add 350 uL Precipitation Buffer (N4). Mix immediately by inverting the tube, or for large pellets, vigorously shaking the tube, until the mixture is homogenous. Do not vortex. Centrifuge the lysate at >12,000 g for 10 minutes.
5. Bind. Load the supernatant from step 4 onto a spin column in a 2-mL wash tube. Centrifuge the column at 12,000 g for 1 minute. Discard the flow-through and place the column back into the wash tube.
6. Optional wash (Recommended for endA+ strains). Add 500 uL Wash Buffer (W10) with ethanol to the column. Incubate the column for 1 minute at room temperature. Centrifuge the column at 12,000 g for 1 minute. Discard the flow-through and place the column back into the wash tube.
7. Wash and remove ethanol. Add 700 uL Wash Buffer (W9) with ethanol to the column. Centrifuge the column at 12,000 g for 1 minute. Discard the flow-through and place the column back into the wash tube. Centrifuge the column at 12,000 g for 1 minute. Discard the flow-through.
8. Elute. Place the Spin Column in a clean 1.5-mL recovery tube. Add 75 uL of preheated TE Buffer (TE) to the center of the column. Incubate the column for 1 minute at room temperature.
9. Recover. Centrifuge the column at 12,000 g for 2 minutes. The recovery tube contains the purified plasmid DNA at 4⁰C (short-term) or store DNA in aliquots at -20⁰C (long-term).

DNA EXTRACTION FROM GEL

Excising and dissolving the gel

1. Equilibrate a water bath or heat block to 50⁰C.
2. Excise a minimal area of gel containing the DNA fragment of interest.
3. Weigh the gel slice containing the DNA fragment using a scale sensitive to 0.001 g.
4. Add Gel Solubilization Buffer (L3) to the excised gel in the tube size indicated in the following table:
Gel Tube Buffer L3 Volume
≤2% agarose 1.7-mL polypropylene 3:1 (i.e. 1.2 mL Buffer L3 : 400 mg gel piece)
>2% agarose 5-mL polypropylene 6:1 (i.e. 2.4 mL Buffer L3 : 400 mg gel piece)
5. Place the tube with the gel slice and Buffer L3 into a 50⁰C water bath or heat block. Incubate the tube at 50⁰C for 10 minutes. Invert the tube every 3 minutes to mix and ensure gel dissolution.
6. After the gel slice appears dissolved, incubate the tube for an additional 5 minutes.
7. Optional: For optimal DNA yields, add 1 gel volume of isopropanol to the dissolved gel slice. Mix well.
8. Purify the DNA using a centrifuge.

Purifying DNA using a centrifuge

1. Load. Pipet the dissolved gel piece onto a Quick Gel Extraction Column inside a Wash Tube. Use 1 column per 400 mg of agarose gel. Note: the column reservoir capacity is 850 uL.
2. Bind. Centrifuge the column at >12,000 g for 1 minute. Discard the flow-through and place the column into the Wash Tube.
3. Wash. Add 50 uL Wash Buffer (W1) containing ethanol to the column.
4. Remove Buffer. Centrifuge the column at >12,000 g for 1 minute. Discard the flow-through and place the column into the Wash Tube.
Repeat Steps 3 and 4.
5. Remove Ethanol. Centrifuge the column at maximum speed for 3 minutes. Discard the flow-through.
6. Elute. Place the column into a Recovery Tube. Add 50 uL Elution Buffer (E5) to the center of the column. Incubate the tube for 2 minutes at room temperature.
7. Collect. Centrifuge the tube at >12,000 g for 5 minutes.
8. Store. The elution tube contains the purified DNA. Store the purified DNA at 4⁰C for immediate use or at -20⁰C for long-term storage.

DNA ISOLATION FROM BACTERIA

1. Pick an isolated bacterial colony and resuspend it in 1 mL of autoclaved water in a microfuge tube.
2. Centrifuge for 1 minute at 10,000-12,000 rpm. Remove the supernatant.
3. Add 200 uL of InstaGene matrix to the pellet and incubate at 56⁰c for 15-30 minutes.
Note: InstaGene matrix should be mixed at moderate speed on a magnetic stirrer to maintain the matrix in suspension. The pipet tip used should have a large bore, such as 1,000 uL pipet tip
4. Vortex at high speed for 10 seconds. Place the tube in a 100⁰C heat block or boiling water bath for 8 minutes.
5. Vortex at high speed for 10 seconds. Spin at 10,000-12,000 rpm for 2-3 minutes.
6. Use 20 uL of the resulting supernatant per 50 uL PCR reaction. Store the remainder of the supernatant at -20⁰C. Repeat Step 5 when reusing the InstaGene preparation.
Note: It is important to store the prepared sample at -20⁰C.

Transformation of S.mutans with XrpA + pMSP3535 and sgVicK+ pMSP3535

Protocol comes from paper recently published in Molecular Microbiology "A unique open reading frame within the ComX gene of Streptococcus mutans regulates genetic competence and oxidative stress tolerence" by Kaspar et.al.
S.mutans UA159 that was isolated by NU_Kazakhstan team from oral cavity. S.mutans were grown overnight with final concentration of bacitracin 0.2 U/ml. Overnight culture was diluted 1:50 in 10 mL of BHI. When OD600 of 0.2 reached, a final concentration of 1 uM CSP was added. Then cultures were incubated at 37°C for 10 minutes. Then 0.5 ng of pMSP3535 with xrpA or sgVicK construct with erythromycin resistance were added. After 3 hours of incubation at 37°C, 25 ul of dilution was plated on BHI plate with 10 ug/mL. After 31 hour of incubation at 5% CO2, there were colonies on plates. There was growth on control plate also. The possible reason for that:
- S.mutans has natural competence and might have acquired resistance for antibiotics during lifetime of person from which it was acquired.
- Working concentration of erythromycin is 10 ug/mL for S.mutans.Also, our team contacted authors of "A unique open reading frame within the ComX gene of Streptococcus mutans regulates genetic competence and oxidative stress tolerence" by Kaspar et.al. Robert A.Burne have confirmed that usually working concentration of S.mutans for erythromycin is 10 ug/mL.

Testing xrpA under pH sensitive promoter system

1. Transformed S.mutans was inoculated, single colony put on BHI with final concentration 10 ug/mL of erythromycin.
2. Cells were diluted 1/100, 250 ul into 25 mL with antibiotic, after 7 hours OD600 0.5 obtained.
3. Then following solutions were put onto 48 nunco plates (Denmark)
• XrpA transformed S.mutans+ buffer pH= 5.3 + nisin
• XrpA transformed S.mutans + nisin
• XrpA transformed S.mutans+buffer
• XrpA transformed S.mutans
• Untransformed S.mutans
• Control BHI+ erythromycin fresh
• Control BHI +erythromycin incubated for 7 hours

Measuring Biofilm

1. Four 48-well plate were incubated at 5% CO2 for different times
• 2 hours
• 4 hours
• 6 hours
• 8 hours
2. Wells were rinsed with distilled water
3. Plates were air dried, then stained with 0.25% safranin- 0.5% ethanol- s.water for 15 minutes.
4. After 15 minutes, plates were rinsed with distilled water and then was air dried.
5. Biofilm was dissolved in 70% ethanol. Absorbance was measured with Varioscan Flash.
*Promoter was activated with buffer acetate/sodium acetate

Results

At the beginning we have planned the construction of three systems. They are XrpA gene under pH-sensitive promoter (the most active at pH=5.5), sgRNA for VicK gene under nlmAB promoter (regulated by CSP peptide, and the last one is blue-light safety regulation system.
XrpA part
We measured the efficiency of biofilm production by S.mutans via overexpression of endogenous xrpA protein under pH - sensitive promoter. Nisin-Controlled Expression system was activated by addition of nisin polypeptide, and the promoter was induced by acetic acid-sodium acetate buffer (pH=5.5). The efficiency of construct was checked by measuring biofilm with spectrophotometer (Varioscan Flash Thermo Scientific).
There is a difference between S.mutans having XrpA construct and the one that lacks it. Data indicates that XrpA transformed S.mutans has low level of biofilm than wild type during 2, 6 and 8 hours time intervals.
Fig. 1 and Fig.2 show that the amount of biofilm formed by S.mutans (x, acid, n) was lower than in the rest of control samples.
It can be seen from all three figures that the addition of acetate buffer had inhibiting effect on the growth of bacteria. Therefore, the amount of biofilm formed by S.mutans (x, a) is lower than S.mutans (x, n), S.mutans (x) and S.mutans (wild). We hypothesized that the defense mechanisms that usually protect S.mutans from acid stress might not be activated at short time range. The measurements on Nunc Plates have certain limitations such as absence of coating for Gram + bacterial species, and loosing of not attached biofilm mass during simple staining. The more accurate results could be obtained from using electron scanning microscopy. However, the first two figures confirmed theoretical and practical results from studies performed by Kaspar et al. in 2015.

Figure 1. Measurements of absorbance of biofilm at 2 hours incubation.
x- S.mutans transformed with XrpA construct under pH- sensitive promoter.
nisin- S.mutans transformed with XrpA construct under pH-sensitive promoter + nisin polypeptide.
acid- S.mutans transformed with XrpA construct under pH-sensitive promoter + acetate buffet (the promoter is active).
wild- S.mutans without construct.


Figure 2. Measurements of absorbance of biofilm at 6 hours incubation.

Figure 3. Measurements of absorbance of biofilm at 8 hours incubation.

Safety Regulation System
Light system was designed to target the origin of replication (ori) of pMSP3535 vector for Nisin-Controlled Expression in Gram + bacteria such as Streptococcus mutans. sgRNA was synthesized to target ori and was put under nlmAB promoter (activated by Competence Stimulating Peptide). To construct Safety Regulation FixK2 (K592006)+rbs(B0034)+tetR (C0040)+double terminator (B0012-B0013)+Pveg(K143012)+FixJ(K592005) parts were used. Due to absence of PstI restriction enzyme, we have used the method described in "Circular polymerase extension cloning for high-throughput cloning of complex and combinatorial DNA libraries" by Jiayuan Quan and Jingdong Tian. However, our team faced a challenge in ligating Pveg + FixJ.

VicK part
Our team worked on transcriptional inhibition of VicK gene that is responsible for lactic acid production in S.mutans. We have submitted to the Registry sgRNA for VicK, however we were not able to characterize the part. We faced a problem with ligation of dCas9 (K1323002) into pMSP3535 vector (nisin regulated). We have an S.mutans that was transformed with sgVicK and still working on ligating dCas9 into pMSP3535 vector.

References

1. Sasaki, Y., Nogami, E., Maeda, M., Nakanishi-Matsui, M., & Iwamoto-Kihara, A. (2014). A unique F-type H+-ATPase from Streptococcus mutans: An active H+ pump at acidic pH. Biochemical and biophysical research communications, 443(2), 677-682.
2.Wendi L. Kuhnert,Guolu Zheng,Roberta C. Faustoferri, and Robert G. Quivey, Jr.(2004). The F-ATPase Operon Promoter of Streptococcus mutans Is Transcriptionally Regulated in Response to External pH, JOURNAL OF BACTERIOLOGY, Dec. 2004, p. 8524–8528
3.Tianlei Liu, Shoubin Xue, Wenbo Cai, Xiaojing Liu, Xiaojuan Liu, Rongrong Zheng, Hongyan Luo, Wenhui Qi.ComCED signal loop precisely regulates nlmC expression in Streptococcus mutans.Ann Microbiol (2014) 64:31–38
4.M. Dilani Senadheera, Bernard Guggenheim, Grace A. Spatafora, Yi-Chen Cathy Huang, Jison Choi,4 David C. I. Hung,4 Jennifer S. Treglown, Steven D. Goodman, Richard P. Ellen, and Dennis G. Cvitkovitch. A VicRK Signal Transduction System in Streptococcus mutans Affects gtfBCD, gbpB, and ftf Expression, Biofilm Formation, and Genetic Competence Development,JOURNAL OF BACTERIOLOGY, June 2005, p. 4064–4076.