Difference between revisions of "Template:Team:Groningen/CONTENT/EXPERIMENTS/Colony PCR thrC locus 2 (th18)"
| Line 21: | Line 21: | ||
</div> | </div> | ||
</div> | </div> | ||
| − | <div class="caption"> | + | <div class="caption">Used primers.</div> |
</div> | </div> | ||
Latest revision as of 23:14, 21 November 2015
00:00, 4 September 2015 - 00:00, 4 September 2015
Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.
Primer
Sequence
IGEM thrC forward
AATTCATGTAAAAGATGAGGTTGGTTCATT
iGEM erm-thrC rev 2
AGGAAGTTAAAGGAGCTCGAATTAATTCC
Used primers.
The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.