Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"
Line 4: | Line 4: | ||
<html> | <html> | ||
+ | |||
+ | |||
+ | |||
<b>13/07</b> | <b>13/07</b> | ||
+ | |||
<ul> | <ul> | ||
<li>Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.</li> | <li>Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.</li> | ||
Line 156: | Line 160: | ||
<br/> | <br/> | ||
<br/> | <br/> | ||
+ | |||
+ | |||
+ | |||
<b>14/07</b><br/> | <b>14/07</b><br/> | ||
+ | |||
Launched the two different PCR with different Tm.<br/><br/> | Launched the two different PCR with different Tm.<br/><br/> | ||
PCR with high annealing temperature, 35 cycles:<br/> | PCR with high annealing temperature, 35 cycles:<br/> | ||
Line 396: | Line 404: | ||
<br/> | <br/> | ||
Measurement of DNA concentration | Measurement of DNA concentration | ||
+ | |||
+ | |||
<br/><br/><b>20/07</b><br/><br/> | <br/><br/><b>20/07</b><br/><br/> | ||
+ | |||
-Annealing of o15.072 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAG) and o15.073 (AATTCTCCCCCAAGTCTTCGAAGACAAGCATGG) thanks to the protocol used previously. | -Annealing of o15.072 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAG) and o15.073 (AATTCTCCCCCAAGTCTTCGAAGACAAGCATGG) thanks to the protocol used previously. | ||
Line 423: | Line 434: | ||
</tr> | </tr> | ||
</table> | </table> | ||
+ | |||
+ | |||
<br/><br/><b>21/07</b><br/><br/> | <br/><br/><b>21/07</b><br/><br/> | ||
+ | |||
Digestion of amplified band of pSIPnew and pKV6 with respectively XbaI/SalI and EcoRI/SalI using the following protocol. | Digestion of amplified band of pSIPnew and pKV6 with respectively XbaI/SalI and EcoRI/SalI using the following protocol. | ||
Line 516: | Line 530: | ||
</table> | </table> | ||
<br> | <br> | ||
+ | |||
+ | |||
<br><br><b>22/07</b><br><br> | <br><br><b>22/07</b><br><br> | ||
+ | |||
<b>Transformation results</b> | <b>Transformation results</b> | ||
<table style="width=100%"> | <table style="width=100%"> | ||
Line 554: | Line 571: | ||
</tr> | </tr> | ||
</table> | </table> | ||
+ | |||
+ | |||
<br><br><b>23/07</b><br><br> | <br><br><b>23/07</b><br><br> | ||
+ | |||
Preparation of DH5α Electrocompetent cells, 50 tubes of 100µL. | Preparation of DH5α Electrocompetent cells, 50 tubes of 100µL. | ||
Line 587: | Line 607: | ||
</br> | </br> | ||
overnight cultures of 3 p15.01 transformants. | overnight cultures of 3 p15.01 transformants. | ||
+ | |||
+ | |||
<br><br><b>24/07</b><br><br> | <br><br><b>24/07</b><br><br> | ||
+ | |||
Miniprep of the 3 overnight cultures of p15.01 transformants T1, T2 and T3(respective concentration: 204.8, 160.7 and 267.7 ng/µL).<br> | Miniprep of the 3 overnight cultures of p15.01 transformants T1, T2 and T3(respective concentration: 204.8, 160.7 and 267.7 ng/µL).<br> | ||
Digestion of pKV6(negative control) and p15.01 with BbsI and Eco31I to control the insertion of the two BbsI sites in p15.01. | Digestion of pKV6(negative control) and p15.01 with BbsI and Eco31I to control the insertion of the two BbsI sites in p15.01. | ||
Line 611: | Line 634: | ||
<b>HERE IS THE PICTURE OF THE CORRESPONDING GEL</b><br> | <b>HERE IS THE PICTURE OF THE CORRESPONDING GEL</b><br> | ||
<br> | <br> | ||
− | Both T2 and T3 transformants present the same bands as pKV6, whereas T1 shows 3 bands at 2.7kb, 1.7kb and 1.4kb.<br> | + | Both T2 and T3 transformants present the same bands as pKV6, whereas T1 shows 3 bands at 2.7kb, 1.7kb and 1.4kb.<br><br> |
− | + | ||
Oligos used for sequencing are <b>o15.097</b>(CGGTAGAGCTCCCTTCTATGC) and <b>o15.098</b>(CTGGCACGACAGGTTTCCC).<br> | Oligos used for sequencing are <b>o15.097</b>(CGGTAGAGCTCCCTTCTATGC) and <b>o15.098</b>(CTGGCACGACAGGTTTCCC).<br> | ||
Overnight of T1 in LB+ery(150µG/mL).<br> | Overnight of T1 in LB+ery(150µG/mL).<br> | ||
Line 636: | Line 658: | ||
Cells were plated on two LB + erythromycin (200µg/mL) plates. The first was inoculated with 50µL, the second with | Cells were plated on two LB + erythromycin (200µg/mL) plates. The first was inoculated with 50µL, the second with | ||
µL. | µL. | ||
+ | |||
+ | |||
<br><br><b>25/07</b><br><br> | <br><br><b>25/07</b><br><br> | ||
Line 687: | Line 711: | ||
Time constants were 5.3 for all the pulses. | Time constants were 5.3 for all the pulses. | ||
pKV6 was plated on LB + erythromycin (200µg/mL); pSIP411 and p15.02 were plated on LB + erythromycin (150µg/mL) and LB + erythromycin (200µg/mL). | pKV6 was plated on LB + erythromycin (200µg/mL); pSIP411 and p15.02 were plated on LB + erythromycin (150µg/mL) and LB + erythromycin (200µg/mL). | ||
+ | |||
Line 731: | Line 756: | ||
− | |||
To prevent the transformation of the native pSIP411 (non-digested or re-circularized), we decided to PCR the 3kb fragment containing the ORI and the erythromycin resistance gene, digest it with SalI/XbaI, PCR purify it and then gel purify it. | To prevent the transformation of the native pSIP411 (non-digested or re-circularized), we decided to PCR the 3kb fragment containing the ORI and the erythromycin resistance gene, digest it with SalI/XbaI, PCR purify it and then gel purify it. | ||
This would give us only the fragment we want to ligate and thus prevent background transformants to appear. | This would give us only the fragment we want to ligate and thus prevent background transformants to appear. | ||
Line 765: | Line 789: | ||
To get a fresher batch of annealed oligos, we decided to anneal them again, using the same protocol. | To get a fresher batch of annealed oligos, we decided to anneal them again, using the same protocol. | ||
(o15.011+o15.012 and o15.072+o15.073). | (o15.011+o15.012 and o15.072+o15.073). | ||
+ | |||
+ | The three minipreps from p15.01 transformants were send to sequencing thanks to GATC LightRun NightXpress service.<br> | ||
+ | 5µL (~100ng/µL) of all three minipreps were mixed with <b>o15.097</b> (forward primer, CGGTAGAGCTCCCTTCTATGC) or <b>o15.098</b> (reverse primer, CTGGCACGACAGGTTTCCC).<br> |
Revision as of 18:06, 12 August 2015