Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Cloepierson (Talk | contribs) |
Cloepierson (Talk | contribs) |
||
Line 24: | Line 24: | ||
<br><h3>Gene PHO80</h3> | <br><h3>Gene PHO80</h3> | ||
− | 5’Primer of | + | 5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast. |
<br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT | <br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT | ||
Line 63: | Line 63: | ||
<br><h1>12/08/15</h1> | <br><h1>12/08/15</h1> | ||
<h2>Culture</h2> | <h2>Culture</h2> | ||
− | The Saccharomyces cerevisiae SK1 was thaw and sow 100µL of it on YPD medium overnight. (at 30°C) | + | The <i>Saccharomyces cerevisiae</i> SK1 was thaw, and sow 100µL of it on YPD medium overnight. (at 30°C) |
<br>This yeast will be transformed.<br> | <br>This yeast will be transformed.<br> | ||
<br><h2>PCR</h2> | <br><h2>PCR</h2> | ||
− | 3 PCR were realized on | + | 3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.<br> |
<br> | <br> | ||
Protocol: | Protocol: |
Revision as of 20:31, 14 August 2015