Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 63: Line 63:
 
<br><h1>12/08/15</h1>
 
<br><h1>12/08/15</h1>
 
<h2>Culture</h2>
 
<h2>Culture</h2>
−
The <i>Saccharomyces cerevisiae</i> SK1 was thaw, and sow 100µL of it on YPD medium overnight. (at 30°C)
+
The <i>Saccharomyces cerevisiae SK1</i> was thaw, and sow 100µL of it on YPD medium overnight. (at 30°C)
 
<br>This yeast will be transformed.<br>
 
<br>This yeast will be transformed.<br>
 
<br><h2>PCR</h2>
 
<br><h2>PCR</h2>
Line 159: Line 159:
 
<br>
 
<br>
 
<img src="https://static.igem.org/mediawiki/2015/e/e0/ParisBettencourt_ElectrophoresisPCRKanResistance.png" width="350px"><br>
 
<img src="https://static.igem.org/mediawiki/2015/e/e0/ParisBettencourt_ElectrophoresisPCRKanResistance.png" width="350px"><br>
−
We expected strips around 1.300bp.
+
We expected bands around 1.300bp.
−
The strip corresponding to marker with FRT is bigger than the two others strips wich have just the Kan resistance with tails.<br>
+
The band corresponding to marker with FRT is bigger than the two others strips wich have just the Kanamycin resistance with tails.<br>
  
 
<br><h2>pre-culture</h2>
 
<br><h2>pre-culture</h2>
−
Swo one colony <i>Saccharomyces cerevisiae</i> SK1 of the yesterday in 5mL of the liquid YPD medium, let 's grow overnight.<br>
+
Swo one colony <i>Saccharomyces cerevisiae SK1</i> of the yesterday in 5mL of liquid YPD medium, let 's grow overnight.<br>
  
 
<br><h1>14/08/15</h1>
 
<br><h1>14/08/15</h1>

Revision as of 21:29, 14 August 2015

Background

Aims

Results

Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.

5/08/15

Design primers


Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC-5’

- tail homology PHO85
- Primer Kanamycin

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
GCATTC-5’

- tail homology PHO80
- Primer Kanamycin

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- FRT
- Primer Kanamycin

12/08/15

Culture

The Saccharomyces cerevisiae SK1 was thaw, and sow 100µL of it on YPD medium overnight. (at 30°C)
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

13/08/15

PCR purification

Protocol: Dilute PCR product (5 or 10 times ?) with the resuspension buffer
Pour it in a purification column
Centrifuge 30sec at 14K rpm
Throw the filtrat
Add 700µL of EtOH (washing solution)
Centrifuge 30sec at 14K rpm
Throw the filtrat
Add 500µLof washing solution
Centrifuge 30sec at 14K rpm
Throw the filtrat
Centrifuge 30sec at 14K rpm
Throw the filtrat
Put the column in a Eppendorf
Add 45µL of RNAse/DNAse free water right on the membrane
Wait 2min
Centrifuge 2min at 10K rpm

PCR The PCR control with an electrophoresis




We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips wich have just the Kanamycin resistance with tails.

pre-culture

Swo one colony Saccharomyces cerevisiae SK1 of the yesterday in 5mL of liquid YPD medium, let 's grow overnight.

14/08/15