Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 266: Line 266:
 
<br><span style="color:#179A89"> -&nbsp;Primer Kanamycin </span><br>
 
<br><span style="color:#179A89"> -&nbsp;Primer Kanamycin </span><br>
  
−
 
+
<br><h1>August 19th</h1>
  
  

Revision as of 10:07, 19 August 2015

August 8th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’

- tail homology PHO85
- Primer Kanamycin

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’

- tail homology PHO80
- Primer Kanamycin

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- FRT
- Primer Kanamycin

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

Figure 1:Times and temp of PCR


August 13rd

PCR purification

Protocol :
  • Dilute PCR product (5 or 10 times ?) with the resuspension buffer
  • Pour it in a purification column
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Add 700µL of EtOH (washing solution)
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Add 500µLof washing solution
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Put the column in a Eppendorf
  • Add 45µL of RNAse/DNAse free water right on the membrane
  • Wait 2min
  • Centrifuge 2min at 10K rpm

    • PCR control with an electrophoresis



    We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.

    Figure 2:Result of PCR.


    Pre-culture

    Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.

    August 14th

    Transformation of yeast

    Protocol :
    • After growth, determine the titer of the yeast culture by using spectrophotometer : pipette 10µL of cells into 1mL of wtaer in spectrophotometer cuvette and measure the OD at 600nm.
    • Add 2.5x108 cells to 50mL of 2X YPD in a culture flask.
    • Incubate the flask in a shaking incubator at 30°C until the cell culture is at least 2x107 cells.mL-1
    • Denature 1mL of carrier DNA at 99°C for 5min and chill immediately in ice.
    • Harvest the yeast cells by centrifugation at 3,000g for 5min.
    • Resuspend the pellet in 25mL of sterile water and centrifuge at 3,000g for 5min at 20°C. Repeat this wash with sterile water 2 times.
    • Resuspend the last pellet in 1mL of sterile water.
    • Transfer the cell suspension to a 1.5mL microcentrifuge tube.
    • Centrifuge for 30s at 13,000g and discard the supernatant.
    • Resuspend the cells in 1mL of sterile water and pipette 100µL samples into 1.5mL microcentrifuge tubes, one for each transformation.
    • For each transformation :
      • 240µL of PEG 3350 (50% (w/v))
      • 36µL of LiAc 1.0M
      • 50µL of single-stranded carrier DNA (2.0mg.mL-1)
      • 6µL of PCR product
      • 28µL of water DNAse Free
    • Place the tubes at 42°C for 40min.
    • Centrifuge the tubes at 13,000g for 30s in a microcentrifuge tube and remove the supernatant.
    • Pipette 1mL of YPD liquid medium into the transformation tube, and vortex mix to resuspend pellet.
    • Incubate 3h at 30°C to ensure good antibiotic expression.
    • Plate 2, 20 and 200µL of the cell suspension onto YPD medium with 200µm.mL-1 antibiotic G418.
    • Incubate the plates at 30°C for 3 days.


    August 17th

    Result of plates:

    There is a culture in plates.
    The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
    We will repeat this control on an agar plate and not in a liquid medium.

    We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.






    The positive control is well, yeast to multiply of YPD agar without antibiotic. Yeast is not dead, if we observe of other agar is not a contamination.

    We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.

    We look only few colonies in the plates with yeast transforming PHO80.

    The result is good transformation is perform well.

    Figure 3:Negative control

    Figure 4:positive control and Result of transformation

    Verification of the results

    Thanks to the colony PCR, to determinate if the resistance is integrated.
    Create the primer:
    Primer 5'-3' PHO80
    ATCATAAGACGAGGATATCCTTTGGAG
    Primer 3'-5' PHO80
    CTCAATCATGATTGCTTTCATAATACCCC
    Primer 5'-3' PHO85
    TATCATTATATATACATGGCTACGGTTTTTCG
    Primer 3'-5' PHO85
    AAGGGATATATAGCGCGGCAAACTG
    Primer 5'-3' FRT+PHO85
    TATCATTATATATACATGGCTACGGTTTTTCG
    Primer 3'-5' FRT+PHO85
    AAGGGATATATAGCGCGGCAAACTG

    August 18th

    Verification of the new negativ control

    The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.

    Figure 5:Result of the new negative control

    Problem of FRT

    The transformation with the FRT has run well, but the flipase we have is integration of the E.coli plasmide. We can't use this plasmid, it will be rejected by yeast.
    Other transformtion with Cre lox is possible.
    Cre lox: is a gene which has the same fonction FRT, it not cup thanks to the flipase but thanks to the Cre recombinase.

    We creates two primer for the new transformation with Cre lox.

    Primer 5'-3' Cre lox + PHO 85

    5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’

    Primer 3'-5' Cre lox + PHO 85

    3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’

    - tail homology PHO85
    - Cre lox
    - Primer Kanamycin

    August 19th