Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 141: Line 141:
 
<br><h1>August 13rd</h1>
 
<br><h1>August 13rd</h1>
 
<h2>PCR Purification</h2>
 
<h2>PCR Purification</h2>
<B>Protocol : </B>
+
Protocol :
<ul>
+
<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification </a>  
  <li><u>Dilute</u> PCR product (5 or 10 times ?) with the resuspension  buffer<br></li>
+
  <li><u>Pour</u> it in a purification column<br></li>
+
  <li><u>Centrifuge</u> 30sec at 14K rpm<br></li>
+
  <li><u>Throw</u> the filtrat<br></li>
+
  <li><u>Add</u> 700µL of EtOH (washing solution)<br></li>
+
  <li><u>Centrifuge</u> 30sec at 14K rpm<br></li>
+
  <li><u>Throw</u> the filtrat<br></li>
+
  <li><u>Add</u> 500µLof washing solution<br></li>
+
  <li><u>Centrifuge</u> 30sec at 14K rpm<br></li>
+
  <li><u>Throw</u> the filtrat<br></li>
+
  <li><u>Centrifuge</u> 30sec at 14K rpm<br></li>
+
  <li><u>Throw</u> the filtrat<br></li>
+
  <li><u>Put</u> the column in a Eppendorf<br></li>
+
  <li><u>Add</u> 45µL of RNAse/DNAse free water right on the membrane<br></li>
+
  <li><u>Wait</u> 2min<br></li>
+
  <li><u>Centrifuge</u> 2min at 10K rpm<br></li>
+
</ul>
+
 
<br>
 
<br>
 
<h2>PCR control with an electrophoresis</h2><br>
 
<h2>PCR control with an electrophoresis</h2><br>

Revision as of 14:31, 19 August 2015

August 8th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’

- tail homology PHO85
- Primer Kanamycin

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’

- tail homology PHO80
- Primer Kanamycin

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- FRT
- Primer Kanamycin

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

Figure 1: PCR cycle


August 13rd

PCR Purification

Protocol : PCR purification

PCR control with an electrophoresis



We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.

Figure 2:Result of PCR


Pre-culture

Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.

August 14th

Transformation of yeast
Protocol: Heat shock transformation for yeast

August 17th

Result of plates:

There is a culture in plates.
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.

We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.






The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.

We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.

We look only few colonies in the plates with yeast transforming PHO80.

The result is well, transformation works.

Figure 3:Negative control

Figure 4:Positive control and Result of transformation

Verification of the results

Thanks to the colony PCR, to determinate if the resistance is integrated.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG

August 18th

Verification of the new negativ control

The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.

Figure 5:Result of the new negative control

Problem of FRT

The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with Cre lox system is possible.
Cre lox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.

We create two primers for the new transformation with Cre lox.

Primer 5'-3' Cre lox + PHO 85

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’

Primer 3'-5' Cre lox + PHO 85

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- Cre lox
- Primer Kanamycin

August 19th